Fdh-gdh fusion protein, encoding gene, and coevolution system and coevolution method

Abstract

The application discloses an FDH-GDH fusion protein, which comprises a first amino acid sequence with CO2 reductase activity and a second amino acid sequence with glycerol dehydrogenase activity, and the first amino acid sequence and the second amino acid sequence are connected through a connecting peptide. The application also discloses a gene coding the fusion protein, an expression vector and a surface display engineering bacterium. In addition, the application discloses an FDH-GDH co-evolution system and method. The application combines glycerol dehydrogenase and CO2 reductase, and converts glycerol into dihydroxyacetone while fixing CO2 to produce formic acid. The application realizes CO2 fixation and produces high-value-added products such as dihydroxyacetone. The application also provides a co-evolution method of CO2 reductase and glycerol dehydrogenase, obtains a high-activity CO2 reductase and glycerol dehydrogenase fusion protein, displays the fusion protein on the surface of E. coli, and realizes efficient CO2 fixation and efficient dihydroxyacetone production.

Description

Technical Field

[0001] This invention relates to an FDH-GDH fusion protein, its encoding gene, and an FDH-GDH co-evolution system and method. Background Technology

[0002] 1,3-Dihydroxyacetone (DHA) is the simplest ketose, chemically reactive, and an important chemical and pharmaceutical intermediate widely used in chemical, pharmaceutical, and food industries, with broad market prospects. The main methods for DHA synthesis are chemical synthesis and microbial fermentation. Traditional chemical synthesis uses heavy metal atoms as active ingredients, requires very strict reaction conditions, consumes a large amount of energy, has low catalytic activity, and causes serious environmental pollution. In other words, chemical synthesis suffers from high raw material costs, harsh reaction conditions, demanding production equipment, low product yield, and environmental pollution. Microbial fermentation, on the other hand, utilizes biological enzymes to catalyze the production of DHA. This method uses glycerol as a substrate and utilizes glycerol dehydrogenase produced during microbial metabolism to dehydrogenate the hydroxyl group at the 2-position of glycerol, producing DHA. Therefore, compared with chemical synthesis, biotransformation has advantages such as milder reaction conditions, higher reaction specificity, less environmental pollution, higher substrate utilization, and higher catalytic efficiency.

[0003] Existing microbial conversion of glycerol to DHA production generally suffers from inhibitory effects of substrates and products on the producing strains, resulting in reduced conversion rates and prolonged production cycles when glycerol concentrations are increased, thus making it difficult to improve DHA yield. Summary of the Invention

[0004] The main objective of this invention is to provide a method for using glycerol dehydrogenase and CO2 reductase in combination, which converts glycerol into 1,3-dihydroxyacetone while fixing CO2 to produce formic acid.

[0005] The technical solution adopted in this invention is as follows:

[0006] An FDH-GDH fusion protein comprising a first amino acid sequence having CO2 reductase activity and a second amino acid sequence having glycerol dehydrogenase activity, wherein the first amino acid sequence and the second amino acid sequence are linked by a linker peptide.

[0007] Preferably, the linker peptide is (GGGGS)3, (GS)3, or (EAAAK)3.

[0008] Preferably, the first amino acid sequence is shown in SEQ ID No. 5, and the second amino acid sequence is shown in SEQ ID No. 7.

[0009] Preferably, the amino acid sequence of the fusion protein is shown in SEQ ID No. 13.

[0010] The present invention also discloses the encoding gene of the above-mentioned FDH-GDH fusion protein.

[0011] Preferably, its nucleotide sequence is shown in SEQ ID No. 12.

[0012] Preferably, its nucleotide sequence is shown in SEQ ID No. 14.

[0013] Preferably, the vector contains the FDH-GDH fusion protein encoding gene described above, as well as the encoding gene of the surface display system.

[0014] Preferably, the carrier is pET28a, and the surface display system adopts Lpp-OmpA or IN3 surface display system.

