Method for efficiently screening recombinant pichia pastoris strains with different copy numbers

Abstract

The application discloses a method for efficiently screening Pichia pastoris recombinant strains with different copy numbers, which comprises the following steps: screening recombinant Pichia pastoris strains containing exogenous genes by PTVA method, selecting the recombinant strains based on PI staining by using a flow cytometer, carrying out fermentation induction culture, and detecting copy numbers; or directly carrying out fermentation induction culture after the PTVA screening, selecting the recombinant strains based on DiOC6(3) staining by using a flow cytometer, detecting copy numbers, and obtaining Pichia pastoris recombinant strains with different copy numbers. Compared with a traditional method for screening Pichia pastoris strains with different copy numbers, the method shortens the screening time by more than one third and increases the probability of screening the diversity copy number to more than 90%.

Description

(I) Technical Field

[0001] This invention belongs to the field of yeast screening technology, and relates to a screening method for Pichia pastoris genetically engineered strains, specifically a rapid screening method for high copy number transformants of Pichia pastoris. (II) Background Technology

[0002] The yield of Pichia pastoris expressed proteins is influenced by strain, culture medium composition, and culture conditions. In recent years, numerous articles published both domestically and internationally have conducted in-depth research on the effects of strain selection, culture medium composition optimization, and changes in induction conditions on protein yield. Some scholars have elucidated the fermentation process of Pichia pastoris from aspects such as promoter, induction process, dissolved oxygen control, temperature control, and pH control. These studies have all resulted in varying degrees of improvement in the production process of the target protein. With the publication of the Pichia pastoris genome and the development of other related omics research, research on the modification of metabolic pathways in Pichia pastoris strains and the optimization of protein yield at the molecular level has deepened.

[0003] Among the methods for optimizing recombinant protein yield in Pichia pastoris expression systems, the most widely studied is increasing the copy number of the inserted gene to improve transcription and translation levels. Screening for high-copy-count strains is one of the most effective strategies for increasing recombinant protein expression. However, excessively high copy numbers may also be detrimental to protein expression, so it is necessary to screen strains with different copy numbers by comparing their fermentation performance to identify the strain with the optimal copy number. Therefore, obtaining strains with different copy numbers for comparison is a fundamental condition for improving recombinant protein expression. Clones with gene insertion obtained through single crossover typically yield multi-copy strains in approximately 1-10% of cases, and these strains often have lower copy numbers. Two commonly used methods for screening high-copy-count recombinant Pichia pastoris strains are: first, antibiotic concentration gradient acclimation after transformation, such as using a concentration gradient of genimycin G418 or bleomycin Zeocin; currently, the PTVA (Posttransformational vector amplification) method proposed by Polizzi et al. is commonly used; second, transformation after constructing multiple expression cassettes in vitro. When screening Pichia pastoris GS115 competent cells using G418, a preliminary screening can be performed using histidine-added medium, followed by further screening using a G418 antibiotic gradient from low to high. However, the first method has the disadvantages of requiring large amounts of antibiotics, being cumbersome, labor-intensive, time-consuming, and having excessive randomness in obtaining high copy number strains. The second method, due to plasmid size limitations, can only obtain strains with lower copy numbers.

[0004] Flow cytometry (FCM), developed in the 1970s, is an instrument that automatically analyzes and sorts single cells. It consists of four parts: a laser source and optical system, a flow chamber and fluid system, a computer and analysis system, and a phototube and detection system. Also known as fluorescence-activated cell sorting (FACSC), it integrates modern immunofluorescence technology with fluid mechanics, applied electronics, lasers, and computer science. It can efficiently analyze tiny particles (such as cells and bacteria) and is used in basic and clinical cell biology as a high-tech detection and sorting instrument. Compared to traditional fluorescence microscopy, flow cytometry offers advantages such as high throughput, high precision, and high accuracy, making it the most advanced cell detection and sorting technology currently available. Flow cytometry can be used to analyze cell surface markers, cell receptors, cell viability, antigens, DNA and RNA content in tumor cells, and cell membrane potential, playing a crucial role in medical, biological, and other research fields.

[0005] With technological advancements, single-cell sorting and analysis techniques are increasingly widely used in related research. Cell sorting requires labeling cells with different physiological characteristics, then selectively choosing target subpopulations to separate them from the total cell population. Single-cell analysis first requires cell isolation, commonly achieved through methods such as micromanipulation, serial dilution, and microfluidics. However, these methods are not fast or precise enough. Therefore, flow cytometry has been widely applied in single-cell sorting, demonstrating significant value in single-cell acquisition, single-cell sequencing, single-cell PCR, and the study of differential cell types. Flow cytometry-based cell sorting can provide excellent seed culture for fermentation processes, further enhancing the extracellular secretion of exogenous proteins in Pichia pastoris. However, there are currently no reports, either domestically or internationally, of flow cytometry being used for Pichia pastoris gene copy number screening.

[0006] The conventional PTVA method uses plates containing different concentrations of G418 or other antibiotics to screen for high copies of the target gene. Later, it was improved to the liquid PTVA method, which is now the most commonly used method. This method uses a small volume of liquid culture medium instead of plates. The concentration of the antibiotic in the culture medium is increased every 24 hours until it reaches a concentration of 3 mg / mL (G418). The bacterial culture is then spread on plates with the same antibiotic concentration and grown for 3-5 days. A few colonies are then picked from the plates for shake flask fermentation. The conventional shake flask fermentation time for Pichia pastoris is 72-96 hours, and the total fermentation time is 18-20 days. Moreover, the probability of obtaining different copy numbers varies greatly. (III) Summary of the Invention

[0007] The purpose of this invention is to provide a method for efficiently screening recombinant Pichia pastoris strains with different copy numbers. This invention applies flow cytometry to the screening process of multi-copy strains after liquid PTVA. The yeast culture is treated with fluorescent dyes PI or DiOC6(3), and a series of strains are sorted according to the fluorescence intensity. After identification, recombinant Pichia pastoris with different copy numbers are obtained. Based on the respective characteristics of PI and DiOC6(3), this invention establishes two screening routes, Route A and Route B. Route A: The bacterial culture after the PTVA experiment is directly subjected to flow cytometry sorting based on PI staining, followed by single colony isolation, high-density rapid fermentation in shake flasks, and copy number identification; Route B: The bacterial culture after the PTVA experiment is first subjected to high-density rapid fermentation in shake flasks with mixed bacteria, followed by flow cytometry sorting based on DiOC6(3) fluorescent staining, single colony isolation, and copy number identification. DiOC6(3) is a fluorescent dye that can permeate the cell membrane and selectively stain the mitochondria of living cells. It can be used as a fluorescent probe to detect the mitochondrial membrane potential. The screening time for each route is only 12-14 days. Both routes of this method can achieve the goal of screening recombinant Pichia pastoris strains with different copy numbers more quickly than traditional methods.

[0008] The technical solution adopted in this invention is:

[0009] Method 1: This invention provides a method for efficiently screening recombinant Pichia pastoris strains with different copy numbers, the method comprising the following steps:

[0010] (1) The recombinant Pichia pastoris strain containing the exogenous gene was inoculated into a culture medium containing resistance, and the resistant recombinant strain was screened by PTVA method;

[0011] (2) Step (1) The bacterial culture of the resistant recombinant bacteria was detected by flow cytometry based on PI staining and the recombinant bacteria were selected according to the fluorescence intensity.

[0012] (3) The copy number of the supernatant after fermentation and induction culture of the recombinant bacteria screened in step (2) was detected to obtain recombinant strains of Pichia pastoris with different copy numbers.

[0013] Furthermore, the bacterial culture of the resistant recombinant bacteria in step (2) was obtained by inoculating the resistant recombinant bacteria selected by PTVA method into YPD medium and culturing overnight at 30°C and 220 rpm.

