Single-stranded circularized library and methods of construction and use thereof

Abstract

The application belongs to the field of gene sequencing, and discloses a single-stranded circular library and a construction method and application thereof. The construction method comprises the following steps: breaking, end-repairing and adapter-ligating a target DNA to obtain a ligation product; performing PCR amplification on the ligation product to obtain an amplification product; mixing the amplification product with an auxiliary circularization primer, heating to ligate the amplification product with the auxiliary circularization primer, then adding a ligase, and incubating to obtain a single-stranded circular library with a length of 500-2000 bp. The application further provides the single-stranded circular library constructed according to the above method, and further provides a sequencing method for long fragment DNA, which takes the single-stranded circular library as a subject for sequencing. The construction method can construct a single-stranded circular library with a length of 500-2000 bp, which can be used for long read sequencing and can improve the accuracy of sequencing.

Description

Technical Field

[0001] This invention belongs to the field of gene sequencing, specifically relating to single-stranded circularized libraries, their construction methods, and applications. Background Technology

[0002] Next-generation sequencing (NGS), also known as high-throughput sequencing, is a DNA sequencing technology developed based on PCR and gene chips. During DNA replication, NGS determines the DNA sequence by capturing specific markers (usually fluorescent molecular markers) carried by newly added bases. In NGS, individual DNA molecules must be amplified into gene clusters composed of identical DNA molecules and then replicated synchronously to enhance the fluorescence signal intensity and thus read the DNA sequence. However, as the read length increases, the coordination of gene cluster replication decreases, leading to a decline in base sequencing quality. This strictly limits the read length of NGS (no more than 500 bp). Therefore, NGS has the disadvantages of long library preparation time and short library length. Compared to the most common 150 bp read length of NGS, the average read length of full-length transcriptomes using Oxford nanopore technology in third-generation sequencing is 1–1.5 kb, offering faster sequencing speeds. However, since only one base is passed at a time, a single sample can only be read 1–2 times, which can easily reduce sequencing accuracy.

[0003] Therefore, it is necessary to provide a method for constructing longer libraries, and libraries constructed by this method can improve sequencing accuracy when used for sequencing. Summary of the Invention

[0004] The present invention aims to at least solve one of the technical problems existing in the prior art. To this end, the present invention proposes a method for constructing single-stranded circularized libraries, which can construct single-stranded circularized libraries with a length of 500-2000 bp, which can be used for long-read sequencing and can improve sequencing accuracy.

[0005] The present invention also proposes a single-chain circularized library constructed according to the construction method described above.

[0006] This invention also proposes a method for sequencing long DNA fragments.

[0007] According to one aspect of the present invention, a method for constructing a single-stranded circularized library is proposed, comprising the following steps:

[0008] S1: Break, repair, and ligate the target DNA to obtain the ligation product;

[0009] S2: Perform PCR amplification on the ligation product obtained in step S1 to obtain the amplification product;

[0010] S3: Mix the amplification product from step S2 with the helper circularization primer (Splint Primer), heat to ligate the amplification product with the helper circularization primer, then add ligase, and incubate to obtain the single-stranded circularized library; the length of the single-stranded circularized library is 500-2000 bp.

[0011] According to a preferred embodiment of the present invention, at least the following beneficial effects are achieved:

[0012] The construction method of this invention reduces splicing costs and saves memory and computation time; it also avoids errors introduced during PCR amplification. The single-stranded circularized libraries constructed according to the method of this invention can reach lengths of 500–2000 bp, which, from a sequencing application perspective, belongs to long-read sequencing and can be used for whole-genome sequencing, covering all sequences in the genome. Based on this, the single-stranded circularized libraries constructed by this invention do not require amplification and can be directly used for third-generation single-molecule sequencing, such as PacBio sequencing. Using single-stranded circularized libraries allows for multiple sequencing runs of a single sample through rolling circle replication, thereby improving sequencing accuracy.

[0013] In some embodiments of the present invention, the target DNA in step S1 is genomic DNA.

[0014] In some embodiments of the present invention, the length of the DNA obtained after the breakage in step S1 is 500 to 3000 bp.

[0015] In some embodiments of the present invention, step S1 further includes a step of purifying the fragmented DNA after the fragmentation is completed.

