Application of chd6 detection reagent in preparation of colorectal cancer diagnosis reagent

CN116287226BActive Publication Date: 2026-08-18THE SIXTH AFFILIATED HOSPITAL OF SUN YAT SEN UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202210814767.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-07-11
Publication Date
2026-08-18
Estimated Expiration
2042-07-11

AI Technical Summary

Benefits of technology

[0054](1)本发明研究发现CHD6在原发性CRC患者标本中过表达,并且在CRC肝转移的标本中有更高表达,从临床水平提示了该基因可能与CRC的发生发展相关。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116287226B_ABST
    Figure CN116287226B_ABST
Patent Text Reader

Abstract

The application belongs to the field of biological medicine, and particularly relates to application of a CHD6 detection reagent in preparation of a colorectal cancer diagnosis reagent. The application research finds that CHD6 is overexpressed in primary CRC patient samples and is related to poor prognosis. Through molecular biology means, interference of CHD6 can significantly inhibit CRC proliferation, clonal formation, migration and invasion, etc., thereby showing that CHD6 has important functions in colorectal cancer occurrence and development. In addition, the application also finds that EGF can increase CHD6 protein levels by inhibiting degradation of CHD6 protein. Use of an EGFR inhibitor can inhibit tumor growth of CHD6 high-expression PDX. And, use of a Wnt inhibitor LGK-974 in combination with the EGFR inhibitor cetuximab can more significantly inhibit growth of CHD6 high-expression PDX. The expression level of CHD6 can be used as an index for predicting sensitivity of an EGFR inhibitor.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, and more specifically, it relates to the application of CHD6 detection reagent in the preparation of colorectal cancer diagnostic reagents. Background Technology

[0002] Colorectal cancer (CRC) is one of the most common malignant tumors of the digestive system. According to the latest global cancer survey report, colorectal cancer ranks third in both incidence and mortality worldwide, after breast and lung cancer. The 5-year survival rate of colorectal cancer patients is directly related to the malignancy of the tumor at diagnosis; the 5-year survival rate for early-stage colorectal cancer is as high as 92%, while it is only 7% for late-stage cancer. Currently, diagnostic reagents and targeted treatment methods for colorectal cancer are limited, making the development of diagnostic reagents and targeted therapeutic agents for colorectal cancer highly significant.

[0003] In clinical practice, the monoclonal antibody cetuximab is used to treat patients with KRAS / BRAF wild-type colorectal cancer. It works by targeting the extracellular domain to inhibit EGFR activity, and has clinical significance in disease remission and survival in metastatic CRC. However, even among KRAS / BRAF wild-type colorectal cancer patients, only a portion receive cetuximab treatment and benefit from the drug. Summary of the Invention

[0004] The purpose of this invention is to provide an application of a CHD6 inhibitor in the preparation of drugs for treating colorectal tumors.

[0005] Another object of the present invention is to provide an application of a CHD6 expression detection reagent in the preparation of colorectal tumor diagnostic reagents / kits.

[0006] CHD6 (chromodomain helicase DNA-binding protein 6) is a chromatin remodeling protein that alters chromatin structure by catalyzing ATP hydrolysis to generate energy, promoting the binding of transcription factors to gene promoters, and thus regulating gene expression. CHD6 co-localizes with RNA polymerase and is involved in mRNA synthesis. Studies have found that CHD6 can bind to the transcription factor NRF2 to regulate NQOI expression and maintain cellular redox homeostasis.

[0007] In this invention, "detection" is synonymous with diagnosis. In addition to the early diagnosis of colorectal tumors, it also includes the diagnosis of intermediate and late-stage colorectal tumors, as well as colorectal tumor screening, risk assessment, prognosis, disease identification, diagnosis of disease stages, and selection of therapeutic targets.

[0008] The application of the colorectal tumor marker CHD6 enables the early diagnosis of colorectal cancer. When CHD6 is found to be overexpressed in cancerous cells compared to clinically or morphologically normal cells, this indicates that the normal cells are progressing to cancer. Thus, colorectal cancer can be diagnosed at an early stage by the expression of colorectal tumor-specific CHD6 in cells with a normal appearance.

[0009] Early diagnosis refers to the possibility of detecting cancer before it metastasizes, preferably before morphological changes in tissues or cells can be observed.