[0015] The present invention also discloses an engineered bacterium for surface display of FDH-GDH fusion protein, characterized in that it contains the above-mentioned fusion protein expression vector.

[0016] Preferably, the engineered bacteria is Escherichia coli.

[0017] The above-mentioned FDH-GDH fusion protein surface demonstrates the application of engineered bacteria in the catalytic synthesis of 1,3-dihydroxyacetone.

[0018] This invention also discloses an FDH-GDH co-evolutionary system, characterized by comprising:

[0019] (1) A formic acid biosensor, wherein the formic acid biosensor encodes the FHLA gene and the Kana resistance gene, and uses a regulated promoter to initiate the expression of the FHLA gene, the FHLA promoter regulating the expression of the Kana resistance gene;

[0020] (2) FDH-GDH mutant library plasmid, wherein the FDH-GDH mutant library plasmid is obtained by amplifying the above-mentioned FDH-GDH fusion protein encoding gene using error-prone PCR, and cloning the amplified FDH-GDH fusion protein gene into an expression vector.

[0021] (3) Host bacteria, which are transformed with the above-mentioned formic acid biosensor and FDH-GDH mutant library plasmid.

[0022] Preferably, the adjustable promoter is the Tac promoter.

[0023] Preferably, the nucleotide sequence of the formic acid biosensor is shown in SEQ ID No. 10.

[0024] Preferably, the expression vector is pET32a.

[0025] Preferably, the host bacterium is Escherichia coli.

[0026] This invention also discloses an FDH-GDH co-evolution method, the steps of which include:

[0027] (1) Construction of formic acid biosensor: The expression of FHLA gene is initiated by the Tac promoter, and the FHLA promoter regulates the expression of Kana resistance gene;

[0028] (2) Obtaining FDH-GDH mutant library plasmid: Amplify the FDH-GDH fusion protein encoding gene as described in claim 5 or 6 using error-prone PCR, clone the amplified FDH-GDH fusion protein gene library into the pET32a vector, and obtain the FDH-GDH mutant library plasmid.

[0029] (3) Screening: The FDH-GDH mutant library plasmid was transferred into E. coli containing formic acid biosensor. Single clone strains with fast growth rate were selected by screening with IPTG and high concentration Kana plates. Catalytic tests were performed, and strains with enhanced yield were selected, i.e. containing the evolved FDH-GDH fusion protein.

[0030] Glyceryl dehydrogenase (GDH) is a key enzyme in the production of 1,3-dihydroxyacetone from glycerol. This invention utilizes a surface display system to exhibit GDH on the outer membrane of *E. coli* cells, increasing the binding degree between glycerol and GDH, thereby improving glycerol conversion efficiency, effectively avoiding the inhibitory effect of high-concentration glycerol on cells, and achieving efficient enzyme utilization. This invention employs two surface display systems. The first is the Lpp-OmpA display system, which can display catalytically active enzymes on the outer membrane of *E. coli*, generating a variety of whole-cell biocatalysts. OmpA is a β-barrel outer membrane protein of *E. coli*, forming a barrel-like structure with β-sheets that spans the outer membrane and can transport proteins with relatively large molecular weights. Lipoprotein (Lpp) is another outer membrane protein, anchored to the outer membrane by its amino-terminal lipid portion, and is also the most abundant lipoprotein on the surface of *E. coli*. The lipoprotein signal peptide is fused with a portion of the OmpA peptide to form a composite display system.