[0016] Specifically, the purification method includes any one of the following: magnetic bead method, silica gel column chromatography method, and precipitation method.

[0017] More specifically, the purification method uses magnetic beads.

[0018] The subsequent purification method is the same as here.

[0019] In some embodiments of the present invention, the end repair method in step S1 includes: mixing the broken DNA with a first end repair system and heating it at 20-25°C for 30-40 minutes to obtain the first end repair DNA.

[0020] Specifically, the first end repair system includes: Tris-HCl, MgCl2, DTT, ATP, dNTPs, T4 DNA polymerase, T4 polynucleotide kinase, and BSA.

[0021] More specifically, the first end repair system comprises: 50 mM Tris-HCl, 10 mM MgCl2, 10 mM DTT, 1 mM ATP, 0.4 mM dNTPs, 0.08 U / μL T4 DNA polymerase, 0.2 U / μL T4 polynucleotide kinase, and 0.11 mg / mL BSA.

[0022] In some embodiments of the present invention, the end repair method in step S1 further includes: mixing the first end repair DNA with the second end repair system and heating at 35-37°C for 30-35 minutes to obtain end repair DNA.

[0023] Specifically, the second end repair system includes: reaction buffer, dATP, and DNA polymerase Klenow.

[0024] More specifically, the second end repair system comprises: 10× reaction buffer, 0.25 mM dATP, and 0.2 U / μL DNA polymerase Klenow.

[0025] In some embodiments of the present invention, step S1, after each step of end repair, includes a step of purifying the first end repair DNA and the end repair DNA.

[0026] In some embodiments of the present invention, step S1 involves mixing the end-repair DNA with the adapter, and then ligating the adapter to the end-repair DNA using a ligation buffer to obtain the ligation product.

[0027] In some embodiments of the present invention, the adapter includes a first adapter and a second adapter, wherein the nucleic acid sequence of the first adapter is shown in SEQ ID NO:1 (GATCTACCAGCGGAAGCAGTACGAGGAAGCGAATG*T, where * represents a phosphorylation site), and the nucleic acid sequence of the second adapter is shown in SEQ ID NO:2 (Phos-CATTCGCTTCCTCGTCTGCTCGCACAGTGGTGCGT, where Phos represents phosphorylation modification).

[0028] Specifically, phosphorylation modification of the first and second adapters is a necessary requirement for the attachment of adapters to double-stranded DNA.

[0029] In some embodiments of the present invention, the ligation buffer comprises: PEG-8000, Tris-HCl at pH 7.8, ATP, BSA, MgCl2, DTT, and T4 DNA ligase.

[0030] In some preferred embodiments of the present invention, the ligation buffer comprises: 30% PEG-8000, 150 mM Tris-HCl at pH 7.8, 3 mM ATP, 0.15 mg / mL BSA, 30 mM MgCl2, 1.5 mM DTT, and 30 U / μL T4 DNA ligase.

[0031] In some embodiments of the present invention, step S1, after the connector is connected, further includes a step of purifying the connector connection product.

[0032] In some embodiments of the present invention, step S2, after completing the PCR amplification, further includes a step of purifying the amplification product.

[0033] In some embodiments of the present invention, the nucleic acid sequence of the auxiliary circularization primer in step S3 is shown in SEQ ID NO: 5 (CCGCTGGTAGATCACGCACCACTGTG).

[0034] In some embodiments of the present invention, the heating temperature in step S3 is 94-98°C and the heating time is 3-5 minutes.

[0035] In some preferred embodiments of the present invention, the heating temperature in step S3 is 95°C and the heating time is 3 minutes.

[0036] In some embodiments of the present invention, after the amplification product is linked to the auxiliary circularization primer in step S3, it is left to stand at 0-4°C for 3-5 minutes.

[0037] In some preferred embodiments of the present invention, after the amplification product is linked to the auxiliary circularization primer in step S3, it is left to stand at 4°C for 3 minutes.

[0038] In some embodiments of the present invention, the incubation temperature in step S3 is 35-40°C and the incubation time is 60-80 min.

[0039] In some preferred embodiments of the present invention, the incubation temperature in step S3 is 37°C and the incubation time is 60 min.