[0010] In addition to the early diagnosis of colorectal cancer, the reagents / kits of this invention also hold promise for colorectal cancer screening, risk assessment, prognostic diagnosis, disease identification, diagnosis of disease stages, and selection of therapeutic targets.

[0011] On the one hand, this application provides the application of CHD6 detection reagents in the preparation of tumor screening / diagnosis / prediction / prognostic diagnostic reagents or diagnostic systems.

[0012] In some embodiments, the tumor is selected from melanoma, uterine cancer, gastric cancer, bladder cancer, lung adenocarcinoma, cervical cancer, esophageal cancer, squamous cell carcinoma of the lung, sarcoma, head and neck cancer, invasive breast cancer, ovarian cancer, pancreatic cancer, liver cancer, prostate cancer, glioblastoma, low-grade glioma of the brain, pheochromocytoma, paraganglioma, thyroid cancer, and colorectal tumors.

[0013] In some implementations, the tumor is selected from colorectal tumors.

[0014] In some embodiments, the diagnostic reagent / kit is a diagnostic reagent / kit for the prognostic use of colorectal tumors.

[0015] In some embodiments, the detection reagent is used to detect the gene expression level of CHD6; in some embodiments, the detection reagent is used to detect the mRNA expression level of CHD6; in some embodiments, the detection reagent is used to detect the expression level of CHD6 protein.

[0016] In some embodiments, the detection reagent is one or more of the following: quantitative PCR dye, quantitative PCR primer, quantitative PCR probe, antibody, antibody functional fragment, and conjugated antibody; in some embodiments, the kit is selected from one or more of the following: qPCR kit, Western blot detection kit, immunochromatographic detection kit, flow cytometry analysis kit, immunohistochemistry detection kit, ELISA kit, protein precipitation kit, immunofluorescence kit, and electrochemiluminescence detection kit; in some embodiments, the kit is selected from one or more of the following: protein precipitation kit, immunofluorescence kit, Western blot detection kit, and immunohistochemistry detection kit.

[0017] In some embodiments, the test sample for the test reagent is tissue, feces, or blood; in some embodiments, the test sample is tissue; in some embodiments, the test sample is intestinal mucosal tissue.

[0018] On the one hand, this application provides a tumor diagnostic reagent / kit that includes a CHD6 detection reagent.

[0019] In a particular embodiment of this application, CHD6 was found to be significantly highly expressed in CRC.

[0020] In some implementation schemes, elevated CHD6 expression levels compared to normal levels are predicted to indicate a poor prognosis / high risk of colorectal cancer.

[0021] On one hand, this application provides a diagnostic system for colorectal tumors, the diagnostic system comprising:

[0022] Detection component: The detection component is used to detect the expression level of CHD6;

[0023] Result Judgment Component: The result judgment component is used to output the disease results of tumor patients based on the expression level of CHD6 detected by the detection component.

[0024] In some implementations, the expression level of CHD6 is one or more of gene expression level, mRNA expression level, and / or protein expression level.

[0025] In some implementations, the result determination component includes an input module, an analysis module, and an output module; the input module is used to input the expression level of CHD6; the analysis module is used to analyze the probability of disease risk outcomes in cancer patients based on the expression level of CHD6; and the output module is used to output the analysis results from the analysis module.

[0026] In some implementations, the detection component comprises one or more of the following: qPCR kit, immunoblotting kit, immunochromatographic kit, flow cytometry kit, immunohistochemistry kit, ELISA kit, protein precipitation kit, immunofluorescence kit, electrochemiluminescence kit, qPCR instrument, immunoblotting device, flow cytometer, immunohistochemistry device, ELISA device, electrochemiluminescence device, and immunofluorescence device.

[0027] In some implementations, the kit is selected from protein precipitation kits, immunofluorescence kits, immunoblotting kits, and immunohistochemical kits.

[0028] In some implementations, treatment with the EGFR inhibitor cetuximab significantly inhibited the growth of CHD6-overexpressing xenograft tumors. Immunohistochemical staining showed that cetuximab treatment significantly inhibited the expression of the malignancy marker Ki67 in CHD6-overexpressing xenograft tumors, while treatment with cetuximab was not significantly effective in CHD6-lowexpressing xenograft tumors.