[0014] Further, step (2) involves a fluorescence detection method based on PI staining: propidium iodide is added to the bacterial culture of the resistant recombinant bacteria as the experimental group, while propidium iodide is added to the bacterial culture of the inactivated resistant recombinant bacteria as the positive control, and the bacterial culture of the resistant recombinant bacteria as the negative control. After incubation in the dark (at room temperature for 5-10 min), fluorescence detection is performed using flow cytometry to screen recombinant bacteria with different fluorescence intensities. The final concentration of propidium iodide added is 50 μg / mL.

[0015] Furthermore, the preferred method for fluorescence detection based on PI staining in step (2) is as follows:

[0016] A. Place a 96-well plate in the collection chamber of the FACS Melody flow cytometer (BD Company), and add 80 μL of YPD liquid culture medium containing 50 mg / L ampicillin and 50 mg / L kanamycin to each well;

[0017] B. Preparation of PI stock solution: Take 1 mg of propidium iodide (PI) powder into a sterile 2 mL EP tube, add 1 mL of pH 7.4, 0.1 M PBS, and prepare a 1 mg / mL PI stock solution.

[0018] C. Dilute the resistant recombinant bacteria to OD using ddH2O. 600 To achieve a final PI concentration of 50 μg / mL, 1 mL of diluted bacterial suspension was added to 50 μL of PI stock solution as the experimental group. Simultaneously, 1 mL of diluted bacterial suspension was inactivated at 100℃ for 20 min, and then 50 μL of PI stock solution was added to achieve a final PI concentration of 50 μg / mL as the positive control group. 1 mL of diluted bacterial suspension was used as the negative control group. Each group was incubated in the dark for 5-10 min at room temperature, and then placed in an ice bath at 0℃. By adjusting the flow cytometry signal and appropriate cell population gating, debris, adherent cells, and dead cells were removed. The PE channel was selected, and samples were loaded at a low flow rate. Then, a series of cell subpopulations were gated according to the PI fluorescence intensity from strong to weak.

[0019] D. Inoculate the 96-well plate cultures corresponding to the cell subpopulations screened in step C into YPD medium plates and incubate at 30°C for 2-3 days. Then, select a single colony from the plate and transfer it to 3 mL of YPD medium and incubate at 30°C and 220 rpm for 24 hours. This is the recombinant bacteria selected based on fluorescence intensity.

[0020] Method 2: This invention provides a method for efficiently screening recombinant Pichia pastoris strains with different copy numbers, the method comprising the following steps:

[0021] 1) Inoculate recombinant Pichia pastoris strains containing exogenous genes into a culture medium containing resistance, and screen for resistant recombinant strains using the PTVA method;

[0022] 2) Step 1) The resistant recombinant bacteria are fermented and induced to obtain the bacterial solution after fermentation is completed;

[0023] 3) After the fermentation of the bacterial culture in step 2) the fluorescence detection based on DiOC6(3) staining was performed by flow cytometer. Recombinant bacteria were selected according to the fluorescence intensity and the copy number was detected to obtain Pichia pastoris recombinant strains with different copy numbers.

[0024] Further, the method for fluorescence detection based on DiOC6(3) staining in step 3) is as follows: 3,3-diethyloxacarbonyl iodine is added to the fermented bacterial solution as the experimental group, 3,3-diethyloxacarbonyl iodine is added to the inactivated fermented bacterial solution as the positive control group, and the fermented bacterial solution as the negative control group. After incubation in the dark (at room temperature for 5-10 min), fluorescence detection is performed using flow cytometry to screen recombinant bacteria with different fluorescence intensities. The final concentration of 3,3-diethyloxacarbonyl iodine added is 0.25 μM.

[0025] Furthermore, the preferred method for fluorescence detection based on DiOC6(3) staining in step 3) is as follows:

[0026] ① Place a 96-well plate in the collection chamber of the FACS Melody flow cytometer (BD company), and add 80 μL of YPD liquid culture medium containing 50 mg / L ampicillin and 50 mg / L kanamycin to each well;

[0027] ②DiOC6(3) stock solution: Dissolve 3,3-dihexylocarbocyanineiodide (DiOC6(3)) in ethanol to prepare a DiOC6(3) stock solution with a concentration of 0.05mM, dispense it into aliquots and store it at -20℃ in the dark.

[0028] ③ Take 1 mL of bacterial culture and dilute it with ddH2O to OD. 600 The concentration was 0.1, and 5 μL of DiOC6(3) stock solution was added to make the final concentration 0.25 μM as the experimental group; at the same time, 1 mL of diluted bacterial solution was inactivated at 100℃ for 20 min, and 50 μL of DiOC6(3) stock solution was added to make the final concentration 0.25 μM as the positive control group; 1 mL of diluted bacterial solution was used as the negative control group; each group was incubated in a water bath at 37℃ in the dark for 5-10 min; by adjusting the flow cytometer signal and the appropriate cell population gate, debris, adhered cells and dead cells were removed; the fluorescence intensity of DiOC6(3) was detected by the FITC detection channel (Ex=484nm; Em=501nm), the FITC channel (DiOC6(3) staining) was selected, the sample was loaded at a low flow rate, and then a series of cell subpopulations were gated in the order of strong to weak DiOC6(3) fluorescence and sorted into the corresponding wells of the 96-well plate, with 5000 cells collected in each well;

[0029] ④ Inoculate the 96-well plate cultures corresponding to the cell subpopulations into YPD medium plates and incubate at 30℃ for 2-3 days. Then, select single colonies from the plates and incubate them in 3 mL of YPD medium at 30℃ and 220 rpm for 24 h to obtain recombinant bacteria.

[0030] Furthermore, the exogenous genes in step (1) of method one or step 1) of method two include the gene sequences of green fluorescent protein eGFP, collagen peptide COL and bovine lactoferrin peptide BlfFf; the present invention selects these three exogenous genes for recombinant expression in Pichia pastoris in order to more comprehensively illustrate the technology of the present invention, and the application of the technology of the present invention is not limited to these three exogenous genes.

[0031] Furthermore, in step (1) of method one or step 1) of method two, the culture medium includes a culture medium suitable for the growth of Pichia pastoris, such as YPD medium; the resistance to PTVA applicable to Pichia pastoris is selected according to the plasmid, including G418, bleomycin, hygromycin, but the present invention is not limited to G418.

[0032] Furthermore, step (1) of method one or step 1) of method two) PTVA screening refers to gradually increasing the concentration of resistance in the culture medium to screen for resistant recombinant bacteria. For example, a recombinant Pichia pastoris strain containing a foreign gene is inoculated into a YPD medium containing G418 until OD 600 =0.1, sealed with sterile gauze, and cultured at 30℃ and 220rpm in the dark for 24h. The G418 addition was increased every 24h by 0.1-2 times. The final G418 concentration achieved a Pichia pastoris lethality of over 95%. Then, PTVA was terminated, and resistant recombinant bacteria were screened. The final G418 concentration was 0.035-3 mg / mL. For YPD medium volumes of 5 mL, the amounts of 100 mg / mL G418 stock solution added were 17.5 μL, 25 μL, 50 μL, 75 μL, 100 μL, 125 μL, and 150 μL, respectively.

[0033] Furthermore, the recombinant Pichia pastoris strain containing the exogenous gene in step (1) of Method 1 or step 1) of Method 2 is constructed according to the following steps:

[0034] The exogenous gene was optimized based on the codon preference of Pichia pastoris. The optimized exogenous gene was then seamlessly ligated with the pPIC9K plasmid fragment using a one-step cloning kit. The resulting product was transformed into competent E. coli cells and cultured on MD plates containing ampicillin and kanamycin. Positive clones were picked and sequenced to verify the results, and strains containing the recombinant plasmid of the exogenous gene were obtained. The plasmid was then extracted to obtain the recombinant plasmid.

[0035] The recombinant plasmid was linearized with restriction endonuclease SacⅠ and then transformed into competent Pichia pastoris GS115 cells by electroporation. The cells were cultured on MD plates containing ampicillin and kanamycin, and positive clones were sequenced for verification, thus obtaining a recombinant Pichia pastoris strain containing the exogenous gene.

