Molecular marker and primer for detecting eggplant saet source cytoplasmic male sterile restorer gene

Abstract

The application discloses a SNP molecular marker SmRf186 for detecting a Solanum aethiopicum Saet-derived cytoplasmic male sterile restorer gene. The SNP molecular marker SmRf186 is located at the 1860648th base of chromosome 6 of Solanum aethiopicum, the sequence of a downstream primer 1 is 5'_GAAGGTGACCAAGTTCATGCTAACTAAAGGAAGTGGAGAAAATAAGC_3', the sequence of a downstream primer 2 is 5'_GAAGGTCGGAGTCAACGGATTAACTAAAGGAAGTGGAGAAAATAAGG_3', and the sequence of an upstream primer is 5'_ATCAGCTAAAGTATGCTGAAGATGTT_3'. The application is a SNP molecular marker developed based on fine mapping results of the Solanum aethiopicum Saet-derived cytoplasmic male sterile restorer gene, has a short detection period and high flux. The application is used for the transformation of a Solanum aethiopicum Saet-derived cytoplasmic male sterile restorer line, can be rapidly detected, and the breeding efficiency is improved.

Description

Technical Field

[0001] This invention relates to a molecular marker and primers for detecting the Saet-derived cytoplasmic male sterility restorer gene in eggplant, belonging to the field of plant breeding technology, and is specifically used for the molecular detection of the Saet-derived cytoplasmic male sterility restorer gene in eggplant breeding materials. Background Technology

[0002] Eggplant is one of the most widely cultivated solanaceous vegetables in my country. It not only has high nutritional value, but also can be prepared in a variety of ways. It is a popular vegetable that can be sold both fresh and dried, is available year-round, and is economical, making it popular among producers and consumers.

[0003] Cytoplasmic male sterility (CMS) holds significant value in utilizing heterosis in crops, and is widely used in eggplant hybrid varieties. Currently, eggplant hybrid varieties are all derived from two inbred lines, requiring manual emasculation for seed production, which is time-consuming, labor-intensive, and results in high seed production costs. Even with manual emasculation, some pollen shedding from the anthers before emasculation can lead to self-pollination, affecting seed purity. The use of cytoplasmic male sterility lines can effectively overcome the shortcomings of inbred line seed production. Therefore, the application of cytoplasmic male sterility is of great importance for utilizing heterosis in eggplant.

[0004] All reported cases of eggplant cytoplasmic male sterility are heterologous cytoplasmic male sterility, but there are no reports of its practical application in hybrid variety breeding, mainly due to the lack of restorer lines (Yoshimi et al., 2013). Studies have shown that... S. aethiopicum Aculeatum Group (Saet source) is an ideal donor for eggplant cytoplasmic male sterility genes and restorer genes (Khan et al., 2014). However, one of the key issues that still needs to be addressed in practical applications is how to establish an efficient breeding technique for male sterility restorer lines to improve selection efficiency. Conventional breeding methods for field identification and testing of eggplant Saet source cytoplasmic male sterility restorer lines are time-consuming, resource-intensive, and have low accuracy, lacking efficient molecular markers for detection. Therefore, there is an urgent need to establish an efficient, stable, and reliable identification and breeding technique for eggplant Saet source cytoplasmic male sterility restorer lines. Summary of the Invention

[0005] To address the aforementioned issues, this invention, based on the fine localization of the eggplant Saet-derived cytoplasmic male sterility restoration gene, has developed a high-throughput SNP molecular marker, SmRf186, which is closely linked to the eggplant Saet-derived cytoplasmic male sterility restoration gene, for the molecular detection of the eggplant Saet-derived cytoplasmic male sterility restoration gene.

[0006] The technical solution discloses a molecular marker for detecting the Saet-derived cytoplasmic male sterility restorer gene in eggplant, characterized in that the SNP marker SmRf186 is located at position 1860648 on chromosome 6 of the eggplant genome, and the base is C or G. The SNP marker with a base of C indicates a Saet-derived cytoplasmic male sterility restorer line, and the SNP marker with a base of G indicates a Saet-derived cytoplasmic male sterility maintainer line.

[0007] The PCR-specific primers for the molecular marker SmRf186 are characterized in that: downstream primer 1 is 5'_GAAGGTGACCAAGTTCATGCTAACTAAAGGAAGTGGAGAAAATAAGC_3', downstream primer 2 is 5'_GAAGGTCGGAGTCAACGGATTAACTAAAGGAAGTGGAGAAAATAAGG_3', and upstream primer is 5'_ATCAGCTAAAGTATGCTGAAGATGTT_3'.

[0008] The PCR-specific primers for the molecular marker SmRf186 are characterized in that: the 5' ends of the downstream primers 1 and 2 are provided with fluorescent tag sequences.

[0009] The PCR-specific primers for the molecular marker SmRf186 are characterized in that: the 5' end of the downstream primer 1 is added with a FAM fluorescent tag sequence, and the 5' end of the downstream primer 2 is added with a HEX fluorescent tag sequence.

[0010] The PCR-specific primers for the molecular marker SmRf186 are characterized in that: the FAM fluorescent tag sequence is 5'-GAAGGTGACCAAGTTCATGCT-3', and the HEX fluorescent tag sequence is 5'-GAAGGTCGGAGTCAACGGATT-3'.

[0011] Beneficial Effects: This invention is based on the F1 hybrid population of the Saet-derived cytoplasmic male sterility restorer line 3-26 and maintainer line EP26 in eggplant. The restorer gene is located on chromosome Ch06, and a SNP molecular marker SmRf186 closely linked to the restorer gene is designed through sequence analysis. This invention enables rapid detection of the Saet-derived cytoplasmic male sterility restorer gene in eggplant at the seedling stage, improving breeding efficiency.