[0029] On one hand, this application provides a treatment system for colorectal tumors, the treatment system comprising:

[0030] 1) A CHD6 diagnostic system, wherein the diagnostic system includes the aforementioned diagnostic system;

[0031] 2) A medication system; the medication system contains an EGFR inhibitor;

[0032] In some embodiments, the EGFR inhibitor is selected from EGFR antibodies or their functional fragments, or small molecule compounds; in some embodiments, the EGFR antibody is selected from one or more of cetuximab, gefitinib, erlotinib, icotinib, and afatinib maleate; in some embodiments, the EGFR antibody is selected from cetuximab.

[0033] On one hand, this application provides the use of CHD6 inhibitors in the preparation of drugs for treating tumors; said tumors include melanoma, uterine cancer, gastric cancer, bladder cancer, lung adenocarcinoma, cervical cancer, esophageal cancer, squamous cell carcinoma of the lung, sarcoma, head and neck cancer, invasive breast cancer, ovarian cancer, pancreatic cancer, liver cancer, prostate cancer, glioblastoma, low-grade glioma of the brain, pheochromocytoma, paraganglioma, thyroid cancer, and colorectal tumors.

[0034] In some embodiments, the CHD6 inhibitor is selected from substances that inhibit the activity of CHD6 protein, substances that degrade CHD6 protein, or gene tools that reduce CHD6 protein levels.

[0035] In some embodiments, the substance that inhibits the activity of the CHD6 protein is selected from compounds.

[0036] In some implementations, the gene tool for reducing CHD6 protein levels is selected from gene editing, gene knockdown, or gene knockout materials.

[0037] In some embodiments, the gene knockdown material is selected from at least one of siRNA, dsRNA, miRNA, and shRNA; in some embodiments, the sequence of the shRNA is as shown in SEQ ID NO.1: cctagaagattacctcatcca, or SEQ ID NO.2: cctttggtgttgtttacgatc.

[0038] In some embodiments, the CHD6 inhibitor is selected from CHD6 antibodies or functional fragments thereof;

[0039] On the one hand, this application provides the application of FBXW7 accelerator in the preparation of CHD6 negative regulator.

[0040] In some embodiments, the FBXW7 promoter is a substance that promotes the activity of the FBXW7 protein or a gene tool that increases the level of the FBXW7 protein.

[0041] On the one hand, this application provides the application of EGF pathway inhibitors in the preparation of colorectal tumor drugs.

[0042] In some embodiments, the EGF pathway inhibitor is a substance that inhibits the generation or activity of metabolic initiators, intermediates, or end products in the pathway; in some embodiments, the EGF pathway inhibitor is selected from EGFR antibodies or their functional fragments, or small molecule compounds; in some embodiments, the EGFR antibody is selected from one or more of cetuximab, gefitinib, erlotinib, icotinib, and afatinib maleate; in some embodiments, the EGFR antibody is selected from cetuximab; in some embodiments, the colorectal tumor is a tumor that highly expresses CHD6.

[0043] On one hand, this application provides a composition for treating colorectal tumors, comprising:

[0044] (a) Wnt inhibitors;

[0045] The Wnt inhibitor is selected from one or more of LGK-974, XAV-939, and IWR-1-endo;

[0046] (b) EGFR inhibitors;

[0047] The EGFR inhibitor is selected from one or more of cetuximab, gefitinib, erlotinib, icotinib, and afatinib maleate.

[0048] In some embodiments, the Wnt inhibitor is selected from LGK-974; in some embodiments, the EGFR inhibitor is selected from cetuximab.

[0049] In some implementations, the colorectal tumor is a tumor with high CHD6 expression.

[0050] On one hand, this application provides a composition comprising LGK-974 and cetuximab.

[0051] In some embodiments, the use of the composition in the preparation of a medicament for treating colorectal tumors is provided.

[0052] In some implementations, the colorectal tumor is stage I, II, III, or IV colorectal cancer or precancerous adenoma.

[0053] The beneficial effects of some embodiments of the present invention:

[0054] (1) The present invention found that CHD6 is overexpressed in primary CRC patient specimens and is even more expressed in CRC liver metastasis specimens, suggesting at the clinical level that this gene may be related to the occurrence and development of CRC.

[0055] (2) By means of molecular biology, interference with CHD6 can significantly inhibit the proliferation, colony formation, migration and invasion of CRC.