[0036] Furthermore, the fermentation induction culture in step (3) of Method 1 and the fermentation induction culture in step (2) of Method 2 are both: the recombinant bacteria or resistant recombinant bacteria are inoculated into BMGY medium and cultured at 30℃ and 220rpm for 16-24h until OD. 600 4; centrifuge at 4500 rpm for 5 min at room temperature, collect the bacterial cells, and resuspend the bacterial cells in high-salt medium to OD. 600 8; Take 20 ml of the resuspended bacterial culture and transfer it to a 250 ml Erlenmeyer flask, seal the flask with gauze, and incubate at 30℃ and 220 rpm for 24 h on a shaker. Every 12 h, add anhydrous methanol to the high-salt medium until the final volume concentration is 1%. After 24 h of incubation, take the bacterial culture after fermentation and screen it by flow cytometry; or take 1 mL of bacterial culture, centrifuge at 12000 rpm for 2 min at room temperature, collect the supernatant, and perform copy number detection. The high-salt medium consists of: 15 g / L yeast extract, 0.465 g / L CaSO4, 7.45 g / L MgSO4·7H2O, 11.8 g / L KH2PO4, 9.1 g / L K2SO4, 5 g / L ammonium sulfate, 10 mL / L methanol, and biotin 4 × 10⁻⁶. -4 g / L, 2 mL / L PTM1, solvent is water; the trace elements (PTM1) are: H3BO3 0.02 g / L, CuSO4·5H2O 6.0 g / L, MnSO4·H2O 3.0 g / L, Na2MoO4·2H2O 0.2 g / L, CoCl2 0.5 g / L, NaI 0.08 g / L, ZnCl2 20.0 g / L, FeSO4·7H2O 65.0 g / L, biotin 0.2 g / L, 5.0 mL / L H2SO4, ddH2O to a final volume of 1 L, filtered for sterilization, and stored at 4°C protected from light.

[0037] This invention uses the single copy of the glyceraldehyde-3-phosphate dehydrogenase gene (GAPDH) from the GS115 genome as an internal reference gene; the plasmid pMD18T-GAP containing the GAPDH gene is used as a standard plasmid, and the OD of the plasmid is measured using a micro-volume nucleic acid quantification instrument. 260nm According to the formula copies / μL=(6.02×10 23 )×(ng / μL×10 -9 The absolute copy number of the diluted plasmid was calculated as (DNA length × 660). The plasmid was then serially diluted 10-fold to different order of magnitude of copy number. A standard curve for RT-PCR was constructed with Cp value as the ordinate and copy number as the abscissa. The recombinant bacterial genome was extracted, and the gel recovered the genome for use as the template for RT-PCR detection. The corresponding copy number was obtained based on the standard curve.

[0038] The technical route design of this invention is based on the inventor's previous research findings: after PTVA experiment, the flow cytometry fluorescence intensity of recombinant Pichia pastoris stained with PI is related to the number of exogenous gene copies; after methanol-induced culture, the flow cytometry fluorescence intensity of recombinant Pichia pastoris stained with DiOC6(3) is related to the number of exogenous gene copies.

[0039] Compared with existing technologies, the beneficial effects of this invention are mainly reflected in the following aspects: Firstly, this invention utilizes flow cytometry-directed sorting to replace the traditional random selection process from plates after PTVA, shortening the time and increasing the probability of screening strains with different copy numbers, thus reducing workload. Secondly, it further optimizes the fermentation screening method, using a 24–48h high-density rapid shake-flask fermentation method to replace the traditional 72–96h shake-flask fermentation method, achieving the same results as the traditional fermentation method. In summary, the technology used in this invention shortens the time by more than one-third compared to traditional methods for screening Pichia pastoris strains with different copy numbers, and increases the probability of screening strains with diverse copy numbers to over 90%. (iv) Description of the attached drawings

[0040] Figure 1 The results of flow cytometry sorting of different recombinant collagen strains in Example 1 are shown; P1 to P6 represent different PI staining fluorescence intensities.

[0041] Figure 2 This is an SDS-PAGE analysis of collagen expression in different strains selected after flow cytometry sorting in Example 1. Lanes 1-7 are strains 01, 08, 09, 10, 12, 13 and the original strain, respectively.

[0042] Figure 3 The results of mitochondrial membrane potential detection for different recombinant bovine lactoferrin peptides in Example 2 are shown. a and b are dye-free controls, c is a strain with a copy number of 1, d is a strain with a copy number of 2, e is a strain with a copy number of 3, f is a strain with a copy number of 6, and g is a strain with a copy number of 10. (V) Detailed Implementation

[0043] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto:

[0044] The Pichia pastoris GS115 strain and expression vector pPIC9K used in this invention were both purchased from Invitrogen, USA.

[0045] YPD solid medium: yeast extract 10g / L, peptone 20g / L, glucose 20g / L, agar 20g / L, solvent is water.

[0046] YPD liquid culture medium: yeast extract 10g / L, peptone 20g / L, glucose 20g / L, solvent is water.

[0047] MD medium (selective medium): glucose 20 g / L, biotin 4 × 10⁻⁶ -4 The following steps were taken to prepare the solution: 2 g of agarose was added to 80 mL of water, YNB (amino-free yeast nitrogen source) 13.4 g / L, agarose 20 g / L, and water was used as the solvent. The solution was sterilized at 121℃ for 20 minutes. After the temperature dropped to 60℃, 10 mL of 10×YNB, 10 mL of 10×glucose, and 0.2 mL of 500×biotin were added to the clean bench. Water was then added to bring the solution to 100 mL.

[0048] BMGY medium (yeast growth medium): 10 g / L yeast extract, 20 g / L peptone, 3 g / L K₂HPO₄, 11.8 g / L KH₂PO₄, 3.4 g / L YNB (amino-free yeast nitrogen source), 10 g / L ammonium sulfate, 10 mL / L glycerol, biotin 4 × 10⁻⁶ -4 The solution is as follows: Completely dissolve 10g yeast extract, 20g peptone, 3g K₂HPO₄, 11.8g KH₂PO₄, 3.4g YNB (amino-free yeast nitrogen source), 10g ammonium sulfate, and 10mL glycerol. Add deionized water to a final volume of 1L. Autoclave at 115℃ for 30 minutes. After cooling, add 2mL of 500× biotin to a clean bench.

[0049] Trace elements (PTM1): H3BO3 0.02g / L, CuSO4·5H2O 6.0g / L, MnSO4·H2O 3.0g / L, Na2MoO4·2H2O 0.2g / L, CoCl2 0.5g / L, NaI 0.08g / L, ZnCl2 20.0g / L, FeSO4·7H2O 65.0g / L, Biotin 0.2g / L, 5.0mL / L H2SO4, ddH2O to a final volume of 1L, filter sterilize, store at 4℃ protected from light.

[0050] High-salt culture medium (optimized yeast shake-flask fermentation induction medium): 15 g / L yeast extract, 0.465 g / L CaSO4, 7.45 g / L MgSO4·7H2O, 11.8 g / L KH2PO4, 9.1 g / L K2SO4, 5 g / L ammonium sulfate, 10 mL / L methanol, biotin 4 × 10⁻⁶ -4Prepare a solution of 2 mL / L PTM1 in water as the solvent: Completely dissolve 15 g yeast powder, 0.465 g CaSO4, 7.45 g MgSO4·7H2O, 11.8 g KH2PO4, 9.1 g K2SO4, and 5 g ammonium sulfate, and bring the volume to 0.988 L. Autoclave at 115 °C for 30 min. After cooling, add 2 mL of PTM1 and 10 mL of methanol to a clean bench.

[0051] LiAc-DTT solution: 100mM lithium acetate (LiAc), 10mM dithiothreitol (DTT), 0.6M sorbitol, 10mM Tris-HCl, pH 7.5.

[0052] This invention optimizes the corresponding gene sequences of Pichia pastoris based on their preferred codons without altering the amino acid sequences of each protein. Sequences such as agg, ggg, gca, and ggc in the fusion protein gene sequence are optimized to their preferred codons such as agg, gct, and ggt, so as to facilitate better expression in the Pichia pastoris expression system.