[0040] In some embodiments of the present invention, after obtaining the single-chain cyclized library, step S3 further includes a step of digesting the non-cyclized template: adding digestion buffer to the system containing the single-chain cyclized library, heating at 35-40°C for 30-35 min, and terminating the reaction with EDTA.

[0041] In some embodiments of the present invention, the construction method further includes step S4: mixing the single-stranded circularized library with sequencing primers and a DNA polymerase with strand displacement function to perform rolling circle replication, so as to verify the quality of the single-stranded circularized library.

[0042] In some embodiments of the present invention, the nucleic acid sequence of the sequencing primer is identical to the nucleic acid sequence of the auxiliary circularization primer. This indicates that the auxiliary circularization primer in the present invention can not only complete DNA circularization but also serve as a sequencing primer for sequencing reactions.

[0043] In some embodiments of the present invention, the DNA polymerase with strand displacement function is phi29 DNA polymerase.

[0044] According to a second aspect of the invention, a single-chain circularized library constructed according to the construction method is proposed.

[0045] According to a third aspect of the present invention, a sequencing method for long DNA fragments is proposed, using the single-stranded circularized library as the target for sequencing. Attached Figure Description

[0046] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:

[0047] Figure 1 The image shows the agarose gel electrophoresis results of lambda genomic DNA, fragmented genome, and purified fragmented genome in Example 1 of this invention; where lane M is the DNA Marker, lane 1 is the whole genome, lane 2 is the fragmented genome 1, lane 3 is the purified fragmented genome 1, lane 4 is the fragmented genome 2, and lane 5 is the purified fragmented genome 2.

[0048] Figure 2 The image shows the agarose gel electrophoresis results of the purified fragmented genome, the adapter-ligated genome, the amplification product, and the purified amplification product in Example 1 of this invention; wherein, lane M-DNA Marker, lane 1-purified fragmented genome, lane 2-adaptor-ligated genome, lane 3-purified adapter-ligated genome, lane 4-amplification product, lane 5-purified amplification product.

[0049] Figure 3 This is an agarose gel electrophoresis result of the purified amplification product, single-stranded circularized template, and product after digestion of non-circularized template in Example 1 of the present invention; wherein, lane M1-DNA Marker1 (all-gold type, BM211-01), lane M2-DNA Marker2 (Thermo, SM1353), lane 1-purified amplification product, lane 2-single-stranded circularized template, lane 3-product after digestion of non-circularized template;

[0050] Figure 4 This is an electrophoresis result of the purified single-stranded circularized library and rolling circle replication product in Example 1 of the present invention; wherein, lane M1-DNA Marker1 (all-gold type, BM211-01), lane M2-DNA Marker2 (Thermo, SM1353), lane 1-purified single-stranded circularized library, lane 2-rolling circle replication product. Detailed Implementation

[0051] The embodiments of the present invention are described in detail below. These embodiments are exemplary and are only used to explain the present invention, and should not be construed as limiting the present invention.

[0052] In the description of this invention, the use of "first" and "second" is for the purpose of distinguishing technical features only, and should not be construed as indicating or implying relative importance or implicitly indicating the number of technical features indicated or the order of the technical features indicated.

[0053] In the description of this invention, unless otherwise explicitly defined, terms such as amplification and cyclization should be interpreted broadly, and those skilled in the art can reasonably determine the specific meaning of the above terms in this invention in conjunction with the specific content of the technical solution.

[0054] In the description of this invention, references to terms such as "one embodiment," "some embodiments," etc., indicate that a specific feature, material, or characteristic described in connection with that embodiment is included in at least one embodiment of the invention. In this specification, illustrative expressions of the above terms do not necessarily refer to the same embodiment. Furthermore, the specific features, materials, or characteristics described may be combined in any suitable manner in one or more embodiments.

[0055] Unless otherwise specified, the experimental methods used in the examples are conventional methods; unless otherwise specified, the materials and reagents used are commercially available.