[0056] (3) In addition, this application found that EGF can promote the protein stability of CHD6, thereby increasing the CHD6 protein level. EGFR inhibitors can be used to treat CRC patients with high CHD6 expression in KRAS / BRAF wild type. Furthermore, the combination of EGFR inhibitors and Wnt inhibitors can more significantly inhibit the growth of PDX tumors with high CHD6 expression, which has important clinical significance. Attached Figure Description

[0057] Figure 1 To analyze the changes of CHD6 in different tumors using the TCGA database.

[0058] Figure 2 shows the mRNA levels of CHD6 in normal tissues and colorectal cancer tissues. 2A is from the TCGA colorectal cancer database, 2B is from the GSE20842 database, and 2C is from the GSE20916 database.

[0059] Figure 3 A waterfall plot showing the relative CHD6 mRNA levels in colorectal cancer tissue and paired adjacent normal tissue samples from 18 CRC patients detected using quantitative real-time PCR.

[0060] Figure 4 Kaplan-Meier survival curves based on CHD6 expression in CRC tissues.

[0061] Figure 5 Immunofluorescence staining of CHD6 in human colon cancer, adjacent normal colon tissue, and liver metastases. The right side shows the quantitative analysis performed using ImageJ. Scale bar, 100 μM.

[0062] Figure 6To silence CHD6 expression in colorectal cancer cells by infection with a specified shRNA and thus determine cell proliferation, Western blotting was used to verify the silencing efficiency of the shRNA. Cell proliferation was measured using CCK8 assay, and data are expressed as mean ± standard deviation. shCHD6-31 refers to the gene expression knockdown of CHD6 (fragment 1); shCHD6-32 refers to the gene expression knockdown of CHD6 (fragment 2); shCTL refers to the control group.

[0063] Figure 7 To measure cell colony formation in colorectal cancer cells by infecting them with a specified shRNA to silence CHD6 expression, data are presented as mean ± standard deviation. shCHD6-31 refers to the knockdown of CHD6 gene expression (fragment 1, SEQ ID NO. 1: cctagaagattacctcatcca); shCHD6-32 refers to the knockdown of CHD6 gene expression (fragment 2, SEQ ID NO. 2: cctttggtgttgtttacgatc); shCTL refers to the control group.

[0064] Figure 8 To silence CHD6 expression in colorectal cancer cells by infection with specified shRNAs, cell migration was measured using Transwell chambers. Data are expressed as mean ± standard deviation. shCHD6-31 refers to the gene expression knockdown of CHD6 (fragment 1); shCHD6-32 refers to the gene expression knockdown of CHD6 (fragment 2); shCTL refers to the control group.

[0065] Figure 9 To silence CHD6 expression in colorectal cancer cells by infection with specified shRNAs, cell invasion was measured using Matrigel-lined Transwell chambers. Data are presented as mean ± standard deviation. shCHD6-31 refers to the knockdown of CHD6 gene expression (fragment 1); shCHD6-32 refers to the knockdown of CHD6 gene expression (fragment 2); shCTL refers to the control group.

[0066] Figure 10 To demonstrate that knocking down CHD6 inhibits tumor growth in mice, human-derived CRC cells were implanted subcutaneously in mice, and the growth rate of the resulting tumors was assessed. "Dox" refers to doxycycline-induced knockdown of CHD6 gene expression; "No Dox" refers to the control group.

[0067] Figure 11 shows the regulation of CHD6 by EGF. 11A shows the effect of EGF treatment on CHD6 protein levels in colorectal cancer cells as detected by Western blotting; 11B shows the degradation rate of CHD6 as detected by Western blotting, with cells treated with the protein synthesis inhibitor cycloheximide (CHX) for different time periods. p-AKT was used to demonstrate the activation of the EGF signaling pathway, and Graphpad was used to statistically analyze the degradation rate of CHD6.

[0068] Figure 12 shows the regulation of CHD6 by the ubiquitin ligase FBXW7. 12A shows the effect of FBXW7 overexpression on CHD6 protein levels; 12B shows the effect of FBXW7 silencing on CHD6 protein levels. Myc is the tag.

[0069] Figure 13 Wnt inhibitors reduce the mRNA and protein levels of CHD6.