[0053] This invention utilizes the BD FACS Melody flow cytometer. However, this invention is not limited to this model; any flow cytometer with sorting capabilities is suitable for the screening technique described herein.

[0054] In this embodiment of the invention, the single copy of the glyceraldehyde-3-phosphate dehydrogenase gene (GAPDH) in the GS115 genome was set as an internal reference gene; the plasmid pMD18T-GAP containing the GAPDH gene was used as a standard plasmid, and the OD of the plasmid was measured using a micro-volume nucleic acid quantification instrument. 260nm According to the formula copies / μL=(6.02×10 23 )×(ng / μL×10 -9 Calculate the absolute copy number using Cp / (DNAlength×660); dilute the plasmid sequentially in 10-fold gradients to contain different orders of magnitude of copy number, and construct a standard curve for RT-PCR using Cp value as the ordinate and copy number as the abscissa; extract the genome of the recombinant bacteria to be tested, and use the gel recovery as the template for RT-PCR detection, obtaining the corresponding copy number based on the standard curve.

[0055] Example 1: Screening method based on the combination of PTVA and high-density fermentation

[0056] 1. Preparation of recombinant green fluorescent protein expression vector

[0057] (1) Construction of expression vector pPIC9K-eGFP

[0058] The green fluorescent protein (eGFP) gene was optimized based on the codon preference of Pichia pastoris and synthesized by Nanjing Genscript Biotech Co., Ltd. The optimized green fluorescent protein gene is 717 bp in length and contains 239 amino acids. The nucleotide sequence is shown in SEQ ID NO.1.

[0059] The green fluorescent protein (eGFP) gene fragment shown in SEQ ID NO.1 and the pPIC9K plasmid fragment were digested with EcoRI and NotI, and then seamlessly ligated into the multiple cloning site of the pPIC9K plasmid using a one-step cloning kit. The resulting product was transformed into E. coli DH5α competent cells and cultured at 37°C on LB plates containing 50 mg / L ampicillin and 50 mg / L kanamycin. Positive clones were picked and sequenced for verification, and a strain containing the recombinant plasmid of the green fluorescent protein (eGFP) gene was obtained. The plasmid was extracted to obtain the expression vector pPIC9K-eGFP, which was stored at -80°C.

[0060] SEQ ID NO.1

[0061] .

[0062] (2) Linearization of expression vector pPIC9K-eGFP

[0063] The expression vector pPIC9K-eGFP constructed in step (1) was digested with restriction endonuclease SacⅠ at 37℃ overnight. Then, 1% agarose gel electrophoresis was used to check whether it was completely digested. After complete digestion, the digestion solution was purified using a PCR product purification kit, and the linearized plasmid was recovered.

[0064] Enzyme digestion reaction system: plasmid pPIC9K-eGFP 1μg, 10×L buffer 2μL, SacⅠ 1μL, sterile water added to 20μL.

[0065] 2. Preparation of Pichia pastoris GS115 competent cells

[0066] (1) Pick a single colony of Pichia pastoris GS115 on a YPD plate and inoculate it into a test tube containing 3 mL of YPD liquid medium. Incubate overnight at 30°C with shaking at 220 rpm.

[0067] (2) Take 500 μL of the overnight culture from step (1) and inoculate it into a 500 mL Erlenmeyer flask containing 50 mL of fresh YPD liquid medium. Incubate overnight at 30 °C and 220 rpm with shaking until the OD600 reaches 1.3-1.5. Transfer the culture into a sterile centrifuge tube and centrifuge at 4 °C and 5000 rpm for 5 min. Remove the supernatant and place the cells on ice.

[0068] (3) Resuspend the bacterial cells from step (2) in 20 mL of LiAc-DTT solution, culture them in a shaker at 30°C for 30 min, centrifuge at 4°C and 5000 rpm for 5 min, and remove the supernatant.

[0069] (4) Repeat step (3) three times or add 1 mL of 1 M sorbitol aqueous solution pre-cooled on ice to resuspend the bacterial cells, then transfer them to a 1.5 mL EP tube, centrifuge at 3000 rpm for 5 min, remove the supernatant, and repeat this step three times.

[0070] (5) The bacterial cells collected in step (4) are resuspended in 1M sorbitol aqueous solution pre-cooled on ice, with a final volume of 0.5 mL; dispensed into 80 μL tubes, which are Pichia pastoris GS115 competent cells, and stored at -80℃ for later use.

[0071] 3. Electroconversion of Pichia pastoris

[0072] (1) Take one tube of Pichia pastoris GS115 competent cells prepared in step 2 out of the -80℃ freezer and place it on ice. Add 1 μg of the linearized plasmid pPIC9K-eGFP prepared in step 1, mix well, transfer to a 0.2 cm pre-cooled electroporation cuvette of the Bio-Rad electroporator, gently tap it to make it sit at the bottom of the electroporation cuvette, and place it on ice for 5-10 min.

[0073] (2) According to the operating instructions of the Bio-Rad electroporator, set the mode to Pic mode, wipe the outer wall of the electroporator cup dry and place it in the electric shock position, the electric shock voltage is 1.5kV, the capacitance is 25μF, the resistance is 200Ω, and the electric shock time is 5msec.

[0074] (3) Immediately after the electroporation ends, add 1 mL of pre-cooled 1M sorbitol aqueous solution to the electroporation vessel, gently mix by pipetting, and quickly transfer to a 1.5 mL EP tube. Incubate at 30°C and 220 rpm for 1-2 h.

[0075] (4) Take 100-200 μL of the bacterial cells from step (3) and spread them on an MD plate containing 50 mg / L ampicillin and 50 mg / L kanamycin. Incubate in an inverted position in a 30°C incubator for 2-4 days until a single colony appears, and obtain the recombinant transformant.

[0076] 4. PCR identification of recombinant transformants

[0077] (1) Cell wall disruption of yeast transformants

[0078] Select a single colony from the transformation plate in step 3 and place it in a PCR tube containing 0.1M NaOH aqueous solution. Mix by pipetting until visible turbidity is achieved. Place the PCR tube in a microwave oven at 800W for 5 minutes, then quickly place it in liquid nitrogen to freeze for 5 minutes. Repeat this process twice. Finally, heat the tube in a microwave oven at 800W for 5 minutes. Centrifuge at 5000 rpm for 1 minute and place the precipitate at the bottom of the PCR tube.

[0079] (2) Identification by colony PCR

[0080] α-F: TACTATTGCCAGCATTGCTGCT;

[0081] 3AOX:GCAAATGGCATTCTGACATCC.

[0082] Take 1 μL of the supernatant from step (1) into a new PCR tube. Use primers α-F and 3AOX as amplification primers for colony PCR verification. The enzyme used is T5 Super PCR Mix (Colony) (purchased from Beijing Qingke Biotechnology Co., Ltd.). The PCR conditions are: 98℃ pre-denaturation for 5 min, one thermal cycle; 98℃ denaturation for 10 s, 55℃ annealing for 15 s, 72℃ extension for 15 s, 30 thermal cycles; 72℃ final extension for 5 min. Detect the PCR product by 1% agarose gel electrophoresis. If it is a positive transformant, a bright band will appear. The amplified band size is expected to be around 800 bp, and the corresponding bacterial species is a positive transformant.

[0083] 5. Preservation of recombinant Pichia pastoris

[0084] The single colony of the positive transformant selected in step 4 from the MD plate in step 3 was inoculated into a 250 mL Erlenmeyer flask containing 50 mL of YPD medium and cultured overnight at 30 °C and 220 rpm. The strain was then preserved in a -80 °C freezer using the glycerol method. This is the recombinant Pichia pastoris strain, which is the original GFP.

