Application of SlRAV1 gene in regulating tomato fruit early maturity and quality

Abstract

The application provides application of SlRAV1 gene in regulating early maturity and quality of tomato fruits, and the nucleotide sequence of the SlRAV1 gene is shown as SEQ ID NO. 1. The application constructs a transgenic tomato plant with the SlRAV1 gene knocked out, and finds that the rav1 transgenic tomato fruits are earlier in color change by recording the days required from flowering to the color breaking stage of wild type and mutant tomato fruits; compared with the wild type fruits at the same period, the mutant fruits have increased accumulation of lycopene, increased contents of soluble sugar and organic acid.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, and in particular to the application of the SlRAV1 gene in regulating the early ripening and quality of tomato fruits. Background Technology

[0002] Tomatoes (Solanum lycopersicum L.) have a long history of cultivation and have become one of the most widely grown horticultural crops in the world. Their fruits have a unique flavor and are rich in nutrients, making them a popular choice in many diets. my country is a major producer and consumer of tomatoes, and developing high-yield, high-quality tomato varieties has always been a goal for many breeders.

[0003] Tomato fruit development consists of three stages: cell division, cell enlargement, and fruit ripening. The cell enlargement stage determines tomato yield. The ripening process is accompanied by a series of physiological and biochemical changes in fruit color, texture, and flavor, resulting in tomatoes rich in various nutrients. The color changes during ripening are mainly due to chlorophyll degradation and the accumulation of carotenoids such as lycopene, β-carotene, and lutein. In particular, the lycopene in ripe tomatoes can effectively prevent cardiovascular disease and prostate cancer, making it highly beneficial to human health.

[0004] The starch accumulated during fruit development is gradually broken down into smaller oligosaccharides and monosaccharides such as sucrose, glucose, and fructose as the fruit ripens, playing a crucial role in enhancing the fruit's sweetness. Organic acids are another major category of components in tomatoes, and their levels significantly affect the fruit's taste. Citric acid and malic acid are the two most abundant organic acids in tomatoes, and their levels show increasing and decreasing trends, respectively, during fruit ripening. The taste of the fruit largely depends on the ratio of sugars to organic acids in it.

[0005] As a climacteric fruit, the ripening process of tomatoes is typically accompanied by a rapid increase in ethylene content and a surge in respiration. Ethylene plays a central role in regulating the ripening process of tomatoes and other climacteric fruits. The AP2 / ERF transcription factor family includes three subfamilies: AP2 (APETALA2), ERF, and RAV. Previous studies have reported that ERF is located at the end of the ethylene signaling pathway, mediating ethylene regulation of the expression of genes related to tomato fruit ripening, thereby affecting fruit ripening process and quality. For example, the SlERF.F12 gene knockout mutant produces fruit that ripens earlier and has increased lycopene content. Besides the ERF subfamily, the AP2 subfamily has also been reported to participate in the ripening process of tomato fruit. However, unlike the SlERF.F12 gene, the SlAP2a gene knockout mutant has increased ethylene synthesis and earlier color change, but reduced lycopene content in the fruit. (Liu M, Gomes BL, Mila I, et al. Comprehensive Profiling of Ethylene Response Factor Expression Identifies Ripening-Associated ERF Genes and Their Link to Key Regulators of Fruit Ripening in Tomato. Plant Physiol. 2016, 170(3): 1732-1744. Doi: 10.1104 / pp. 15.01859.;Deng H, Chen Y, Liu Z, Liu Z, Shu P, Wang R, Hao Y, Su D, Pirrello J, Liu Y, Li Z, Grierson D, Giovannini JJ, Bouzayen M, Liu M.SlERF.F12modulates the transition to ripening in tomato fruit by recruiting the co-repressor TOPLESS and histone deacetylases to repress key ripeninggenes.Plant Cell 2022,34(4):1250-1272.Doi:10.1093 / plcell / koac025.).