[0012] Attached Figure Description Figure 1 Location results of the Saet-derived cytoplasmic male sterility restoration gene in eggplant; Figure 2 Detection of molecular marker SmRf186 in the segregating F1 population of crosses between parents 3-26 and EP26.

[0013] The present invention will be described in detail below with reference to specific embodiments.

[0014] Example 1: Obtaining the Molecular Marker of the Restoration Gene 1. Population Construction and Phenotypic Identification The maternal parent of the population was the Saet-derived cytoplasmic male sterility restorer line 3-26 (heterozygous) of eggplant, bred by the Jiangsu Academy of Agricultural Sciences. The paternal parent was the homozygous high-generation inbred line EP26 of eggplant. 3-26 and EP26 were crossed to obtain the F1 segregating population. After flowering, the population materials were phenotypically identified: plants with no visible pollen, unable to self-pollinate, or with no mature seeds in their self-pollinated fruits were determined to be sterile; plants with visible pollen and mature seeds in their self-pollinated fruits were determined to be fertile.

[0015] 2. Initial localization of the restoration gene: DNA was extracted from 120 individual plants from the parents and the F1 segregating population. Whole-genome resequencing was used to develop polymorphic markers between parents and to construct a high-density genetic map. Based on the phenotypic identification results of the 120 individual plants, the restoration gene was located on chromosome 6 (…). Figure 1 ).

[0016] 3. Fine mapping of the revival gene: In order to narrow down the initial mapping region, 13 SNP molecular markers were designed in the initial mapping region based on eggplant genome data (http: / / doi.org / 10.1038 / s41598-019-47985-w). These markers were used to screen recombination exchange single plants in the F1 segregating population in order to narrow down the candidate region. Finally, the revival gene was mapped to the position interval of 1797257-2510448.

[0017] 4. Development of SNP markers linked to the restorer gene: Based on the results of fine mapping of the restorer gene and the characteristics of SNP mutation information, specific PCR primers for SmRf186 were designed, including downstream primer 1, downstream primer 2, and upstream primer. Both downstream primers have allelic variations C / G at their ends, and the 5' ends of the downstream primers carry fluorescent tag sequences. Downstream primer 1 carries the FAM fluorescent tag sequence 5'-GAAGGTGACCAAGTTCATGCT-3' at its 5' end, and downstream primer 2 carries the HEX fluorescent tag sequence 5'-GAAGGTCGGAGTCAACGGATT-3'.

[0018] Example 2 Detection of the SmRf186 molecular marker for the restoration gene 1. Genomic DNA was extracted from 120 individual leaves of the parental lines 3-26 and EP26 and their F1 hybrid segregating populations using the CTAB method.

[0019] 2. The PCR amplification reaction system is as follows: 5 μL 2×PARMS master mix buffer, 0.15 μL downstream primer 1, 0.15 μL downstream primer 2, 0.4 μL upstream primer, 10-100 ng DNA, and ddH2O to a final volume of 10 μL. The PCR amplification conditions are: 94 ℃ pre-denaturation for 15 minutes; 94 ℃ denaturation for 20 seconds, 65 ℃ annealing and extension for 1 minute (decreasing by 0.8 degrees per cycle), 10 cycles; 94 ℃ denaturation for 20 seconds, 57 ℃ extension for 1 minute, 30 cycles, and finally cooling to 10 ℃. A blank control was included in the experiment.

[0020] 3. The SmRf186 marker was detected in parents 3-26 and EP26 and their 120 F1 segregating populations. A TECAN Infinite M1000 microplate reader was used to read the fluorescence signals, obtaining clear and intuitive genotyping diagrams. Genotyping results were output based on color. Gray dots near the origin of the coordinate axis represent blank controls; blue dots near the horizontal axis indicate only FAM fluorescence detection; and red dots represent heterozygous signals indicating simultaneous detection of both FAM and HEX fluorescence. SmRf186 is located at base 1860648 on eggplant chromosome 6. When base 1860648 is C, the detection signal is red, consistent with the genotype of parental restorer line 3-26. When base 1860648 is G, the detection signal is blue, consistent with the genotype of parental EP26. A total of 62 red signals and 58 blue signals were detected. Statistical analysis of phenotypic concordance revealed that out of 120 materials, 2 materials did not meet the detection criteria, resulting in an identification accuracy of 98.33%. This indicates that the SNP marker can perform relatively good genotyping. Figure 2 ).

[0021] The above description is only a specific implementation example of the present invention, but any changes or modifications made with reference to the present invention are covered within the scope of the present invention.

Claims

1. A PCR-specific primer for detecting the SNP molecular marker SmRf186 of the Saet-derived cytoplasmic male sterility restoration gene in eggplant, characterized in that: Downstream primer 1 is 5'_GAAGGTGACCAAGTTCATGCTAACTAAAGGAAGTGGAGAAAATAAGC_3', downstream primer 2 is 5'_GAAGGTCGGAGTCAACGGATTAACTAAAGGAAGTGGAGAAAATAAGG_3', and upstream primer is 5'_ATCAGCTAAAGTATGCTGAAGATGTT_3'.

2. The PCR-specific primers according to claim 1, characterized in that, The 5' ends of downstream primers 1 and 2 are fitted with fluorescent tag sequences.

3. The PCR-specific primers according to claim 2, characterized in that, The downstream primer 1 has a FAM fluorescent tag sequence added to its 5' end, and the downstream primer 2 has a HEX fluorescent tag sequence added to its 5' end.

4. The PCR-specific primers according to claim 3, characterized in that, The FAM fluorescent tag sequence is 5'-GAAGGTGACCAAGTTCATGCT-3', and the HEX fluorescent tag sequence is 5'-GAAGGTCGGAGTCAACGGATT-3'.

Images