[0085] 6. Screening for high-copy recombinant strains using PTVA method

[0086] (1) Prepare 5 mL of 100 mg / mL G418 stock solution using sterile ddH2O;

[0087] (2) Take 5 mL of YPD medium and place it in a sterile 50 mL centrifuge tube. Add 17.5 μL of 100 mg / mL G418 stock solution. Inoculate the recombinant Pichia pastoris strain from step 5 into the centrifuge tube until OD. 600 =0.1, seal with sterile gauze, incubate at 30℃ and 220rpm in the dark for 24h;

[0088] (3) Under aseptic conditions, centrifuge at 4500 rpm, discard the supernatant, add 5 mL of fresh YPD liquid culture medium, then add 25 μL of 100 mg / mL G418 stock solution, and incubate at 30℃ and 220 rpm in the dark for 24 h.

[0089] (4) Repeat step (3), increasing the amount of G418 added every 24 hours until the Pichia pastoris mortality rate is above 95%, at which point the PTVA process ends. The specific amounts added are: 50 μL, 75 μL, 100 μL, 125 μL, and 150 μL.

[0090] (5) Measure the OD value of the bacterial solution after the PTVA process. First, dilute the bacterial solution to OD value with sterile ddH2O under sterile conditions. 600 =1, then dilute the bacterial solution with sterile ddH2O by 10. 6 Take 100 μL of the culture medium and spread it on a YPD plate containing G418 resistance (concentration is the same as the final concentration in the PTVA process, i.e., 3 mg / mL). Incubate at 30℃ and 220 rpm for 3-5 days. Pick single colonies of different sizes from the plate and inoculate them into 250 mL Erlenmeyer flasks containing 50 mL of YPD medium. Incubate overnight at 30℃ and 220 rpm to obtain the recombinant Pichia pastoris after PTVA screening, i.e., the resistant recombinant strain. Preserve the strain at -80℃ using the glycerol method.

[0091] 7. Rapid shake-flask high-density induction of recombinant yeast expression

[0092] Conventional Pichia pastoris shake-flask fermentation methods require 72-96 hours for the induction phase, resulting in low initial cell density. To shorten the experimental cycle, this invention uses GFP-expressing Pichia pastoris as a model strain and improves the shake-flask fermentation process by designing a new high-salt culture medium and methanol addition conditions, limiting the fermentation time to 24 hours. The fermentation method in this example only requires 24 hours to distinguish between high and low expression levels in the strain.

[0093] (1) The recombinant Pichia pastoris strain screened after PTVA screening and stored at -80℃ in step 6 was inoculated into BMGY medium at a volume concentration of 5%, and cultured at 30℃ and 220 rpm for 16-24 h until OD. 600 The value is 4.

[0094] (2) Centrifuge at 4500 rpm for 5 min at room temperature, collect the bacterial cells, and resuspend the bacterial cells in high-salt medium to OD. 600 8. Transfer 20 ml of the resuspended bacterial culture to a 250 ml Erlenmeyer flask, seal the flask with gauze, and incubate at 30°C and 220 rpm for 24 h. Add anhydrous methanol to the high-salt medium every 12 h until the final volume concentration is 1%.

[0095] (3) After culturing for 24 hours in step (2), take 1 mL of bacterial culture sample, centrifuge at 12000 rpm for 2 min at room temperature, collect the supernatant, and store it in a -20℃ refrigerator for later use as the sample to be tested.

[0096] (4) Determination of GFP fluorescence intensity in fermentation broth supernatant

[0097] Add 200 μL of the supernatant stored at 20°C in step (3) to each well of a 96-well plate, with three replicates for each sample; use a multi-mode microplate reader with an excitation wavelength of 483 nm and an emission wavelength of 535 nm to read the fluorescence values ​​of the samples in top-read mode; record the data. The fluorescence intensity of the sample is calculated according to the formula: Fluorescence intensity = (fluorescence value of recombinant Pichia pastoris strain - fluorescence value of GS115 strain without GFP gene) / fluorescence value of GS115 strain without GFP gene.

[0098] 8. Optimization of methanol addition in rapid shake-flask high-density fermentation process

[0099] (1) The recombinant Pichia pastoris strain stored at -80℃ in step 5 was inoculated into BMGY medium at a volume concentration of 5%, and cultured at 30℃ and 220rpm for 16-24h until the OD600 was 4.

[0100] (2) Centrifuge at 4500 rpm for 5 min at room temperature, collect the bacterial cells, and resuspend the bacterial cells in high-salt medium to OD. 600 8. The resuspended bacterial culture was divided into three groups. 20 ml of the resuspended culture from each group was transferred to a 250 ml Erlenmeyer flask, sealed with gauze, and incubated at 30°C and 220 rpm for 24 h on a shaker. For the first group, anhydrous methanol was added to the high-salt medium every 6 h until the final volume concentration reached 1%. For the second group, anhydrous methanol was added to the high-salt medium every 12 h until the final volume concentration reached 1%. For the third group, anhydrous methanol was added to the high-salt medium every 24 h until the final volume concentration reached 1%.

[0101] (3) After culturing for 24 hours in step (2), take 1 mL of bacterial culture sample, centrifuge at 12000 rpm for 2 min at room temperature, and collect the supernatant.

[0102] (4) Add 200 μL of the supernatant collected in step (3) to each well of the 96-well plate, and make three replicates for each sample; use a multi-functional microplate reader to read the fluorescence value of the sample in top-read mode at an excitation wavelength of 483 nm and an emission wavelength of 535 nm, and calculate the fluorescence intensity in the same way as in step 7. The results are shown in Table 1.

[0103] Table 1 Effect of different methanol addition amounts on fluorescence intensity

[0104]

[0105] As can be seen from the table above, the fermentation effect is best when methanol is added once every 12 hours.

[0106] 9. Optimization of yeast powder addition in high-salt culture medium during rapid shake-flask high-density fermentation.

[0107] (1) The recombinant Pichia pastoris strain stored at -80℃ in step 6 was inoculated into BMGY medium at a volume concentration of 5%, and cultured at 30℃ and 220rpm for 16-24h until the OD600 was 4.

[0108] (2) Centrifuge at 4500 rpm for 5 min at room temperature, collect the bacterial cells, and resuspend the bacterial cells in high-salt medium containing 10 g / L, 15 g / L, and 20 g / L yeast extract, respectively, to OD. 600 8. Take 20 ml of the resuspended bacterial culture and transfer it to a 250 ml Erlenmeyer flask. Seal the flask with gauze and incubate at 30°C and 220 rpm for 24 h on a shaker. Add anhydrous methanol to the high-salt medium every 12 h until the final volume concentration is 1%.

[0109] (3) After culturing for 24 hours in step (2), take 1 mL of bacterial culture sample, centrifuge at 12000 rpm for 2 min at room temperature, and collect the supernatant.

[0110] (4) Add 200 μL of the supernatant collected in step (3) to each well of the 96-well plate, and make three replicates for each sample; use a multi-functional microplate reader to read the fluorescence value of the sample in top-read mode at an excitation wavelength of 483 nm and an emission wavelength of 535 nm, and detect the fluorescence intensity in the same way as in step 7. The results are shown in Table 2.

[0111] Table 2 Effect of different yeast powder addition amounts on fluorescence intensity

[0112]

[0113] As can be seen from Table 2 above, the fermentation effect of adding 15g / L yeast powder is better than that of the groups with added 10g / L and 20g / L yeast powder.

[0114] In conclusion, the fermentation effect was better when 1% methanol was added over 12 hours and yeast powder was added at 15 g / L in a high-salt medium.

[0115] 10. Determination of copy number

[0116] (1) Housekeeping gene standard curve:

[0117] Using the genome of the recombinant Pichia pastoris strain extracted in step 5 from Takara's yeast genomics kit as a template, the housekeeping gene GADPH fragment and GFP gene fragment were amplified, and pMD were used to amplify them respectively. TM19 The -T Vector Cloning Kit was used to ligate the T vector to construct standard plasmids T-Vector-GAP and T-Vector-GFP, which were then transformed into competent E. coli DH5α cells for storage.

[0118] Escherichia coli strains containing T-Vector-GAP and T-Vector-GFP plasmids were inoculated into 5 mL LB liquid medium test tubes and cultured overnight at 37°C. The two plasmids were then extracted using a plasmid extraction kit as starting template standard plasmids.