[0006] To date, there have been no research reports on the regulation of tomato fruit ripening and quality formation by the RAV subfamily, to which the tomato SlRAV1 gene belongs. Summary of the Invention

[0007] This invention provides a new application of the SlRAV1 gene in regulating the early maturity and quality of tomato fruits. The SlRAV1 gene knockout mutant has increased lycopene, soluble sugar and organic acid content in its fruits, and the fruit coloring time is advanced, providing a reference for creating early-maturing, high-quality tomato germplasm resources.

[0008] The specific technical solution is as follows:

[0009] This invention provides the application of the SlRAV1 gene in regulating the early ripening of tomato fruits, and the nucleotide sequence of the SlRAV1 gene is shown in SEQ ID NO.1.

[0010] Furthermore, the regulatory pathway involves knocking out the SlRAV1 gene to promote earlier ripening of tomato fruits.

[0011] The present invention also provides the application of the SlRAV1 gene in regulating the quality of tomato fruit, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0012] Furthermore, the regulatory pathway involves increasing the content of lycopene, soluble sugars, and organic acids in tomatoes by knocking out the SlRAV1 gene.

[0013] This invention constructed transgenic tomato plants with the SlRAV1 gene knocked out. The results showed that the SlRAV1 gene knockout could promote an increase in the ethylene release rate, thereby causing the tomato fruit to change color earlier, and also increasing the accumulation of lycopene, soluble sugars and organic acids.

[0014] Furthermore, in the aforementioned application, the method for constructing a mutant by knocking out the SlRAV1 gene is as follows:

[0015] (1) Design the target sequence sgRNA of the SlRAV1 gene and construct a CRISPR / Cas9 vector for editing the tomato SlRAV1 gene;

[0016] (2) The CRISPR / Cas9 vector was transferred into Agrobacterium competent cells to obtain Agrobacterium containing the CRISPR / Cas9 vector;

[0017] (3) The cotyledons of common wild-type tomatoes were infected with Agrobacterium tumefaciens containing the SlRAV1 gene editing vector. Seedlings were obtained again through tissue culture, and mutant plants with SlRAV1 gene deletion were screened.

[0018] Furthermore, the vector is PAEE401; the host cell is Agrobacterium GV3101.

[0019] Furthermore, the target sequence sgRNA is as shown in SEQ ID NO.2 or as shown in SEQ ID NO.3.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] This invention constructed transgenic tomato plants with the SlRAV1 gene knocked out. By recording the number of days required from flowering to fruit coloring in wild-type and mutant tomatoes, it was found that the fruits of the rav1 transgenic tomatoes changed color earlier. Compared with wild-type fruits at the same time, the mutant fruits had increased lycopene accumulation, soluble sugar and organic acid content. Attached Figure Description

[0022] Figure 1 The results are from the SlRAV1 gene knockout tomato plants in Example 1.

[0023] Figure 2 The following figures illustrate the expression of the SlRAV1 gene in different tissues and organs of tomato in Example 2. Root represents the root; Stem represents the stem; Leaf represents the leaf; Flower represents the flower; 10d, 20d, 30d, 40d, and 45d represent 10, 20, 30, 40, and 45 days after flowering, respectively; MG represents the green ripening stage (the fruit is fully enlarged, but the peel is greenish-blue, the flesh is firm, and the nutrient tissue formed by the placenta surrounding the seeds has become gelatinous; Sargent SA. Tomato production guide for Florida: harvest and handling. Florida: Cooperative extension service, Institute of Food and Agricultural Sciences 1997.); Br represents the color-breaking stage (the tip of the fruit begins to change from greenish-blue to yellowish-white, and the flesh begins to soften); Br+1, Br+3, Br+5, and Br+7 represent one, three, five, and seven days after color breaking, respectively; Relative Expression represents the relative gene expression level.

[0024] Figure 3 The images show the fruit coloring of wild-type tomato plants and SlRAV1 gene knockout plants in Example 3 at 47, 49, 51, 53, 55, and 57 days after flowering; WT represents the common wild-type tomato variety Condine Red; rav1-1# and rav1-2# represent two SlRAV1 gene knockout lines.