[0031] The second display system of this invention is the ice nucleation protein (INP) display system. INP is a classic carrier protein in bacterial surface display systems, belonging to a type of secretory surface protein found in bacteria. As a commonly used carrier protein, INP exists in various bacteria, such as *Pseudomonas fluorescens*, *Pseudomonas*, *Xanthomonas*, and *Eurybrio*, resulting in numerous mutants with varying functions. INP protein can effectively increase the display amount of target proteins, maximize the preservation of target protein activity, display a wide variety of target proteins, and ensure that the target proteins do not adversely affect the host. The ice nucleation protein INP selected in this invention was synthesized at Guangzhou Aiji Biotechnology Co., Ltd. using *Pseudomonas syringae* as a template, and the genomic sequence (IN3) of the ice nucleation protein INP was obtained by PCR amplification.

[0032] The principle of microbial conversion of glycerol to DHA involves glycerol dehydrogenase produced during microbial metabolism, which dehydrogenates the hydroxyl group at the 2-position of glycerol to generate DHA. The reaction requires the participation of the NAD+ oxidase, which catalyzes the conversion of NAD+ to NADH. Domestic and international literature reports that microorganisms used for DHA production mainly include Acetobacter, Gluconbacter, Serratia, and Klebsiella, with Gluconobacter oxydans being the most widely used strain in the industrial production of 1,3-dihydroxyacetone.

[0033] Glycerol dehydrogenase consumes a significant amount of NAD+ during the conversion of NAD+ and glycerol into NADH and dihydroxyacetone, increasing the cost of dihydroxyacetone production. CO2 reductase can fix CO2 into one-carbon organic compounds such as formic acid, which can then be used in the production of other organic compounds. Simultaneously, it converts NADH (reduced appendase I) into NAD+ (oxidized appendase I), thus continuously providing NAD+ for the DHA conversion process from glycerol. Therefore, this invention uses the genome of *Klebsiella* as a template and amplifies the genomic sequence (gldA) of glycerol dehydrogenase (GDH) using PCR. Furthermore, a fusion protein is formed by binding a linker to CO2 reductase (FDH). This invention combines glycerol dehydrogenase and CO2 reductase, simultaneously fixing CO2 to produce formic acid and converting glycerol into dihydroxyacetone. This achieves both CO2 fixation and the production of high-value-added products such as dihydroxyacetone. Furthermore, existing CO2 reductases and glycerol dehydrogenases have low activities. This invention provides a co-evolution method for CO2 reductase and glycerol dehydrogenase, obtaining a highly active CO2 reductase and glycerol dehydrogenase fusion protein, which is then displayed on the surface of *E. coli*, achieving efficient CO2 fixation and efficient production of dihydroxyacetone. This invention has advantages such as low cost, high value, green environmental protection, and recyclability, and is suitable for the efficient production of dihydroxyacetone. Attached Figure Description

[0034] Figure 1 Image of the pET28a-Lpp-OmpA-FDH-GDH(GGGGS)3 expression vector.

[0035] Figure 2 Map of the pET28a-IN3-FDH-GDH(GGGGS)3 expression vector.

[0036] Figure 3 Map of the pET28a-Lpp-OmpA-FDH-GDH(GS)3 expression vector.

[0037] Figure 4 : pET28a-IN3-FDH-GDH(GS)3 expression vector map.

[0038] Figure 5 Image of the expression vector pET28a-Lpp-OmpA-FDH-GDH(EAAAK)3.

[0039] Figure 6 Image of the pET28a-IN3-FDH-GDH(EAAAK)3 expression vector.

[0040] Figure 7 : Induced expression of FDH-GDH fusion protein.

[0041] Figure 8 Comparison of FDH-GDH fusion proteins with different surface displays and linker linkage methods catalyzing the production of dihydroxyacetone and formic acid.

[0042] Figure 9 Schematic diagram of the co-evolution of the FDH-GDH fusion protein.

[0043] Figure 10 HPLC identification chromatograms of the catalytic products of the FDH-GDH fusion protein before and after evolution.

[0044] Figure 11 Comparison of dihydroxyacetone and formic acid production before and after evolution. Detailed Implementation

[0045] The present invention will be further described below with reference to the embodiments, but the description of the embodiments does not limit the scope of protection of the present invention in any way.