[0119] Using standard plasmids of different copy numbers as templates, Roche real-time PCR was performed.

[0120] qPCR was performed using RT-GAP-F / RT-GAP-R and RT-GFP-F / RT-GFP-R primers.

[0121] Primers are as follows: RT-GAP-F: GGTATTAACGGTTTCGGACGTATTG,

[0122] RT-GAP-R:GATGTTGACAGGGTCTCTCTCTTGG;

[0123] RT-GFP-F GGCTGACAAACAAAAGAATGGTA,

[0124] RT-GFP-R GATAAGGCAGATTGAGTGGATA.

[0125] Each copy number was tested three times, with three parallel reactions per test. A standard curve was plotted with Cp value on the ordinate and the copy number of the initial template standard plasmid on the abscissa. The linear regression equation for the GAPDH gene standard curve was y = -2.345x + 27.855(R²). 2 =0.9925), the linear regression equation for the GFP gene standard curve is y = -2.344x + 27.12 (R = 0.9925). 2=0.9915).

[0126] (2) Determination of copy number of the test strain

[0127] Based on the data detected in step 7, five groups of strains with different fluorescence intensities (denoted as transformants GFP01, GFP02, GFP03, GFP04, and GFP05, with five strains in each group) and the recombinant Pichia pastoris strains constructed in step 5 (i.e., the original GFP strains, five strains) were selected from low to high for copy number determination. These six groups of strains were inoculated into 5 mL YPD medium test tubes and cultured overnight at 30°C. The genomes of the bacterial cultures were extracted using Takara's yeast genomics kit.

[0128] Using the same method as step (1), qPCR was performed with the bacterial genome as a template. The copy number was calculated based on the standard curve of step (1) and the Cp value of each genome. The results are shown in Table 3.

[0129] Table 3 Copy number of recombinant Pichia pastoris strains as determined by real-time quantitative PCR

[0130]

[0131] Table 3 shows that recombinant Pichia pastoris strains with GFP copy numbers of 1, 2, and 3 were obtained, indicating that the number of strains with different copy numbers is still insufficient. This result was obtained after randomly selecting nearly 80 strains from plates after PTVA.

[0132] The above example uses GFP as an example to improve the PTVA-based screening method for multi-copy strains, designing a new rapid shake-flask high-density fermentation method that shortens the experimental cycle by 3-4 days. However, due to the randomness of strain selection on the final PTVA plates, a large number of strains need to be selected for screening to obtain a strain population with diverse copy numbers, resulting in low efficiency.

[0133] Therefore, the present invention further replaces the random selection of plates in the above method with flow cytometry-guided screening after PTVA.

[0134] Example 2: Using Pichia pastoris strains expressing recombinant collagen as screening targets (Route A)

[0135] 1. Preparation of recombinant collagen expression vector pPIC9K-COL

[0136] (1) Construction of expression vector pPIC9K-COL

[0137] The collagen (COL) gene was optimized based on the codon preference of Pichia pastoris and synthesized by Nanjing Genscript Biotech Co., Ltd. The optimized collagen gene is 1383 bp in length and contains 461 amino acids. The base sequence is shown in SEQ ID NO.3.

[0138] The collagen gene fragment shown in SEQ ID NO.3 and the pPIC9K plasmid fragment were seamlessly ligated to the multiple cloning site of the pPIC9K plasmid using a one-step cloning kit via EcoRI and NotI double digestion. The resulting product was transformed into E. coli DH5α competent cells and cultured at 37°C on LB plates containing 50 mg / L ampicillin and 50 mg / L kanamycin. Positive clones were picked and sequenced for verification, yielding a strain containing the collagen gene recombinant plasmid. The plasmid was extracted to obtain the expression vector pPIC9K-COL, which was stored at -80°C.

[0139] SEQ ID NO.3

[0140]

[0141] (2) Linearization of expression vector pPIC9K-COL

[0142] Step 1: The expression vector pPIC9K-COL was digested with restriction endonuclease SacⅠ at 37℃ overnight. Then, 1% agarose gel electrophoresis was used to check whether the digestion was complete. After complete digestion, the digestion solution was purified using a PCR product purification kit, and the linearized plasmid was recovered.

[0143] The reaction system is as follows: plasmid pPIC9K-COL 1 μg, 10×L buffer 2 μL, SacⅠ 1 μL, sterile water added to 20 μL.

[0144] 2. Preparation of Pichia pastoris GS115 competent cells

[0145] Same as step 2 of Example 1.

[0146] 3. Electroconversion of Pichia pastoris

[0147] Same as step 3 in Example 1, except that the linearized plasmid is changed to pPIC9K-COL.

[0148] 4. PCR identification of recombinant transformants

[0149] The method is the same as step 4 of Example 1, except that the expected amplification band size of the positive transformant is about 1500 bp.

[0150] 5. Preservation of recombinant Pichia pastoris

[0151] Same as step 5 in Example 1.

[0152] 6. Screening for high-copy recombinant strains using PTVA method

[0153] Same as step 6 of Example 1.

[0154] 7. Flow cytometry sorting

[0155] (1) Place a 96-well plate in the collection chamber of the FACS Melody flow cytometer (BD Company) and add 80 μL of YPD liquid culture medium containing 50 mg / L ampicillin and 50 mg / L kanamycin to each well.

[0156] (2) Preparation of PI stock solution. Take 1 mg of propidium iodide (PI) powder into a sterile 2 mL EP tube, add 1 mL of pH 7.4, 0.1 M PBS to prepare a 1 mg / mL PI stock solution, dispense it and store it at -20℃ in the dark. Dilute it into buffer solution before each experiment.

[0157] (3) Dilute the bacterial culture obtained after PTVA in step 6 by ddH2O 100 times to OD. 600 To determine the optimal concentration, 1 mL of diluted bacterial suspension was added to 50 μL of PI stock solution (final PI concentration 50 μg / mL) as the experimental group. Simultaneously, 1 mL of diluted bacterial suspension was inactivated at 100℃ for 20 min, and then 50 μL of PI stock solution (final PI concentration 50 μg / mL) was added as the positive control group; 1 mL of diluted bacterial suspension was used as the negative control group. Each group was incubated at room temperature in the dark for 5-10 min, and then placed in an ice bath at 0℃. Debris, adherent cells, and dead cells were removed by adjusting the flow cytometry signal and appropriate cell population gating. The PE channel was selected, and samples were loaded at a low flow rate. Cell subpopulations were then gated in descending order of PI fluorescence intensity. Cells from different regions were selected for sorting in 96-well plates, with 5000 cells sorted per well. The results are shown below. Figure 1 ;

[0158] (4) Inoculate the 96-well plate cultures corresponding to the cell subpopulations screened in step (3) onto YPD medium plates and incubate at 30°C for 2-3 days. Then, select single colonies from the plates and transfer them to 3 mL of YPD medium, and incubate at 30°C and 220 rpm for 24 h. The strains selected from different plates are named COL01, COL08, COL09, COL10, COL12, and COL13, with 5 of each strain selected. Preserve the bacterial strains at -80°C using the glycerol method.

[0159] 8. Induced expression of recombinant yeast

[0160] (1) Inoculate the strain stored at -80℃ in step 7 into BMGY medium at a volume concentration of 5%, and incubate at 30℃ and 200rpm for 16-24 hours until OD. 600 The value is 4.

[0161] (2) Centrifuge at 4500 rpm for 5 min at room temperature, collect the bacterial cells, and resuspend the bacterial cells in high-salt medium to OD. 600 The sample was 8 μL, transferred to a new high-salt medium, sealed with gauze, and incubated at 30°C and 220 rpm for 24 h on a shaker. Anhydrous methanol was added to the high-salt medium every 12 h until the final volume concentration reached 1%.

[0162] (3) After culturing for 24 hours in step (2), take 1 mL of bacterial culture sample, centrifuge at 12000 rpm for 2 min at room temperature, collect the supernatant, and perform SDS-PAGE detection. The results are as follows: Figure 2 .