[0056] Example 1

[0057] This embodiment constructs a single-stranded circularized library targeting lambda genomic DNA and validates the quality of the single-stranded circularized library. The specific process is as follows:

[0058] (1) DNA extraction, fragmentation, and purification:

[0059] 600 ng of lambda genomic DNA (NEB, N3011L) was collected. The genome was fragmented using a Covaris M220 automated focusing sonic genome cutter (Covaris, USA, M220). Agarose gel electrophoresis was performed to verify fragmentation. The fragmented genome was purified using AMPure XP magnetic beads (Beckman Coulter Life Sciences, catalog number A63880), and the concentration of fragmented genome was measured and verified by agarose gel electrophoresis. Results are as follows: Figure 1 As shown in the figure, the lanes represent the M-DNA Marker (full gold version, BM211-01). Lane 1 – whole genome, lane 2 – fragmented genome 1, lane 3 – purified fragmented genome 1, lane 4 – fragmented genome 2, and lane 5 – purified fragmented genome 2. It can be seen that the fragmented genomes all become diffuse bands, ranging in size from 500 to 3000 bp.

[0060] (2) End repair (ER) and adapter connection:

[0061] Take 500 ng of the purified fragmented genome from step (1), add 20 μL of the first end repair system (1× end repair buffer: 50 mM Tris-HCl, 10 mM MgCl2, 10 mM DTT, 1 mM ATP, 0.4 mM dNTPs, 0.08 U / μL T4 DNA polymerase (NEB, M0203S), 0.2 U / μL T4 polynucleotide kinase (NEB, M0201S), 0.11 mg / mL BSA), mix well, and heat at 20 °C for 30 min to obtain the first end repaired genome, which can be stored at 4 °C. First-terminal repair genome was purified using AMPure XP magnetic beads (Beckman Coulter Life Sciences, catalog number A63880). 40 μL of the purified first-terminal repair genome was added to 20 μL of second-terminal repair system (10×NEBuffer 2 (B7002S), 0.25 mM dATP, 0.2 U / μL DNA polymerase Klenow (5 U / μL, NEB, M0212L)). The mixture was thoroughly incubated at 37°C for 30 min to obtain the end-repaired genome. The purified end-repaired genome was then purified again using AMPure XP magnetic beads (Beckman Coulter Life Sciences, catalog number A63880).

[0062] Prepare 100 μL of 25 μM Y-adaptor (25 μM first adapter Y-1 (100 μM added to TE buffer), 25 μM second adapter Y-2 (100 μM added to TE buffer), 50 mM NaCl, 10 mM Tris (pH 8.0), and 0.1 mM EDTA (pH 8.0)). Mix the above reagents and heat at 95 °C for 3 min, then slowly cool to 20 °C on a thermal cycler. The nucleic acid sequence of the first adapter Y-1 is shown in SEQ ID NO:1 (GATCTACCAGCGGAAGCAGTACGAGGAAGCGAATG*T, where * represents a phosphorylation site), and the nucleic acid sequence of the second adapter Y-2 is shown in SEQ ID NO:2 (Phos-CATTCGCTTCCTCGTCTGCT CGCACAGTGGTGCGT, where Phos represents phosphorylation modification).

[0063] Take 6 μL of the prepared Y-adaptor and add it to 39 μL of purified end-repair genome, mix well. Use a ligation buffer (30% PEG-8000, 150 mM, pH 7.8 Tris-HCl, 3 mM ATP, 0.15 mg / mL BSA, 30 mM MgCl2, 1.5 mM DTT, 30 U / μL T4 DNA ligase (600 U / μL, NEB, MO202L)) to ligate the Y-adaptor to the end-repair genome, obtaining the adapter-ligated genome. Heat at 20 °C for 30 min, cool at 4 °C, and stop the reaction with 35 mM EDTA. Verify the products obtained by agarose gel electrophoresis; the results are as follows. Figure 2 As shown in the figure. Lane M-DNA Marker (all-gold, BM211-01), lane 1-purified fragmented genome, lane 2-adapter-ligated genome. It can be seen that the purified fragmented genome is a diffuse band. When adapters are added, the reaction volume increases and the concentration decreases, resulting in a weaker band in the electrophoresis image.

[0064] Genomes linked by adapters were purified using AMPure XP magnetic beads (Beckman Coulter Life Sciences, catalog number A63880), and the results are as follows: Figure 2 As shown in the figure, lane 3 – the purified adapter is connected to the genome.

