Artificial cell biosensing system, its preparation method and application

Abstract

The application discloses an artificial cell biosensing system and a preparation method and application thereof, and the biosensing system is prepared by using a pressure microfluid device to prepare DOPC artificial liposome cells in a PDMS chip, the cells are wrapped with three kinds of nucleic acid chains, Mg 2+ and THT fluorescent dyes, and CNTs are inserted on the cell membrane; after the DOPC artificial liposome cells are fused with target object liposomes, a cutting cycle reaction of Mg 2+ specific nucleases is triggered, and a fluorescent signal amplification is realized. Compared with the prior art, the application has the following advantages: (1) after the system is fused with target object liposomes, a cutting cycle reaction of Mg 2+ specific nucleases is triggered, a fluorescent amplification signal is generated, and the system can be used for sensitive detection of Let-7a in serum of intestinal cancer patients or gastric cancer patients. (2) the system provides a wide linear range (100 fM to 10 nM, about 5 orders of magnitude, and the LOD is as low as 31.2 fM), and can directly detect actual samples.

Description

Technical Field

[0001] This invention belongs to the field of bioanalytical chemistry technology and relates to an artificial cell model for the early diagnosis of colon cancer or gastric cancer, specifically an artificial cell biosensing system and its preparation method and application. Background Technology

[0002] Metal ions play an indispensable role not only in metabolic activities, homeostasis, biochemical catalysis, and cell signal transduction, but also as cofactors of enzymes, playing a crucial role in various intracellular biological activities. Magnesium ions (Mg...) 2+ As a trace element, its physiological concentration is 0.5–3 mM. Meanwhile, the abnormal expression of miRNAs is closely related to the progression of various diseases. Therefore, accurate and sensitive detection of miRNAs can enable early diagnosis and timely treatment of diseases. The Let-7 miRNA family has 12 members (from let-7a to let-7i), among which abnormal expression of let-7a can lead to the development of various invasive cancers such as gastric cancer, prostate cancer, and cervical cancer. Currently, isothermal amplification techniques with advantages such as fast amplification speed, accurate detection, and high sensitivity have been developed, such as hybridization chain reaction (HCR), strand displacement amplification, bispecific nuclease amplification, and metal ion-dependent DNases, to improve the detection sensitivity of miRNAs. DNAzymes, also known as deoxyribonucleases, are promising tools for detecting bioanalytes such as RNA, DNA, and proteins due to their good programmability and sequence-specific recognition capabilities.

[0003] Liposomes, containing a lipid bilayer, also serve as a simple artificial cell model, exhibiting good biocompatibility and ease of surface functionalization. Traditional mass production methods for liposomes, such as extrusion, hydration, and electroforming, suffer from drawbacks like low encapsulation efficiency and discontinuous production processes. However, microfluidic devices based on polydimethylsiloxane (PDMS) can provide a highly controllable and reusable environment for liposome production. However, when using microfluidic devices to prepare liposomes, different dual-emulsion droplet formulations significantly affect the thickness and morphology of the oil layer, because using oil as a lipid carrier solvent makes it impossible to remove the accompanying oil residues from the liposome bilayer membrane.

[0004] Intercellular signaling has always been an important area of ​​research in life sciences and medicine, mainly achieved through free diffusion of substances, specific recognition of antigens and antibodies, and endocytosis. To achieve cell fusion and accelerate the rate of intercellular communication, nanomaterials such as carbon nanotubes (CNTs) are inserted into the cell membrane to promote the fusion rate of artificial cell probes with other cells. Summary of the Invention

[0005] Technical Problem Solved: In traditional microfluidic devices for liposome preparation, different dual-emulsion droplet formulations significantly affect the thickness of the oil layer and the morphology of artificial cells. To overcome the shortcomings of existing technologies, an octanol-assisted liposome assembly microfluidic method was developed. Using a pressure microfluidic device, octanol-assisted liposome assembly technology was applied in a PDMS chip to synthesize liposome probes encapsulating nucleic acid chains, metal ions, and THT. To better promote the fusion of artificial cell probes with cells containing target miRNA, this invention inserted CTNs into artificial cells and applied them to the detection of let-7a in colon cancer cells or gastric cancer cells, resulting in significantly enhanced intracellular fluorescence.