[0163] 9. Determination of copy number

[0164] (1) Housekeeping gene standard curve

[0165] Using the recombinant Pichia pastoris genome extracted in step 5 from Takara's yeast genome kit as a template, the housekeeping gene GADPH fragment and COL gene fragment were amplified, and pMD was used. TM19 The -T Vector Cloning Kit was used to ligate the T vector to construct standard plasmids T-Vector-GAP and T-Vector-COL, which were then transformed into competent E. coli DH5α cells for storage.

[0166] Escherichia coli strains containing plasmids T-Vector-GAP and T-Vector-COL were inoculated into 5 mL LB tubes and cultured overnight at 37°C. The two plasmids were then extracted using a plasmid extraction kit as starting template standard plasmids.

[0167] Using standard plasmids of different copy numbers as templates, qPCR was performed on the corresponding standard plasmids using a Roche real-time PCR instrument with primers RT-GAP-F, RT-GAP-R; RT-COL-F, RT-COL-R. The primers are as follows: RT-GAP-FGGTATTAACGGTTTCGGACGTATTG.

[0168] RT-GAP-R GATGTTGACAGGGTCTCTCTCTTGG,

[0169] RT-COL-F GATAAAGGTGAAGGTGGTGCTCC,

[0170] RT-COL-R TCTTTCTCCTTTACCACCTGGTTC. Each copy number was tested three times, with three parallel reactions per test. A standard curve was plotted with Cp value on the ordinate and the copy number of the initial template plasmid on the abscissa. The linear regression equation for the standard curve of the GAPDH gene was y = -3.201x + 34.852(R). 2 =0.9993), the standard curve linear regression equation for the COL3A1 gene is y = -4.449x + 45.566 (R = 0.9993). 2 =0.9994).

[0171] (2) Copy number of the test strain

[0172] The genomes of the bacterial culture induced in step 8 and the recombinant Pichia pastoris strain in step 5 were extracted using Takara's yeast genomic kit; qPCR was performed using the same method as in step (1). The copy number was calculated based on the standard curve and the Cp value of each genome, and the results are shown in Table 4.

[0173] Table 4. Copy number of Pichia pastoris for recombinant collagen

[0174]

[0175] In this embodiment, a method combining PI dye sorting and rapid high-density shake-flask fermentation was used to screen for different copy numbers of COL, resulting in strains with copy numbers of 1, 3, 4, 5, 6, 9, and 13. This copy number diversity facilitates the selection of the optimal fermentation strain. Compared to the GFP strain screening method in Example 1, the method combining flow cytometry not only shortens the time by more than one-third but also increases the probability of screening for diverse copy numbers to over 90%.

[0176] Example 3: A screening method combining flow cytometry sorting and rapid high-density fermentation based on DiOC6(3) (Route B)

[0177] 1. Preparation of a cloning vector for the recombinant bovine lactoferrin peptide expression gene

[0178] (1) Construction of expression vector pPIC9K-BlfFf

[0179] Based on the codon preference of Pichia pastoris, the bovine lactoferrin peptide (BlfFf) gene was optimized and synthesized by Nanjing Genscript Biotech Co., Ltd. The full-length bovine lactoferrin peptide expression gene is 1038 bp, with a total of 346 amino acids, and the base sequence is shown in SEQ ID NO.2.

[0180] The bovine lactoferrin peptide gene fragment shown in SEQ ID NO.2 and the pPIC9K plasmid fragment were seamlessly ligated to the multiple cloning site of the pPIC9K plasmid using a one-step cloning kit via EcoRI and NotI double digestion. The resulting product was transformed into E. coli DH5α competent cells and cultured at 37°C on LB plates containing 50 mg / L ampicillin and 50 mg / L kanamycin. Positive clones were picked and sequenced for verification, yielding a strain containing the bovine lactoferrin peptide gene recombinant plasmid. The plasmid was extracted to obtain the expression vector pPIC9K-BlfFf, which was stored at -80°C.

[0181] SEQ ID NO.2

[0182]

[0183] (2) Linearization of expression vector pPIC9K-BlfFf

[0184] The expression vector pPIC9K-BlfFf constructed in step 1 was digested with restriction endonuclease SacⅠ at 37℃ overnight. The complete digestion was then detected by 1% agarose gel electrophoresis. After complete digestion, the digestion solution was purified using a PCR product purification kit, and the linearized plasmid was recovered.

[0185] The reaction system is as follows: plasmid pPIC9K-BlfFf 1 μg, 10×L buffer 2 μL, SacⅠ 1 μL, and sterile water added to 20 μL.

[0186] 2. Preparation of Pichia pastoris GS115 competent cells

[0187] Prepared using the same method as step 2 of Example 1.

[0188] 3. Electroconversion of Pichia pastoris

[0189] The linearized plasmid pPIC9K-eGFP in Example 1 was replaced with the linearized plasmid pPIC9K-BlfFf, and the other operations were the same as step 3 in Example 1.

[0190] 4. PCR identification of recombinant transformants

[0191] The cell wall disruption and colony PCR identification of yeast transformants were the same as in Example 1, except that the expected amplification band size of positive transformants was about 1200 bp.

[0192] 5. Preservation of recombinant Pichia pastoris

[0193] Same as step 5 in Example 1.

[0194] 6. Screening for high-copy recombinant strains using PTVA method

[0195] The experimental procedure is the same as step 6 of Example 1.

[0196] 7. Induced expression of recombinant yeast

[0197] Same as step 7 of Example 1.

[0198] 8. Flow cytometry sorting of mitochondrial membrane potential

[0199] (1) Place a 96-well plate in the collection chamber of the FACS Melody flow cytometer (BD Company) and add 80 μL of YPD liquid culture medium containing 50 mg / L ampicillin and 50 mg / L kanamycin to each well.

[0200] (2) DiOC6(3) Mother liquor: Dissolve 3,3-dihexylocarbocyanineiodide (DiOC6(3)) in ethanol to prepare a DiOC6(3) mother liquor with a concentration of 0.05mM, dispense it and store it at -20℃ in the dark.

[0201] (3) Take 1 mL of the bacterial solution after fermentation in step 7 and dilute it 100 times with ddH2O to OD. 600 The concentration was 0.1, and 5 μL of DiOC6(3) stock solution was added to make the final concentration 0.25 μM as the experimental group. At the same time, 1 mL of diluted bacterial solution was inactivated at 100℃ for 20 min, and 50 μL of DiOC6(3) stock solution (final concentration 0.25 μM) was added as the positive control group; 1 mL of diluted bacterial solution was used as the negative control group. Each group was incubated in a water bath at 37℃ in the dark for 5-10 min. By adjusting the flow cytometer signal and the appropriate cell population gate, debris, adherent cells and dead cells were removed. The fluorescence intensity of DiOC6(3) was detected by the FITC detection channel (Ex=484nm; Em=501nm). The FITC channel (DiOC6(3) staining) was selected, and the sample was loaded at a low flow rate. Then, a series of cell subpopulations were gated in the order of strong to weak DiOC6(3) fluorescence and sorted into the corresponding wells of a 96-well plate. 5000 cells were collected in each well.

[0202] (4) Inoculate the 96-well plate cultures corresponding to the cell subpopulations screened in step (3) onto YPD medium plates and incubate at 30°C for 2-3 days. Then, select single colonies from the plates and transfer them to 3 mL of YPD medium, and incubate at 30°C and 220 rpm for 24 h. The colonies selected from different plates are named BlfFfG01 to BlfFfG08 (5 strains per group). The bacterial strains are preserved at -80°C using the glycerol method.

[0203] 9. Determination of copy number

[0204] (1) Housekeeping gene standard curve

[0205] Using the recombinant Pichia pastoris genome from step 5 as a template, the housekeeping gene fragments GADPH and BlfFf were amplified, and pMD was used. TM19 The -T Vector Cloning Kit was used to ligate the T vector to construct standard plasmids T-Vector-GAP and T-Vector-BlfFf, which were then transformed into E. coli DH5α competent cells for storage.