[0070] Figure 14 shows the effect of cetuximab treatment on CRC tumor growth in four KRAS / BRAF wild-type PDXs. 14A shows the effect of cetuximab treatment on the growth of PDX tumors with different CHD6 expression levels; 14B shows representative IHC images of Ki67 staining in PDX tumor tissues. Scale bars represent 100 μm.

[0071] Figure 15 The combination of the EGFR inhibitor cetuximab and the Wnt inhibitor LGK-974 was used to inhibit the growth of PDX tumors. Detailed Implementation

[0072] The following specific embodiments further illustrate the technical solution of the present invention. These specific embodiments do not represent a limitation on the scope of protection of the present invention. Non-essential modifications and adjustments made by others based on the concept of the present invention still fall within the scope of protection of the present invention.

[0073] In some embodiments of this application:

[0074] Colorectal cancer (CRC); shCHD6: refers to CHD6 knockdown; shCTL: refers to control, i.e., disordered RNA.

[0075] Example 1: Patient and tissue samples

[0076] Fresh, paired, frozen samples of primary colorectal cancer and adjacent normal colon tissue were extracted from the Department of Surgery at the Sixth Affiliated Hospital of Sun Yat-sen University. Samples were also obtained from four patients with colorectal cancer without KRAS / BRAF mutations. At the time of sample collection, all patients had stage II or III disease. Additionally, 10 pairs of samples containing primary colorectal cancer, adjacent normal colorectal tissue, and liver metastases were obtained from Sun Yat-sen University Cancer Center.

[0077] Original immunohistochemical slides were scanned by Aperio Versa (Leica Biosystems), which captured digital images of the immunostained slides and performed quantitative analysis using Image J. All samples were collected after obtaining written informed consent from the patients and approval from the research center's institutional review board.

[0078] Example 2: Cell Culture, Reagents, and Transfection

[0079] All cells were obtained from ATCC and cultured at 37°C and 5% CO2. DLD-1 cells were stored in RPMI 1640 medium (RPMI) containing 10% (v / v) fetal bovine serum (FBS). 293T, HCT116, and SW620 cells were cultured in DMEM medium (containing 10% FBS). All transient transfections of the overexpression plasmids into the cell lines were performed according to the manufacturer's instructions using the Liposome 2000 transfection kit (Thermo Fisher, #11668019).

[0080] Example 3: CHD6 shRNA knockdown

[0081] This application screened four hairpin shRNAs targeting the human CHD6 transcript and identified two independent sequences (SEQ ID NO.: 1, 2) that could reduce mRNA levels by >70%. The shRNAs are located in the pLKO.1 vector (#31 and #32). Tet-pLKO-shCHD6 is the 3'UTR targeting CHD6.

[0082] The steps for preparing lentiviral particles are as follows: 55 cm 2 1×10 in the dish 7HEK293T cells were co-transfected with 10 μg pLKO.1 shRNA construct, 5 μg psPAX2, and 5 μg pMD2.G. 48 and 72 hours after transfection, the supernatant containing viral particles was collected and filtered through a Millex-GP filter (0.45 μm pore size, Millipore). To infect cancer cells with lentivirus, cells were infected twice at 37°C for 24 and 48 hours with medium containing 2 mL lentivirus, 200 μL FBS, and 5 μg / mL polybrene (Sigma). To improve knockdown efficiency, infected cells were screened for several days using puromycin.

[0083] Example 4: Xenograft Colorectal Cancer Model

[0084] This study was approved by the Animal Ethics and Welfare Committee of Sun Yat-sen University. Subcutaneous xenografting of HCT116 cells stably expressing Tet-pLKO-shCHD6 was performed in mice, and in vivo tumor growth was measured. HCT116 cells (1×10⁻⁶) 6 Cells / mouse were subcutaneously injected into the hind limb flank of 5-week-old female BALB / c-nu / nu mice. Six days later, prominent tumors (~80 mm) appeared. 3 Mice were randomly divided into two groups. After 8 days, the average tumor size reached ~150 mm. 3 Doxycycline (50 mg / kg) was administered intraperitoneally, while the control group received intraperitoneal PBS, with injections every three days. Tumor length and width were measured every three days and calculated according to the formula (length × width). 2 ) / 2 to calculate the volume.