[0046] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the description of this invention is for the purpose of describing particular embodiments only and is not intended to limit the invention.

[0047] Unless otherwise specified, all substances or instruments used in the following examples can be obtained from conventional commercial sources.

[0048] In this invention, the Lpp-OmpA sequence is derived from *Escherichia coli*, with the specific amino acid sequence shown in SEQ ID No. 1 and the DNA sequence shown in SEQ ID No. 2. The IN3 gene sequence is derived from *Pseudomonas syringae*, with the specific amino acid sequence shown in SEQ ID No. 3 and the DNA sequence shown in SEQ ID No. 4. It is linked to the His tag of the pET32a vector via a GS linker peptide.

[0049] The FDH sequence is derived from *Klebsiella pneumoniae* (see SEQ ID No. 5 for the specific amino acid sequence and SEQ ID No. 6 for the DNA sequence). The GDH sequence is derived from *Escherichia coli* (see SEQ ID No. 7 for the specific amino acid sequence and SEQ ID No. 8 for the DNA sequence). FDH is linked to GDH via three linking peptides: flexible linker (GGGGS)3, (GS)3, and rigid linker (EAAAK)3, to form a fusion protein.

[0050] The amino acid sequence of the FHLA gene is shown in SEQ ID No. 9, and the DNA sequence of the entire formic acid biosensor is shown in SEQ ID No. 10.

[0051] The amino acid sequence of the pre-evolutionary FDH-GDH fusion protein is shown in SEQ ID No. 11, and the DNA sequence is shown in SEQ ID No. 12. The amino acid sequence of the post-evolutionary FDH-GDH fusion protein is shown in SEQ ID No. 13, and the DNA sequence is shown in SEQ ID No. 14.

[0052] Example 1: Construction of engineered bacteria and induction of expression of pET28a-Lpp-OmpA-FDH-GDH fusion protein

[0053] (1) Construction of the expression vector for pET28a-Lpp-OmpA-FDH-GDH: The DNA sequence of Pet28a-lpp-OmpA was synthesized at Guangzhou Aiji Biotechnology Co., Ltd., and primers 28aforlpp-FDH were designed.

[0054] gatccggctgctaacaaagcccgaaaggaagctgag (SEQ ID No. 15);

[0055] lpp-R: atggtgatgatgatgatgggaaccgcctccgccgttgtccgggcgggtgc (SEQ ID No. 16).

[0056] The synthesized vector was linearized using PCR amplification. The PCR program was as follows: 98℃ for 3 min; 98℃ for 10 s, 58℃ for 30 s, 72℃ for 3 min for 30 cycles; extension at 72℃ for 10 min; reaction stopped; and incubation at 4℃. The PCR products were detected by 1% agarose gel electrophoresis, and the target gene fragment was recovered using a gel extraction kit.

[0057] The FDH gene sequence was synthesized at Guangzhou Aiji Biotechnology Co., Ltd., and primers were designed. The FDH gene sequence was amplified by PCR using the following program: 98℃ for 3 min; 98℃ for 10 s, 58℃ for 30 s, 72℃ for 60 s for 30 cycles; extension at 72℃ for 10 min; reaction stopped; and incubation at 4℃. The PCR product was detected by 1% agarose gel electrophoresis, and the target gene fragment was recovered using a gel extraction kit. The pET28a-lpp-OmpA backbone and the FDH gene were ligated using 5 μl of seamless cloning enzyme at a molar ratio of 1:3 (10 μl ligation system, 50℃ overnight). The ligation product was transformed into *E. coli* DH5α, and positive clones were screened for sequence analysis. The plasmid was extracted from clones with the correct sequence to obtain the recombinant plasmid pET28a-lpp-OmpA-FDH.