[0206] Escherichia coli strains containing T-Vector-GAP and T-Vector-BlfFf plasmids were inoculated into 5 mL LB tubes and cultured overnight. The two plasmids were then extracted using a plasmid extraction kit as standard plasmids.

[0207] qPCR was performed on the corresponding standard plasmids using a Roche real-time PCR instrument with RT-GAP-F / RT-GAP-R and RT-BlfFf-F / RT-BlfFf-R primers. The primers are as follows: RT-GAP-F GGTATTAACGGTTTCGGACGTATTG.

[0208] RT-GAP-R GATGTTGACAGGGTCTCTCTCTTGG,

[0209] RT-BlfFf-F AGATCCATACAAGTTGAGACCAGTTG,

[0210] RT-BlfFf-R GCAATGGTTCCAAAGACTCAGTC. Each concentration was tested in triplicate, with three parallel reactions per test. A standard curve was plotted with Cp value on the ordinate and the copy number of the initial template standard plasmid on the abscissa. The linear regression equation for the GAPDH gene standard curve was y = -3.471x + 37.184(R). 2 =0.9992), the linear regression equation for the BlfFf gene standard curve is y = -3.453x + 36.974 (R = 0.9992). 2 =0.9991)

[0211] (2) Copy number of the test strain

[0212] The strains obtained from step 8 were inoculated into 5 mL YPD test tubes and cultured overnight at 30°C. The genomes were extracted using Takara's yeast genome kit. The copy number of each genome was calculated based on the standard curve in step (1), and the results are shown in Table 5.

[0213] Table 5. Copy number of Pichia pastoris for recombinant bovine lactoferrin

[0214]

[0215] Table 5 shows that using the method of the present invention, recombinant bovine lactoferrin expression strains with copy numbers of 1, 2, 3, 4, 6, and 11 were screened, which is of great value for selecting the optimal fermentation strain.

[0216] 10. Verification of mitochondrial membrane potential in multi-copy strains

[0217] (1) High-density fermentation was carried out on recombinant bovine lactoferrin strains with copy numbers of 1, 2, 3, 6 and 10, using the same fermentation method as in Example 1;

[0218] (2) Take 1 mL of the fermentation solution and place it in a 2 mL EP tube. Centrifuge at 4500 rpm for 5 min, discard the supernatant, add 1.5 mL of sterile ddH2O to resuspend the cells and centrifuge. Repeat the above steps twice. Then wash the cells twice with PBS solution using the same method.

[0219] (3) After diluting the cleaned bacterial cells by a certain factor, the OD was measured. 600 The OD value of the undiluted bacterial culture was calculated, and then diluted with pH 7.4, 0.1 mol / L PBS solution to make the yeast cell count approximately 2.5 × 10⁻⁶. 6 Cells were dispersed by sonication at 20 kHz for 10 seconds, and 3 mL of the dilution solution was taken for later use.

[0220] (4) Prepare 0.05 mM DiOC6(3) stock solution using the method in Example 2.

[0221] (5) Take a diluted cell count of 2.5 × 10⁻⁶. 6 1 mL of bacterial suspension with a concentration of 1 / mL was added to 5 μL of DiOC6(3) stock solution to a final concentration of 0.25 μM as the experimental group. Simultaneously, 1 mL of the diluted bacterial suspension was inactivated at 100℃ for 20 min, and then 50 μL of DiOC6(3) stock solution (final concentration 0.25 μM) was added as the positive control group; 1 mL of the diluted bacterial suspension was used as the negative control group. All groups were incubated at 37℃ in the dark for 5-10 min. The fluorescence intensity of DiOC6(3) was detected using a BD flow cytometer via the FITC detection channel (Ex = 484 nm; Em = 501 nm), and 10 samples were collected. 4 Cells were analyzed for DiOC6(3) fluorescence, and the differences in membrane potential among different strains were as follows: Figure 3 .

[0222] In this example, DiOC6(3) fluorescent staining was used to screen recombinant Pichia pastoris strains with different copy numbers in flow cytometry. The membrane potential of the screened strains with different copy numbers was verified after high-density fermentation. The correlation between membrane potential and copy number showed that mitochondrial membrane potential was positively correlated with the BlfFf copy number level, which is the experimental basis for the application of DiOC6(3) fluorescent staining in this invention. The method of combining flow cytometry sorting with high-density fermentation using membrane potential measurement also shortens the time compared with conventional methods and improves the efficiency of screening strains with different copy numbers to a certain extent.

[0223] In summary, the present invention establishes an efficient method for screening multi-copy recombinant Pichia pastoris strains. This method is based on the characteristics of two fluorescent dyes and can be implemented using either route A: PTVA → PI-based flow cytometry screening → rapid shake-flask fermentation → copy number identification, or route B: PTVA → rapid shake-flask fermentation → DiOC6(3)-based flow cytometry screening → copy number identification.

Claims

1. A method for efficiently screening recombinant Pichia pastoris strains with different copy numbers, characterized in that, The method is performed according to the following steps: 1) The recombinant Pichia pastoris strain containing the exogenous gene was inoculated into a culture medium containing resistance, and the resistant recombinant strain was screened by PTVA method; 2) Step 1) Inoculate the resistant recombinant bacteria into BMGY medium and incubate at 30℃ and 220 rpm for 16-24 hours until OD. 600 4; centrifuge at 4500 rpm for 5 min at room temperature, collect the bacterial cells, and resuspend the bacterial cells in high-salt medium to OD. 600 8; Take 20 ml of the resuspended bacterial culture and transfer it to a 250 ml Erlenmeyer flask, seal the flask with gauze, and incubate at 30℃ and 220 rpm for 24 h on a shaker. Every 12 h, add anhydrous methanol to the high-salt medium until the final volume concentration is 1%; after 24 h of incubation, obtain the bacterial culture at the end of fermentation; the composition of the high-salt medium is: 15 g / L yeast extract, 0.465 g / L CaSO4, 7.45 g / L MgSO4·7H2O, 11.8 g / L KH2PO4, 9.1 g / L K2SO4, 5 g / L ammonium sulfate, 10 mL / L methanol, and biotin 4 × 10⁻⁶. -4 The PTM1, with a concentration of g / L and a solvent of 2 mL / L, is composed of: H3BO3 0.02 g / L, CuSO4·5 H2O 6.0 g / L, MnSO4·H2O 3.0 g / L, Na2MoO4·2 H2O 0.2 g / L, CoCl2 0.5 g / L, NaI 0.08 g / L, ZnCl2 20.0 g / L, FeSO4·7 H2O 65.0 g / L, biotin 0.2 g / L, 5.0 mL / L H2SO4, and ddH2O, diluted to 1 L. 3) In step 2), 3,3-diethyloxacarbonyl anthocyanin iodine was added to the fermented bacterial solution at the end of fermentation as the experimental group. 3,3-diethyloxacarbonyl anthocyanin iodine was added to the inactivated fermented bacterial solution at the end of fermentation as the positive control group. The fermented bacterial solution at the end of fermentation was used as the negative control group. After incubation in the dark, fluorescence detection was performed using flow cytometry to screen recombinant bacteria with different fluorescence intensities. The final concentration of 3,3-diethyloxacarbonyl anthocyanin iodine added was 0.25 μM.

2. The method as described in claim 1, characterized in that, Step 1) includes the genes for green fluorescent protein eGFP, collagen peptide COL, and bovine lactoferrin peptide BlfFf.

3. The method as described in claim 1, characterized in that, Step 1) The PTVA screening method is as follows: Recombinant Pichia pastoris strains containing exogenous genes are inoculated into YPD medium containing G418 until OD... 600 =0.1, seal with sterile gauze, incubate at 30 ℃ and 220 rpm in the dark for 24 h, increase the amount of G418 every 24 h by 0.1-2 times, and stop PTVA when the G418 addition makes the lethality of Pichia pastoris above 95% and screen for resistant recombinant bacteria.

Images