[0085] For patient-derived xenograft (PDX) models, tumor fragments (3-4 mm) from 4 patients with colorectal cancer without KRAS / BRAF mutations were used. 3 The tumor was surgically xenografted subcutaneously into female NCG mice. When the tumor reached approximately 100 mm... 3 Mice were randomly divided into two groups. The control group received intraperitoneal injection of PBS, while the experimental group received intraperitoneal injection of cetuximab.

[0086] Example 5 Cell proliferation detection

[0087] Cells were seeded in 96-well plates, with 3 replicates per group. After the cells adhered, CCK8 reagent was added to the 96-well plates and incubated in a cell culture incubator for 4 hours. The absorbance at a wavelength of 450 nm was measured using a microplate reader and recorded as the Day 0 value. Measurements were taken once a day for 4 days.

[0088] Example 6 Cloning

[0089] Cells were seeded in 6-well plates with 200 cells per well, and three replicates were made. The plates were incubated in a cell culture incubator for 14 days and stained with 0.5% crystal violet prepared with methanol.

[0090] Example 7 Cell Migration

[0091] Add FBS-free cell suspension to Transwell chambers, add FBS-containing complete culture medium to the lower chamber, incubate in a cell culture incubator for 18 hours, and stain with 0.5% crystal violet prepared with methanol.

[0092] Example 8 Cell Invasion

[0093] FBS-free cell suspensions were seeded into Matrigel-lined Transwell chambers, and FBS-containing complete culture medium was added to the lower chamber. The chambers were then incubated in a cell culture incubator for 22 hours and stained with 0.5% crystal violet prepared with methanol.

[0094] Example 9: Protein Immunoblot

[0095] Protein samples were prepared using loading buffer containing SDS and subjected to SDS-PAGE. After adding the sample, electrophoresis was performed at 70V for 30 minutes, then increased to 120V and continued for approximately 1 hour until the bromophenol blue reached the bottom. The transfer clamps were then arranged in the following order: sponge-filter paper-gel-PVDF membrane-filter paper-sponge, and the membrane was placed in the transfer apparatus. Transfer was performed at a constant current of 300mA for 3 hours at low temperature. The membrane was blocked with 5% skim milk powder at room temperature for 1 hour, and then incubated overnight at 4°C with diluted primary antibody. After elution, secondary antibody was added and incubated at room temperature for 1 hour. Development was performed using ECL luminescent substrate solution. Quantitative analysis was performed using ImageJ software.

[0096] Example 10 Immunohistochemical Experiment

[0097] The expression of Ki-67 in tumors was characterized by immunohistochemistry using specific antibodies. The procedure included: dewaxing tumor sections (4 μm) in xylene, hydrating with diluted ethanol (100%–95%–90%–75%), retrieval of antigens in EDTA under high pressure, immersion in 3% H₂O₂ solution at room temperature for 30 minutes, washing with phosphate buffer, and incubating overnight at 4°C with Ki-67 antibody (1:100). After washing, the sections were incubated with enzyme-labeled goat anti-rabbit or anti-mouse IgG at room temperature for 1 hour. Immunostaining with diaminobenzidine was used for visualization, followed by nuclear counterstaining with hematoxylin.

[0098] Example 11 Immunofluorescence Experiment

[0099] Paraffin-embedded samples were cut into 4 mm thick sections. Antigen retrieval was performed in an autoclave for 15-20 minutes in 0.01 M citrate buffer (pH 6.0) to remove aldehyde bonds formed during initial tissue fixation. The sections were then blocked in PBS containing 3% bovine serum albumin for 1 hour at room temperature. The sections were incubated overnight at 4°C with a CHD6-specific primary antibody (1:200). The sections were then incubated for 1 hour at room temperature with an Alexa Fluor-conjugated secondary antibody (Invitrogen). Cell nuclei were then stained with DAPI. After elution, anti-quenching agent was added, and the sections were mounted, photographed under a fluorescence microscope, and statistically analyzed.

[0100] Example 12 Experimental Results Analysis

[0101] Analysis using the TCGA database revealed a high proportion of CHD6 amplification in colorectal cancer, such as... Figure 1 As shown. To verify the expression level of CHD6 in colorectal cancer, further analysis of CHD6 mRNA levels in normal tissues and colorectal cancer tissues from the TCGA colorectal cancer database, GSE20842, and GSE20916 databases revealed high expression of CHD6, such as... Figure 2A-2C As shown.