[0006] Technical Solution: An artificial cell biosensing system, wherein the biosensing system comprises DOPC artificial liposome cells prepared within a PDMS chip using a pressure microfluidic device, the cells containing W1 (SEQ ID NO.1: CTCCAGATTGTACCCACCTACTACCTCA); W2 (SEQ ID NO.2: AACTATACAACTAGCGACTCGTCC); and SUB (SEQ ID NO.3: CCGCCCAACCTGTACCCACATTGGGACGAG(rA)TCTGGAGAGGTTGGGCGGGATGGGTG), Mg 2+ With THT fluorescent dye, CNTs are inserted into the cell membrane; after the DOPC artificial liposome cells fuse with the target liposomes, Mg is triggered. 2+ The cleavage cycle of a specific nuclease amplifies the fluorescence signal.

[0007] The method for preparing the artificial cell biosensor system includes the following steps:

[0008] Purification and cleavage of S1 and CNTs

[0009] CNTs were calcined in a muffle furnace at 400-500°C to remove impurities, then dissolved in PBS solution to form a carbon nanotube solution. The solution was then poured into centrifuge tubes with a layer of dried DOPC on the surface, vortexed, and incubated at 37°C to allow DOPC to uniformly coat the surface of CNTs. The solution was then transferred to PBS solution, cut and processed using an ultrasonic cell disruptor, and centrifuged at high speed to obtain a CNTs solution.

[0010] S2. Preparation of the oil phase in a microfluidic device

[0011] Dissolve DOPC in CHCl3, then blow chloroform dry with nitrogen. After drying overnight, a dry monolayer of DOPC film forms on the inner wall of the centrifuge tube. Add n-octanol to the centrifuge tube and vortex to mix DOPC evenly in the n-octanol.

[0012] S3. Preparation of the external aqueous phase for the microfluidic device

[0013] Prepare a 2% PVA solution and add a 1% P188 solution to it to increase the dispersibility of artificial liposome cells and prevent the aggregation of liposome cells.

[0014] S4. Preparation of aqueous phase within the microfluidic device

[0015] Dilute a 2% PVA solution with PBS to a 0.5% PVA solution. Then dissolve three nucleic acid chains (W1, W2, and SUB), magnesium chloride, and THT fluorescent dye in the 0.5% PVA solution and vortex to mix them thoroughly.

[0016] S5. Preparation of liposomes using microfluidic devices

[0017] The oil phase, internal aqueous phase, and external aqueous phase are injected into the container of the pressure pump inlet channel. The microfluidic pressure pump is connected to the microfluidic chip through a polytetrafluoroethylene tube and connected to a computer. The pressure control software causes the three-phase fluid to flow into the microfluidic chip to form n-octanol-assisted self-assembled liposomes. The formed liposomes are collected into centrifuge tubes through ETFE tubes, incubated at 37 °C, and then stored overnight at 4 °C.

[0018] S6. Preparation of DOPC artificial liposomes

[0019] The product of S5 and the CNTs solution prepared by S1 were mixed at a volume ratio of 2:1, shaken to mix, incubated at 37 °C and then placed at 4 °C overnight to obtain DOPC artificial liposome cells.

[0020] Preferably, the concentration range of the CNTs solution in S1 is 3~5 mg / mL.

[0021] Preferably, the concentration ratio of DOPC to n-octanol in S2 is in the range of 0.1~1 mg / mL.

[0022] Preferably, the volume ratio of the three nucleic acid chains W1, W2, and SUB, magnesium chloride, and THT fluorescent dye in S4 is 2:1:1 to 10:1:1.

[0023] Preferably, the volume ratio of oil phase, internal water phase and external water phase in S5 is 1:1:3 to 1:2:3.

[0024] The above-described artificial cell biosensor system is used in the early diagnosis of colon cancer or gastric cancer.

[0025] Preferably, the system is used to detect let-7a in colon cancer cells or gastric cancer cells using fluorescence imaging.

[0026] Preferably, the system has a detection range of 100 fM to 10 nM for let-7a, with a LOD as low as 31.2 fM.

[0027] The working principle of the artificial cell biosensing system described in this invention is as follows: Using a pressure microfluidic device, an artificial cell probe encapsulating nucleic acid chains, metal ions, and THT is synthesized in a PDMS chip using n-octanol-assisted liposome assembly technology. When the artificial cell probe fuses with the liposomes encapsulating the target, the nucleic acid signal amplification process involving metal ion-specific DNases leads to the generation of a large number of G-quadruplexes, which bind to THT to produce a significant fluorescence enhancement signal. To better promote the fusion of the artificial cell probe with cells containing the target miRNA, CTNs are inserted into the liposomes. To verify the detection and analysis capabilities of the probe, it was co-incubated with liposomes encapsulating let-7a. Fluorescence microscopy images showed successful fusion of the liposome probe and the liposomes encapsulating let-7a. Subsequently, it was applied to the detection of let-7a in colon cancer cells, resulting in significant enhancement of intracellular fluorescence.