[0025] Figure 4 This refers to the number of days required from flowering to fruit color breaking in wild-type, rav1 tomato plants in Example 3.

[0026] Figure 5 The values ​​represent the lycopene (A), β-carotene (B), and lutein (C) content of wild-type and rav1 tomato fruits in Example 3 at Br+3, Br+5, and Br+7.

[0027] Figure 6 The values ​​represent the soluble solids (A), soluble sugars (B), and organic acids (C) content of wild-type, rav1 tomato fruits at Br+10 in Example 3.

[0028] Figure 7 The fruit hardness of wild-type and rav1 tomato plants in Example 3 is measured at Br, Br+1, Br+3, Br+5, and Br+7, where Br+1, Br+3, Br+5, and Br+7 represent one day, three days, five days, and seven days after color breakage, respectively.

[0029] Figure 8 The ethylene release rates of wild-type and rav1 tomato fruits in Example 3 are Br, Br+1, Br+3, Br+5, and Br+7, where Br+1, Br+3, Br+5, and Br+7 represent one day, three days, five days, and seven days after color breakage, respectively. Detailed Implementation

[0030] The present invention will be further described below with reference to the accompanying drawings and specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Operating methods not specifically specified in the following embodiments are generally performed under conventional conditions or as recommended by the manufacturer.

[0031] Example 1: Obtaining SlRAV1 gene knockout plants

[0032] 1. Construction of CRISPR / Cas9 gene editing vector for SlRAV1 gene

[0033] The tomato SlRAV1 gene sequence was obtained from the NCBI database (http: / / www.ncbi.nlm.nih.gov / ). Using CRISPR-P at (https: / / www.genome.arizona.edu / crispr / CRISPRsearch.html), SlRAV1 gene sgRNA (small guide RNA) targets were designed: target 1: CTCCCCATCAACCATTTCCC; target 2: ACAGACGCTGACTCCACAAA.

[0034] Figure 1A shows the location and sequence of two sgRNAs (sgRNA1 and sgRNA2) in the tomato SlRAV1 gene. The three underlined bases at the bottom of the sequence are PAM sequences. sgRNA1 is CTCCCCATCAACCATTTCCCCGG (SEQ ID No. 3); sgRNA2 is ACAGACGCTGACTCCACAAACGG (SEQ ID No. 4).

[0035] The specific construction process of the carrier:

[0036] First, PCR amplification primers containing target one and target two were designed, and PCR fragments targeting the two targets were amplified using plasmid Y0014472-1 as a template. The specific primer sequences are shown in Table 1. The two amplified PCR products were ligated into the PAEE401 plasmid containing the BbsI restriction enzyme site using the GoldenGate assembly kit (BsaI-HFv2) (NEB, E1601). Sequencing verification by a sequencing company confirmed the successful construction of the vector PAEE401-SlRAV1.

[0037] Table 1. PCR primer sequences for constructing CRISPR / Cas9 vectors

[0038]

[0039] 2. Obtaining SlRAV1 gene-edited CRISPR / Cas9 gene-edited plants

[0040] Agrobacterium was obtained by electroporation and transformed with recombinant plasmid PAEE401-SlRAV1. The competent Agrobacterium was Agrobacterium GV3101. The cotyledons of the wild-type tomato variety Condine Red (CR) were infected with Agrobacterium, and the infected cotyledons were then developed into complete transgenic tomato plants through plant tissue culture.

[0041] Subsequently, primers were designed upstream and downstream based on the target location; the primers were cri-rav1-F: ACAATACCCACATCTCAATATCTTC (SEQ ID No. 9) and cri-rav1-R: CCAATACGAATATCGAAATCGCC (SEQ ID No. 10).

[0042] The extracted DNA from the transgenic plants was amplified using PCR and sequenced for verification. Heterozygous T0 generation plants with mutation types of 1-base insertion and 4-base deletion (rav1-#1) and 1-base insertion and 7-base deletion (rav1-#2) were obtained through screening. These were then self-crossed to obtain T1 generation homozygous rav1-#1 and rav1-#2 plants. Figure 1 B).