[0065] (3) PCR (library amplification):

[0066] The purified adapter from step (2) is then ligated to the genome. High-Fidelity 2×Master Mix (NEB, M0492L), 10 μM of P1, and 10 μM of P2 were mixed and used for library amplification in a PCR instrument to obtain amplification products. P1 and P2 were used as amplification primers. The nucleic acid sequence of P1 is shown in SEQ ID NO:3 (Phos-GATCTACCAGCGGAAGCAGTACGAGGAAGCGAATG*T, where Phos represents phosphorylation modification and * represents a phosphorylation site), and the nucleic acid sequence of P2 is shown in SEQ ID NO:4 (ACGCACCACTGTGCGAGCAGACGAGGAAG CGAATG*T, where * represents a phosphorylation site). Phosphorylation modification of P1 and P2 is a necessary requirement for DNA circularization. The amplification program is as follows:

[0067] 98℃, 3 min;

[0068] 98℃, 30s; 60℃, 30s; 72℃, 150s; this stage is repeated 9 times;

[0069] 72℃, 3 min;

[0070] 4℃, Hold.

[0071] The amplification products were purified using AMPure XP magnetic beads. Agarose gel electrophoresis was performed to verify the amplification products and the purified amplification products; the results are as follows. Figure 2 As shown in the figure. Lane 4 represents the amplified product, and lane 5 represents the purified amplified product. It can be seen that the amount of genome is significantly increased after amplification.

[0072] (4) Prepare single-chain cyclized libraries and digest non-cyclized templates:

[0073] The purified amplification product (2 pmol) was mixed with 20 μM of helper circularization primer (Splint Primer, nucleic acid sequence as shown in SEQ ID NO:5: CCGCTGGTAGATCACGCACCACTGTG) and 1×TE Buffer, heated at 95 °C for 3 min with the lid on at 80 °C, and then placed on ice for 3 min. The ligated product was then mixed with a single-stranded circular buffer (10×T4 DNALigase buffer (NEB, M0202L), 1 mM ATP, 2.1 U / μL T4 DNA Ligase (600 U / μL, NEB, M0202L)) and heated at 37 °C for 60 min to obtain a single-stranded circularized library. A digestion buffer (10×CutSmart (NEB, B6004S), 0.62 U / μL ExoⅠ (NEB, M0293L), 1.03 U / μL ExoⅢ (M0206S)) was added to the above system, heated at 37°C for 30 min, and the reaction was terminated with 0.5 M EDTA to digest the non-cyclized template. The results were verified by agarose gel electrophoresis as follows... Figure 3 As shown in the figure, lanes M1 - DNA Marker 1 (all-gold version, BM211-01), M2 - DNA Marker 2 (Thermo, SM1353), lane 1 - purified amplification product, lane 2 - single-stranded circular template, and lane 3 - product after digestion of non-circular template. Lane 3 is the product obtained after enzyme digestion in lane 2. Due to the scale-up of the reaction system, the concentration of single-stranded circular template is reduced, resulting in a weaker band.

[0074] (5) Verify the quality of the single-chain circularized library:

[0075] Use the kit The PCR & DNA Cleanup Kit (5 μg) (NEB, catalog number T1030S) was used to recover the single-stranded circularized library, yielding the purified single-stranded circularized library.

[0076] A 30 nM purified single-stranded circularized library, 100 nM sequencing primers (seq Primer, as shown in SEQ ID NO:6: CCGCTGGTAGATCACGCACCACTGTG, which has the same sequence as the helper circularization primer), and 10×phi29 DNA buffer (NEB, B0269) were mixed, heated at 95 °C for 3 min, and then incubated at room temperature for 25 min to prepare a single-stranded template complex.