[0028] Beneficial effects: This invention utilizes a pressure microfluidic device to prepare artificial liposome cells in a PDMS chip, comprising DOPC liposomes encapsulated with nucleic acids and fluorescent dyes and intercalated with carbon nanotubes. When the liposome probe fuses with the liposome containing the target substance, it triggers Mg... 2+ A specific nuclease cleavage cycle generates a fluorescence amplification signal for sensitive detection of Let-7a in the serum of gastric cancer patients. The study validated that carbon nanotube-intercalated liposomes readily integrate with liposomes containing the target compound, and that this strategy enables fluorescence imaging studies of Let-7a in colon cancer cells. This method offers a wide linear range (100 fM to 10 nM, approximately five orders of magnitude, with a LOD as low as 31.2 fM) and allows for direct detection of real samples. Attached Figure Description

[0029] Figure 1 The purification and cutting process and results of carbon nanotubes in Example 1 are shown in the following images: (a) thermogravimetric analysis image of carbon nanotubes, (b) carbon nanotubes without purification and cutting treatment, and (c) transmission electron microscope image of carbon nanotubes after purification and cutting treatment.

[0030] Figure 2The images show (a) microfluidic chip channels under an inverted optical microscope, (b) liposome formation under an inverted optical microscope, and (c) liposomes stained with rhodamine b under an inverted optical microscope in Example 1.

[0031] Figure 3 In Example 1, a 40× objective lens (ad) and a 10× objective lens (eh) were used to characterize the fusion process of liposomes intercalated with carbon nanotubes and liposomes containing the target substance.

[0032] Figure 4 Feasibility analysis of nucleic acid amplification reaction in Example 1: (a) and (b) Feasibility analysis of fluorescence intensity amplification; (c) Polyacrylamide gel electrophoresis diagram.

[0033] Figure 5 For the nucleic acid fluorescence amplification reaction in Example 1, the following parameters are used: (a) temperature, (b) pH, (c) SUB / W1, (d) SUB / W2, (e) THT concentration, (f) reaction time of W1 / W2 / Let-7a, and (g) reaction time of W1 / W2 / Let-7a / SUB / Mg. 2+ Reaction time, (h) Reaction time of G-tetrachain and THT.

[0034] Figure 6 The images show (a) fluorescence spectra of different concentrations of let-7a in Example 1, and (b) calibration curves of let-7a.

[0035] Figure 7 (a) The selectivity of this method for different types of miRNAs in Example 1. (b) Comparison of the relative expression level of let-7a in serum samples measured by this method (black) and qRT-PCR (red).

[0036] Figure 8 (a) Fabrication of dual vesicles for microfluidic chips, (b) a method for lipid fusion and fluorescence signal amplification mediated by carbon nanotubes, and a schematic diagram of the fluorescence amplification reaction mechanism within liposomes@carbon nanotubes. Detailed Implementation

[0037] The following embodiments further illustrate the content of the present invention, but should not be construed as limiting the present invention. Any modifications and substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the present invention are within the scope of the present invention.

[0038] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art.

[0039] The abbreviation and Chinese name of the invention are as follows:

[0040] DNAzymes: Deoxyribonuclease; DOPC: Dioleoyl lecithin; CHCl3: Chloroform; PDMS: Polydimethylsiloxane; CNTs: Carbon nanotubes; THT: Benzothiazolium dyes; PVA: Polyvinyl alcohol; P188: Poloxamer 188.

[0041] Example 1

[0042] The artificial cell biosensor system was prepared using the following method, including the following steps:

[0043] Purification and cleavage of S1 and CNTs

[0044] The purchased CNTs were calcined in a muffle furnace for 4 h at a heating rate of 5 °C / min at 500 °C to remove impurities other than the CNTs. 20 mg of purified CNTs were weighed and added to 5 mL of prepared PBS solution to form a carbon nanotube solution. This solution was then poured into a centrifuge tube coated with a layer of dried DOPC, vortexed for 10 min, and incubated in a water bath at 37 °C for 30 min to allow the DOPC phospholipids to uniformly coat the CNTs surface. The prepared solution was then added to a beaker containing 45 mL of PBS solution and disrupted using an ultrasonic cell disruptor for 8 h. Finally, the CNTs solution was centrifuged at 8500 r / min to obtain a 0.4 mg / mL CNT solution. Figure 1 As shown, a thermogravimetric analyzer can measure the temperature-mass change curve of an object. Figure 1 (a) The curve shows that when the temperature exceeds 500 °C, the mass of CNTs begins to decrease sharply, indicating that impurities in CNTs will decompose at this temperature. Purified CNTs encapsulated in phospholipids were cut by an ultrasonic cell disruptor, forming CNTs with a size of 100 nm-500 nm, which were then uniformly dispersed in the solution. Figure 1 bc).