[0043] Example 2: Expression of the SlRAV1 gene in different tissues and organs of tomato

[0044] Real-time fluorescence quantitative PCR was employed, using the SYBR fluorescent dye (Vazyme) and a mixed reaction system according to the manufacturer's instructions (Nanjing Novizan). The expression of the SlRAV1 gene in different tissues and organs of tomato was determined using a 480Ⅱ real-time PCR instrument (Roche, CH). The specific primers for the SlRAV1 gene were (RT-SlRAV1-F: 5'-CGTTGTAACAGACGCTGACT-3' (SEQ ID No. 11); RT-SlRAV1-R: 5'-TGGTTGAGGGACAACACCTT-3' (SEQ ID No. 12)). After the assay, tomato Actin was used as an internal reference gene, and 2 -△△CT The relative expression level of the target gene was calculated using a method (Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using Real-Time Quantitative PCR and the 2 -ΔΔCT method. Methods 25(4):402-408. https: / / doi.org / 10.1006 / meth.2001.1262.).

[0045] The results showed that the SlRAV1 gene was expressed in tomato roots, stems, leaves, flowers, and fruits, with higher expression levels at flowering, 30, 40, and 45 days after flowering, and during the green ripening stage. Expression levels decreased during and after the fruit ripening stage. Figure 2 ).

[0046] Example 3: Observation of SlRAV1 gene knockout and wild-type tomato fruit ripening phenotype, and determination of ethylene, firmness, carotenoids, soluble solids, soluble sugars, and organic acid content.

[0047] The experimental material consisted of wild-type tomato plants with the WT and SlRAV1 gene knockouts. Tomato seeds, sterilized with potassium permanganate, were immersed in Erlenmeyer flasks filled with water and germinated at a constant speed of 200 rpm / min at 28℃ for approximately 2 days. When the radicles of the seeds emerged and were 0.5–1 cm in length, they were sown into 72-cell trays (peat moss:vermiculite ratio 3:1) and then cultured in a plant factory under an environment with a light intensity of 200 μmol / m². -2 s -1The photoperiod is 12h / 12h, the day / night temperature is 25℃ / 20℃, and the relative humidity is 70%–80%. Water with Hoagland nutrient solution 2–3 times per week. When the seedlings have 3 leaves and 1 bud, transplant them individually into nutrient pots with a bottom diameter of 7cm and a height of 9cm. Place them in a plant factory for further cultivation. When the plants have grown to approximately 6 leaves and 1 bud, transplant all plants together to the greenhouse. The cultivation conditions are: 400–800 μmol / m³. -2 s -1 Light intensity (PPFD), daytime temperature maintained at 23-25℃, nighttime temperature maintained at 18-20℃, water with Hoagland nutrient solution every 2 days on sunny days, and every 3 days on cloudy days.

[0048] (1) Statistics on fruit ripening

[0049] Starting with the fruit phenotypes of wild-type and rav1 mutant tomatoes 47 days after flowering, the fruit phenotypes of different strains in this invention were photographed and recorded. Results are as follows: Figure 3 As shown, the fruit ripening process of the rav1 gene knockout mutant line was faster than that of the wild type.

[0050] The number of days required for different strains from flowering to fruit color development was statistically analyzed, such as... Figure 4 As shown, the data displayed is the average of 15 repetitions. A Turkey test was used, and the standard error is shown by a vertical line.