[0102] Eighteen paired colon cancer tissue and adjacent normal mucosal samples were analyzed using qRT-PCR. A waterfall plot of relative CHD6 mRNA levels is shown below. Figure 3 As shown (the corresponding samples and reagents are as shown in Example 1).

[0103] Survival analysis based on CHD6 expression in colorectal cancer from the GSE39582 database (Kaplan-Meier analysis) Figure 4 The study showed that high CHD6 levels were associated with poorer relapse-free survival, indicating that high CHD6 levels are associated with a poor prognosis in patients.

[0104] The expression of CHD6 in 10 pairs of normal, CRC, and liver metastasis tissue samples was analyzed using immunofluorescence. The results are as follows: Figure 5 As shown, CHD6 is highly expressed in colorectal cancer and liver metastases (experimental methods are those of Example 1 and Example 11).

[0105] To investigate the role of CHD6 in the development and progression of colorectal cancer, this application uses CHD6 silencing as a criterion for cell proliferation detection. Figure 6 As shown, the immunoblotting experiment demonstrated that the shRNA sequence could silence CHD6, and the CCK8 proliferation assay showed that silencing CHD6 could inhibit the proliferation of colorectal cancer cells (samples, reagents and experimental methods are as described in Examples 2, 5 and 9).

[0106] The results further validated the role of silencing CHD6 in the clonogenic formation of colorectal cancer cells. Figure 7 As shown, silencing CHD6 can inhibit the formation of colorectal cancer cell clones (samples, reagents, and experimental methods are as described in Examples 2 and 6).

[0107] Transwell experiments demonstrated that silencing CHD6 also inhibits the migration and invasion of colorectal cancer cells. Figure 8 and Figure 9 As shown in Examples 2, 7 and 8 (samples, reagents and experimental methods are as described in Examples 2, 7 and 8).

[0108] To determine the contribution of CHD6 to tumor growth in vivo, this application conducted a CRC xenograft mouse model experiment (the implementation methods are described in Examples 2, 3, and 4). Specifically, HCT-116 cells stably expressing Tet-pLKO-shCHD6 were implanted subcutaneously into nude mice, and CHD6 silencing was induced by Doxycycline. The experimental results are as follows: Figure 10 As shown, silencing CHD6 inhibits the growth of subcutaneous tumors in mice.

[0109] Other examples Figure 11A-11B As shown, EGF treatment can increase the protein level of CHD6 in colorectal cancer cells without affecting the mRNA level, and EGF treatment slows down the degradation of CHD6 (see Examples 2 and 9 for implementation methods).

[0110] This invention also found that overexpression of the ubiquitin ligase FBXW7 can reduce CHD6 protein levels, while FBXW7 knockdown can increase CHD6 protein levels. Figure 12A-12B As shown. FBXW7 is a tumor suppressor gene, and its deletion or mutation can cause the accumulation of downstream target genes in tumor tissue (see Examples 2 and 9 for implementation methods).

[0111] Further investigation revealed that the Wnt inhibitor LGK-974 can inhibit both the protein and mRNA levels of CHD6, such as... Figure 13 As shown (the implementation method is described in Examples 2 and 9).

[0112] Cetuximab, an EGFR inhibitor, is used as a targeted therapy for colorectal cancer. However, clinical findings show that even in KRAS / BRAF wild-type colorectal cancer patients, half do not benefit from cetuximab treatment. This application identifies EGF as an upstream regulatory signal of CHD6. To verify the impact of CHD6 expression levels on EGFR inhibitor sensitivity and to provide guidance for personalized cetuximab dosing, this invention established a PDX model. Tumor tissue from colorectal cancer patients was used for subcutaneous xenograft transplantation in mice (methods as described in Examples 1 and 4). As shown in Figure 14, cetuximab treatment significantly inhibited the growth of xenograft tumors with high CHD6 expression. Immunohistochemical staining showed that cetuximab treatment significantly inhibited the expression of the malignancy marker Ki67 in xenograft tumors with high CHD6 expression, while xenograft tumors with low CHD6 expression showed no significant effect from cetuximab treatment (implementation method described in Example 10). This indicates that the expression level of CHD6 can serve as an important reference before cetuximab administration.