[0045] S2. Oil phase preparation in microfluidic devices

[0046] This embodiment uses DOPC dissolved in n-octanol as a raw material to synthesize liposomes. First, 20 mg of DOPC was weighed and 1 mL of chloroform (CHCl3) was added to a 2 mL centrifuge tube until the DOPC dissolved. Then, the tube was dried by nitrogen blowing, and the centrifuge tube was placed in a vacuum drying oven and dried overnight to allow the DOPC phospholipids to form a dry monolayer phospholipid film on the beaker wall. 2 mL of n-octanol was added to the centrifuge tube, and the tube was vortexed for 10 min to ensure the DOPC phospholipids were evenly mixed in the n-octanol, forming a DOPC solution with a concentration of 10 mg / mL.

[0047] S3, Preparation of external aqueous phase in microfluidic devices

[0048] First, prepare a 2% polyvinyl alcohol (PVA) solution. Weigh 196 mL of ultrapure water into a clean beaker and heat it in a water bath to 80 °C. Then, weigh 4 g of PVA and place it in the hot water, stirring continuously for 8 hours. Finally, add 1% poloxamer 188 (P188) to increase the dispersibility of liposomes and prevent their aggregation.

[0049] S4. Preparation of the aqueous phase in the microfluidic device

[0050] Dilute the prepared 2% PVA solution with PBS solution to a mass fraction of 0.5% PVA solution. Measure 2 mL of the 0.5% PVA solution using a graduated cylinder and dissolve the three nucleic acid chains W1, W2, and SUB, magnesium chloride, and THT together in a 2 mL centrifuge tube. Vortex for 10 min to ensure that the nucleic acid chains, dyes, and salt ions are evenly mixed in the PBS solution.

[0051] S5. Preparation of liposomes using microfluidic devices

[0052] The oil phase, internal aqueous phase, and external aqueous phase are injected separately into containers in the inlet channel of the pressure pump. The microfluidic pressure pump is connected to the microfluidic chip via a PVC tube. Connected to a computer, the pressure control software directs the three-phase fluid into the microfluidic chip to form n-octanol-assisted self-assembly liposomes. The formed liposomes are collected in centrifuge tubes via ETFE tubes, incubated at 37 °C for 30 min, and then stored overnight at 4 °C. Figure 2 As shown, the three-phase liquid used to prepare artificial cells converges at a certain flow rate at a point in the PDMS microfluidic chip channel, forming biemerald vesicles, and rapidly forming artificial cells encapsulating a large amount of contents with the help of n-octanol. Under the bright-field view of an inverted optical microscope, the three-phase channel of the unused PDMS chip ( Figure 2 a) The dimensions are: inner aqueous phase (IA) 19.3 μm, oil phase (LO) 11.7 μm, and outer aqueous phase (OA) 19.8 μm. A pressure pump is used to force the three-phase liquid into the PDMS chip at a certain pressure. Precise and stable pressure control via the pressure pump enables rapid production of dual emulsion droplets. Figure 2 b). The prepared artificial cells were stored overnight in a refrigerator at 4 ℃. Most of the impurities that did not form artificial cells and did not meet the experimental requirements were removed using an ultrafiltration tube. The next day, before observation, the cells were stained with Rhodamine B for 20 min. Artificial cells with a size of 50-100 μm could be observed under an inverted fluorescence microscope. Figure 2 c).

[0053] S6. Preparation of liposomes@CNTs

[0054] 2 mL of the prepared liposomes and 1 mL of purified and diced carbon nanotubes were injected into a 5 mL centrifuge tube, shaken for 10 min, and incubated in a water bath at 37 °C for 30 min before being stored overnight at 4 °C. Figure 3 As shown, to evaluate the fusion ability of artificial cell probes inserted with CNTs and artificial cells encapsulating analytes, we co-incubated them and analyzed the results using an inverted fluorescence microscope at different magnifications (40× objective lens). Figure 3 ad), 10× objective lens ( Figure 3 (eh) observed the moment when they were merging or had just completed merging.