[0051] (2) Extraction and content detection of carotenoids from fruits

[0052] Weigh 0.3g of tomato pulp and grind it thoroughly with liquid nitrogen, then transfer it to a 2mL centrifuge tube. Add 350μL of methanol, 700μL of chloroform, and 350μL of ddH2O in sequence, then vortex to mix. Centrifuge at 10000g for 10 min at 4℃, and collect the chloroform phase. Add another 700μL of chloroform to the remaining residue tube, repeating this extraction process several times until colorless. Combine the collected chloroform phases and dry the collection tube with nitrogen. Then add 350μL of methanol solution (w / v) containing 6% KOH to dissolve the precipitate, and derivatize at 60℃ in the dark for 30 min. Add 700μL of chloroform and 350μL of water, vortex to mix, and centrifuge at 10000g for 5 min at 4℃, collecting the chloroform phase. Add 700μL of water to the chloroform phase and extract again, repeating this process several times until the aqueous layer is neutral. The collected chloroform phase was dried under nitrogen, dissolved in 100 μL of chromatographic grade ethyl acetate, and centrifuged at 14000 g for 20 min at 4 °C to ensure complete settling of the precipitate. 150 μL of the supernatant was collected for high-performance liquid chromatography (HPLC) analysis. Four biological replicates were performed.

[0053] The injection procedure for carotenoids is described below. An Alliance 2695 system (Waters Corporation, USA) was used, containing the 2695 separation module and the 2996 PDA detector, equipped with a 5 μm C30 reversed-phase column (250 mm × 4.6 mm) and a 20 mm × 4.5 mm C30 pre-column (Waters Corp.). The column temperature was set to 25 °C, the flow rate to 1 mL / min, the injection volume to 20 μL, and the detection wavelength range to 220–600 nm. The mobile phase used a gradient elution with solvents A (methanol), B (80% methanol), and C (MTBE): 95% A + 5% B for 0–6 min, 80% A + 5% B + 15% C for 7–11 min, 30% A + 5% B + 65% C for 12–32 min, and 95% A + 5% B for 48–50 min, remaining unchanged until the end of the procedure, which lasted approximately 60 min. Data analysis was then performed using Waters Empower software, and the carotenoid components were systematically analyzed and identified based on the retention time and absorption spectrum curves of the standard samples.

[0054] Figure 5 A, B, and C show the contents of lycopene, β-carotene, and lutein, respectively. In the SlRAV1 gene knockout mutant tomatoes, the lycopene content was significantly higher than that of the wild type at Br+5 and Br+7, and the β-carotene content was significantly higher at Br+5. Lutein content showed no consistent change. The lycopene, β-carotene, and lutein content data are the averages of four replicates, and the standard error is shown by vertical lines. The Turkey test was used, with an asterisk indicating a 5% significance level difference between the mutant and the wild type.

[0055] (3) Detection of soluble solids content in fruit

[0056] After picking fresh tomatoes, cut them open from the middle and drip the juice directly onto the measuring panel of a portable fruit sugar meter (POCKET REFRACTOMETER PAL-1, Atago, Japan), ensuring the juice completely covers the measuring panel before taking a reading and recording it.

[0057] Depend on Figure 6 As shown in Figure A, the soluble solids content of the fruit from the SlRAV1 gene knockout mutant was significantly higher than that of the wild type. A Turkey test was used, with an asterisk indicating a 5% significance level between the mutant and the wild type.

[0058] (4) Determination of soluble sugar and organic acid content in fruit

[0059] Take 0.1 g of freeze-dried tomato fruit sample, grind it thoroughly, add 1 mL of ddH2O, react at 80℃ for 30 min, centrifuge (4℃, 10000 rpm, 10 min), take 1 mL of supernatant into a 10 mL centrifuge tube, add another 1 mL of ddH2O, repeat the above steps, and finally collect a total of 2 mL of supernatant. Take 20 μL of this supernatant and then add 980 μL of 80% chromatographic grade acetonitrile to dilute it 50 times. After dilution, take 100 μL into a sample vial, and use gas chromatography-mass spectrometry (GC-MS) (Shimadzu Corporation, Japan) to detect the content of soluble sugars (glucose, fructose, sucrose) and organic acids (malic acid, citric acid) in the solution.

[0060] Figure 6 B represents the soluble sugar content. Figure 6 C represents the organic acid content. Compared to the wild type, the rav1 mutant fruit has higher sucrose, glucose, and fructose content, no significant difference in citric acid, and higher malic acid content.