[0077] Quality verification of the prepared single-chain template complex was performed by mixing 3 nM single-chain template complex, 0.1 mg / mL BSA, 200 μM dNTP, and Phi29 buffer, and heating at 30 °C for 60 min. The single-chain template complex and rolling ring replication product were analyzed using a 0.6% alkaline gel electrophoresis apparatus. The results are as follows: Figure 4 As shown in the figure. Lanes M1-DNA Marker 1 (all-gold, BM211-01), M2-DNA Marker 2 (Thermo, SM1353), lane 1-purified single-stranded circularized library, lane 2-rolling circle replication product. It can be seen that lane 1 contains the single-stranded template complex before rolling circle replication, with a band size of 1000-2000 bp; lane 2 shows products larger than 48 kb (indicated by the black arrow). This is because during rolling circle replication, the polymerase uses circular DNA as a template to replicate and produce large single-stranded DNA (i.e., DNA larger than 48 kb), proving that the prepared single-stranded circularized library is indeed circular DNA, not linear DNA. Furthermore, the single-stranded circular template is not visible in lane 2 because rolling circle replication requires a very small amount of DNA as a template, which is not visible on the gel image, highlighting the advantage of circular DNA templates.

[0078] The embodiments of the present invention have been described in detail above. However, the present invention is not limited to the above embodiments. Within the scope of knowledge possessed by those skilled in the art, various changes can be made without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof can be combined with each other unless otherwise specified.

Claims

1. A method for constructing a single-chain circularized library, characterized in that, Includes the following steps: S1: Break, repair, and ligate the target DNA to obtain the ligation product; S2: Perform PCR amplification on the ligation product obtained in step S1 to obtain the amplification product. The nucleic acid sequences of the amplification primers are shown in SEQ ID NO:3 and SEQ ID NO:

4. S3: Mix the amplification product from step S2 with the auxiliary circularization primer, heat to ligate the amplification product with the auxiliary circularization primer, then add ligase, and incubate to obtain the single-stranded circularized library; the length of the single-stranded circularized library is 500~2000bp; The adapter is a Y-adaptor, which includes a first adapter and a second adapter. The nucleic acid sequence of the first adapter is shown in SEQ ID NO:1, and the nucleic acid sequence of the second adapter is shown in SEQ ID NO:

2. The auxiliary circularization primer is Splint Primer, and the nucleic acid sequence of the auxiliary circularization primer is shown in SEQ ID NO:

5.

2. The construction method according to claim 1, characterized in that, The heating temperature in step S3 is 94~98℃, and the heating time is 3~5 minutes.

3. The construction method according to claim 2, characterized in that, In step S3, after ligating the amplification product with the auxiliary circularization primer, the mixture is allowed to stand at 0-4°C for 3-5 minutes.

4. The construction method according to claim 2, characterized in that, Step S3, after obtaining the single-chain cyclized library, also includes a step of digesting the non-cyclized template: adding digestion buffer to the system containing the single-chain cyclized library, heating at 35~40℃ for 30~35 min, and terminating the reaction with EDTA.

5. The construction method according to claim 1, characterized in that, The length of the DNA obtained after the segmentation in step S1 is 500~3000bp.

6. The construction method according to claim 1, characterized in that, The method for end repair in step S1 includes: mixing the broken DNA with a first end repair system and heating at 25-30°C for 30-40 minutes to obtain first end repair DNA; mixing the first end repair DNA with a second end repair system and heating at 35-37°C for 30-35 minutes to obtain end repair DNA.

7. The construction method according to claim 6, characterized in that, Step S1 involves mixing the end-repair DNA with the adapter, and then ligating the adapter to the end-repair DNA using a ligation buffer to obtain the ligation product.

8. The construction method according to claim 7, characterized in that, The ligation buffer comprises: PEG-8000, Tris-HCl at pH 7.8, ATP, BSA, MgCl2, DTT, and T4 DNA ligase.

9. The construction method according to claim 1, characterized in that, The incubation temperature in step S3 is 35~40℃, and the incubation time is 60~80min.

10. The construction method according to any one of claims 1 to 9, characterized in that, The construction method further includes step S4: mixing the single-stranded circularized library with sequencing primers and a DNA polymerase with strand displacement function to perform rolling circle replication, in order to verify the quality of the single-stranded circularized library.

11. The construction method according to claim 10, characterized in that, The nucleic acid sequence of the sequencing primer is the same as that of the auxiliary circularization primer.

12. The construction method according to claim 10, characterized in that, The DNA polymerase with strand displacement function is phi29 DNA polymerase.

13. A single-chain circularized library constructed according to any one of claims 1 to 12.

14. A method for sequencing long DNA fragments, characterized in that, Sequencing was performed on a single-stranded circular library, which was constructed using the construction method described in any one of claims 1 to 12.

Images