[0055] like Figure 4 As shown, to verify the feasibility of nucleic acid amplification reaction in artificial cells, the fluorescence intensity in the experimental reaction system differed significantly between the presence and absence of the analyte. Figure 4 a) The fluorescence signal is significantly enhanced in the presence of the analyte, mainly due to the formation of the G-quadruplex. When the G-quadruplex binds to THT, it significantly enhances the fluorescence of THT. For example... Figure 4 As shown in Figure c, the progress of the nuclease cleavage reaction in the presence of the target compound let-7a was analyzed by polyacrylamide gel electrophoresis. Lane 6 shows the binding product formed after the target compound was added to the system consisting only of W1, W2, and SUB. Lane 7 shows the Mg... 2+ In its presence, the generation of obvious nuclease cleavage products was observed. The key to the experimental method in this study was the generation of a large quantity of G-quadruplexes, because only when THT binds to G-quadruplexes will the fluorescence signal be amplified. Circular dichroism (CD) spectroscopy is a common method for demonstrating the presence of the secondary structure of G-quadruplexes, such as... Figure 4 As shown in b, the nuclease cleavage reaction triggered by the presence of the target analyte causes a change in the peak shape in the CD spectrum. Positive peaks can be seen near 260 nm and 290 nm, and a negative peak near 240 nm. This result proves the existence of the K+-induced antiparallel G-quadruplex.

[0056] The artificial cell biosensor system prepared above was used in a specific detection process: the prepared internal reaction nucleic acid reaction solution was placed in a 500 μL centrifuge tube and incubated in a water bath. To obtain optimal detection performance, certain conditions needed optimization. First, the reaction temperature was optimized. The reaction temperature affects nuclease activity and the morphology of nucleic acid chain hybridization, significantly influencing the reaction efficiency and rate. (See attached...) Figure 5 As shown in Figure a, the fluorescence signal first increases and then decreases with increasing temperature, with the optimal temperature being 45 ℃. pH also significantly affects nuclease activity. (From the attached figure...) Figure 5As shown in b, the fluorescence signal first increases and then decreases with increasing pH, with the optimal pH being 7.5. The ratio of the nucleic acid reaction was then investigated; the fluorescence signal first increases and then decreases with increasing SUB / W1 and SUB / W2 ratios. Therefore, a ratio of 2 was selected as the optimal reaction ratio (see appendix). Figure 5 (c, d). The concentration of THT was then optimized; as the THT concentration increased, the fluorescence signal first increased and then stabilized. Therefore, a concentration of 25 μM was selected as the optimal reaction concentration (see appendix). Figure 5 e). The reaction time of the nucleic acid was then studied; as time increased, the fluorescence signal first increased and then stabilized (see appendix). Figure 5 f) or reduce (attached) Figure 5 (g, h). Therefore, 230 min was ultimately selected as the optimal total time for the three-part reaction. After determining the most favorable reaction conditions, the selectivity and sensitivity of the let-7a analytical method were further investigated. (Appendix) Figure 6 a represents the fluorescence spectra corresponding to different concentrations of GST, exhibiting a certain linear trend. (See attached...) Figure 6 As shown in b, the relative fluorescence unit (RFU) corresponding to the let-7a concentration exhibits a linear dynamic change in the range of 0.0001 nM to 10 nM, with good linearity (regression coefficient R). 2 = 0.993), and the limit of detection (LOD) calculated using three times the standard deviation of the background signal is approximately 31.2 fM. (See attached...) Figure 7 As can be seen, although the microRNA concentration (10 nM) is 100 times that of let-7a (100 pM), the former exhibits significantly lower fluorescence intensity, and the fluorescence intensity from ion generation is also very low. Therefore, the current analytical strategy demonstrates good specificity for let-7a. Furthermore, when other interfering substances coexist with let-7a, the fluorescence intensity is very high, indicating that these detected interfering substances do not affect the function of the target let-7a, achieving selective recognition and exhibiting good selectivity and anti-interference capabilities. (See attached image) Figure 7 As shown in b, this embodiment also compared the blood of three healthy individuals and three patients with gastric cancer. The fluorescence intensity of the patients differed significantly from that of the healthy individuals.