[0061] (5) Fruit firmness test

[0062] The firmness of tomato fruits at different ripening stages was measured. Five fruits from different strains were taken at each stage. About 1 cm of peel was removed from the top of the fruit and the stem end. Using a GY-1 type fruit firmness tester, the probe of the firmness tester was held perpendicular to the fruit surface and pressed down with steady force until the probe penetrated 2 mm into the diaphragm. The reading shown by the firmness tester at this time is the firmness of the flesh of this fruit. The hardness was measured on both the front and back sides.

[0063] Figure 7 Fruit firmness was measured in wild-type and tomato rav1 mutant plants. The rav1 mutant lines showed a faster decrease in firmness compared to the wild type. The Turkey test was used, with asterisks indicating a 5% significance level difference between different lines and the wild type.

[0064] (6) Determination of ethylene release rate from fruit

[0065] The ethylene release rate of tomato fruits at different ripening stages was determined. Each fruit was weighed and placed in a 330 mL sealed container, kept at room temperature and protected from light for 2 hours. More than 1 mL of headspace gas was drawn from the rubber tube at the top of each container using a syringe marked with 1 mL graduations. Four extractions were performed per container, serving as four technical replicates. Needles were inserted into prepared corks according to their corresponding labels. After samples were collected for each stage, they were injected into the gas chromatograph (Philips, UNICAM pro.GC) for analysis. A 1500 × 4 mm alumina glass column was used. The injector, detector, and column temperature were 130℃, 130℃, and 200℃, respectively. For each measurement, 1 mL of gas was injected quantitatively. Based on the reference peak position of standard ethylene gas (10 μL / L), the corresponding peak time and peak area were obtained using the analytical software provided with the gas chromatograph. The ethylene concentration in each sample was calculated, and the ethylene release per kilogram of sample per hour was calculated. The results are as follows: Figure 4 As shown in the figure. Six fruits were taken from each period for different strains as biological replicates. The data shown in the figure is the average of the six replicates, and the standard error is indicated by the vertical line.

[0066] Depend on Figure 8 It can be seen that the rav1 mutant has a higher ethylene release rate than the wild type, indicating that the SlRAV1 gene inhibits the release of ethylene from the fruit to some extent.

[0067] Based on the above research, this invention discovered that SlRAV1 gene knockout plants exhibit increased lycopene, soluble sugar, and organic acid content in their fruits, and earlier fruit ripening. This invention creates an early-maturing, high-quality tomato germplasm resource through SlRAV1 gene mutation, possessing significant potential application value.

[0068] Furthermore, it should be understood that after reading the above description of the present invention, those skilled in the art can make various alterations or modifications to the present invention, and these equivalent forms also fall within the scope defined by the appended claims.

Claims

1. SlRAV1 The application of genes in regulating the early ripening of tomato fruits is characterized by, The SlRAV1 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the regulatory pathway is through knockout. SlRAV1 Genes that promote the early ripening of tomato fruits.

2. SlRAV1 The application of genes in regulating tomato fruit quality is characterized by, The SlRAV1 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the regulatory pathway is through knockout. SlRAV1 Genes that increase the content of lycopene, soluble sugars and organic acids in tomatoes, wherein the organic acid is citric acid.

3. The application as described in claim 1 or 2, characterized in that, Knock out the SlRAV1 The method for constructing mutant genes is as follows: (1) Design SlRAV1 The target sequence sgRNA of the gene, constructing a tomato SlRAV1 Gene-editing CRISPR / Cas9 vectors; (2) Transform the CRISPR / Cas9 vector into Agrobacterium competent cells to obtain Agrobacterium containing the CRISPR / Cas9 vector; (3) Utilizing SlRAV1 Agrobacterium tumefaciens, a gene-editing vector, was used to infect the cotyledons of common wild-type tomatoes. Seedlings were then regenerated through tissue culture and selected. SlRAV1 Mutant plants with missing genes.

4. The application as described in claim 3, characterized in that, The vector was PAEE401; the host cell was Agrobacterium GV3101.

5. The application as described in claim 3, characterized in that, The target sequence sgRNA is shown in SEQ ID NO.2 or SEQ ID NO.3.

Images