[0113] The Wnt inhibitor LGK-974 is a drug that has entered clinical trials, but its efficacy has not been very good. This study found that LGK-974 combined with cetuximab can better inhibit tumor growth in PDX with high CHD6 expression. Figure 15 This discovery could advance the clinical research process for LGK-974.

[0114] Furthermore, this study found that CHD6 is elevated not only in CRC but also in some other tumors, as shown in the following results. Figure 1 As shown, these include melanoma, uterine cancer, gastric cancer, bladder cancer, lung adenocarcinoma, cervical cancer, esophageal cancer, squamous cell carcinoma of the lung, sarcoma, head and neck cancer, invasive breast cancer, ovarian cancer, pancreatic cancer, liver cancer, prostate cancer, glioblastoma, low-grade glioma of the brain, pheochromocytoma, and paraganglioma. In summary, this invention demonstrates that CHD6 is highly expressed in CRC and is associated with poor survival; its positive effects on cell proliferation, colony formation, migration, and invasion increase its carcinogenicity. In vivo, EGF can increase CHD6 protein levels by inhibiting CHD6 ubiquitination. This invention elucidates the regulation between the EGF signaling pathway and CHD6 during cancer formation. Furthermore, studies based on the PDX model show that CHD6 expression level is an important reference for the sensitivity of the EGFR inhibitor cetuximab, and that LGK-974 combined with cetuximab has better efficacy, providing new insights for personalized medication for cancer patients.

Claims

1. Application of detection reagents for detecting CHD6 expression levels in the preparation of diagnostic reagents for colorectal tumors.

2. The application as described in claim 1, characterized in that, The detection reagent is used to detect the gene expression level of CHD6.

3. The application as described in claim 1, characterized in that... The detection reagent detects the mRNA expression level of CHD6.

4. The application as described in claim 1, characterized in that, The detection reagent is used to detect the expression level of CHD6 protein.

5. The application as described in claim 1, characterized in that, The detection reagent is one or more of the following: quantitative PCR dye, quantitative PCR primer, quantitative PCR probe, and antibody.

6. The application as described in claim 1, characterized in that, The test sample for the aforementioned test reagent is feces or blood.

7. The application as described in claim 1, characterized in that, The test sample for the aforementioned test reagent is tissue.

8. The application as described in claim 1, characterized in that, The test sample for the aforementioned test reagent is intestinal mucosal tissue.

9. A diagnostic system for colorectal tumors, characterized in that, The diagnostic system includes: Detection component: The detection component is used to detect the expression level of CHD6; Result Judgment Component: The result judgment component is used to output the disease results of colorectal cancer patients based on the expression level of CHD6 detected by the detection component.

10. The diagnostic system as described in claim 9, characterized in that, The expression level of CHD6 is one or more of the following: gene expression level, mRNA expression level, and / or protein expression level.

11. The diagnostic system as described in claim 9, characterized in that, The result judgment component includes an input module, an analysis module, and an output module; the input module is used to input the expression level of CHD6; the analysis module is used to analyze the probability of disease risk outcomes for colorectal cancer patients based on the expression level of CHD6; and the output module is used to output the analysis results from the analysis module.

12. The diagnostic system as described in claim 9, characterized in that, The detection component comprises one or more of the following: qPCR kit, immunoblotting detection kit, immunochromatographic detection kit, ELISA kit, protein precipitation kit, immunofluorescence kit, qPCR instrument, immunoblotting detection device, ELISA detection device, and immunofluorescence detection device.

13. A treatment system for colorectal tumors, characterized in that, The treatment system includes: 1) A CHD6 diagnostic system, wherein the diagnostic system comprises the diagnostic system according to any one of claims 9-12; 2) Medication system; the medication system contains an EGFR inhibitor.

14. The treatment system as claimed in claim 13, characterized in that, The EGFR inhibitor is selected from EGFR antibodies or their functional fragments, or small molecule compounds.

15. The treatment system as claimed in claim 14, characterized in that, The EGFR antibody is selected from one or more of cetuximab, gefitinib, erlotinib, icotinib, and afatinib maleate.

Citation Information

Patent Citations

  • Methods for diagnosis and / or prognosis of colon cancer

    US8105777B1