[0057] Example 2

[0058] To evaluate the practical significance of the established nucleic acid analysis method, we tested three serum samples from healthy individuals and three serum samples from gastric cancer patients obtained from a local hospital. Different concentrations of let-7a were added to samples 2 and 3 from healthy individuals and samples 2 and 3 from gastric cancer patients, yielding good relative recoveries (RR%) (99.0%–104.9%) and relative standard deviations (RSD%) of 1.21%–4.27%. These results indicate that our strategy has practical applicability for the detection of let-7a in actual serum samples from gastric cancer patients.

[0059] Table 1 shows the detection of Let-7a in miRNAs isolated from serum samples.

[0060]

Claims

1. An artificial cell biosensing system, characterized in that, The biosensing system utilizes a pressure microfluidic device to prepare DOPC artificial liposome cells within a PDMS chip. The cells encapsulate three nucleic acid chains: W1 (SEQ ID NO. 1), W2 (SEQ ID NO. 2), and SUB (SEQ ID NO. 3), along with Mg... 2+ With THT fluorescent dye, CNTs are inserted into the cell membrane; after the DOPC artificial liposome cells fuse with the target liposomes, Mg is triggered. 2+ The cleavage cycle of a specific nuclease amplifies the fluorescence signal.

2. The method for preparing the artificial cell biosensing system according to claim 1, characterized in that, The method includes the following steps: Purification and cleavage of S1 and CNTs CNTs were calcined in a muffle furnace at 400-500°C to remove impurities, then dissolved in PBS solution to form a carbon nanotube solution. The solution was then poured into centrifuge tubes with a layer of dried DOPC on the surface, vortexed, and incubated at 37°C to allow DOPC to uniformly coat the surface of CNTs. The solution was then transferred to PBS solution, cut and processed using an ultrasonic cell disruptor, and centrifuged at high speed to obtain a CNTs solution. S2. Preparation of the oil phase in a microfluidic device Dissolve DOPC in CHCl3, then blow chloroform dry with nitrogen. After drying overnight, a dry monolayer of DOPC film forms on the inner wall of the centrifuge tube. Add n-octanol to the centrifuge tube and vortex to mix DOPC evenly in the n-octanol. S3. Preparation of the external aqueous phase for the microfluidic device Prepare a 2% PVA solution and add a 1% P188 solution to it to increase the dispersibility of artificial liposome cells and prevent the aggregation of liposome cells. S4. Preparation of aqueous phase within the microfluidic device Dilute a 2% PVA solution with PBS to a 0.5% PVA solution. Then dissolve three nucleic acid chains (W1, W2, and SUB), magnesium chloride, and THT fluorescent dye in the 0.5% PVA solution and vortex to mix them thoroughly. S5. Preparation of liposomes using microfluidic devices The oil phase, internal aqueous phase, and external aqueous phase are injected into the container of the pressure pump inlet channel. The microfluidic pressure pump is connected to the microfluidic chip through a polytetrafluoroethylene tube and connected to a computer. The pressure control software causes the three-phase fluid to flow into the microfluidic chip to form n-octanol-assisted self-assembled liposomes. The formed liposomes are collected into centrifuge tubes through ETFE tubes, incubated at 37 °C, and then stored overnight at 4 °C. S6. Preparation of DOPC artificial liposomes The product of S5 and the CNTs solution prepared by S1 were mixed at a volume ratio of 2:1, shaken to mix, incubated at 37 °C and then placed at 4 °C overnight to obtain DOPC artificial liposome cells.

3. The method for preparing the artificial cell biosensing system according to claim 2, characterized in that, The concentration of CNTs in the S1 solution was 0.4 mg / mL.

4. The method for preparing the artificial cell biosensing system according to claim 2, characterized in that, The concentration of DOPC in the n-octanol solution in S2 is 10 mg / mL.

5. The method for preparing the artificial cell biosensing system according to claim 2, characterized in that, In S4, the volume ratio of the combination of the three nucleic acid chains W1, W2, and SUB with magnesium chloride and THT fluorescent dye is 2:1:1 to 10:1:

1.

6. The method for preparing the artificial cell biosensing system according to claim 2, characterized in that, The volume ratio of oil phase, internal water phase and external water phase in S5 is 1:1:3 to 1:2:

3.

7. The application of the artificial cell biosensing system according to claim 1 in the preparation of a gastric cancer early diagnostic kit.

8. The application according to claim 7, characterized in that, The system is designed to detect let-7a in gastric cancer cells using fluorescence imaging.

9. The application according to claim 8, characterized in that, The system has a detection range of 100 fM to 10 nM for let-7a, with a LOD as low as 31.2 fM.

Images