[0058] Using Klebsiella pneumoniae glycerol dehydrogenase genomic DNA as a template, primers were designed that included (a) a flexible linker peptide (GGGGS) 3 primer F:

[0059] ggcggaggggggtcagggggggggggatctggaggcgggggttcaatgctaaaggtaatacaatcacccgctaaa (SEQ ID No. 17);

[0060] (b)(GS)3 primer F:

[0061] aaagcgggcggaagcgggtctgggtctatgctaaaggtaatacaatcacccgctaaa (SEQ ID No. 18);

[0062] and (c) rigid linker peptide (EAAAK) 3 primer F:

[0063] caaaggaagctgctgcgaaggaggcagctgcaaagatgctaaaggtaatacaatcacccgctaaa(SEQID No.19);

[0064] Common primer R: gctttgttagcagccggatcttagcgcgccaaccactgctgaccca (SEQ ID No. 20).

[0065] The gene encoding glycerol dehydrogenase (GDH) (gldA) was amplified by PCR using the following program: 98℃ for 3 min; 30 cycles of 98℃ for 10 s, 58℃ for 30 s, and 72℃ for 60 s; extension at 72℃ for 10 min; reaction stopped; and incubation at 4℃. The PCR product was detected by 1% agarose gel electrophoresis. A 1.0 kb fragment was recovered using a gel extraction kit and seamlessly ligated with the recovered pET28a-Lpp-OmpA-FDH linearized vector using a 10 μl seamless ligase at 50℃ overnight. The ligation product was transformed into *E. coli* DH5α, and positive clones were screened for sequence analysis. The plasmid was extracted from clones with correct sequences to obtain the recombinant plasmid pET28a-Lpp-OmpA-FDH-GDH. The plasmid map is shown below. Figure 1 , 3 As shown in Figure 5.

[0066] (2) Transformation

[0067] The plasmid was transformed into *E. coli* Rosetta using standard methods to obtain the *Rosetta / pET28a-Lpp-OmpA-FDH-GDH* strain. Single clones were picked and cultured in LB broth containing kanamycin, followed by shaking. Colony PCR was performed using universal primers for the vector to identify the bacterial strains, and strains with correct sequencing results were preserved.

[0068] (3) Expression of fusion protein

[0069] After successful identification, the expression strains were cultured in LB medium at 37°C and 220 rpm until the OD600 reached 0.6-0.8. Then, IPTG was added to a final concentration of 1 mM, and the culture was induced for 20 h at 30°C and 220 rpm. The expressed bacterial cells were enriched by centrifugation, then SDS-PAGE loading buffer was added, and the mixture was boiled in water for 10 min, followed by centrifugation at 12000 rpm for 1 min at 4°C. The supernatant was then used for SDS-PAGE electrophoresis to detect protein expression levels.

[0070] The results of surface display expression vector-induced expression of FDH-GDH fusion protein are shown in Figure 7 .

[0071] Example 2: Construction of engineered bacteria and induction of expression of pET28a-IN3-FDH-GDH fusion protein

[0072] (1) Construction of the expression vector of pET28a-IN3-FDH: The DNA sequence of IN3 was synthesized at Guangzhou Aiji Biotechnology Co., Ltd., using the following primers.

[0073] 28aforlpp-F: gatccggctgctaacaaagcccgaaaggaagctgag (SEQ ID No. 21);

[0074] IN3-R:

[0075] catatggtgatgatgatgatgggaaccgcctccgccggtgctaccataggtagcagtct (SEQ ID No. 22).

[0076] The synthesized vector was linearized using PCR amplification. The remaining construction methods for FDH and GDH are described in Example 1-(1). The resulting plasmid maps are shown below. Figure 2 , 4 As shown in Figure 6.

[0077] (2) Transformation

[0078] The plasmid was transformed into *E. coli* Rosetta using standard methods to obtain the *Rosetta / pET28a-Lpp-OmpA-FDH-GDH* strain. Single clones were picked and cultured in LB broth containing kanamycin, followed by shaking. Colony PCR was performed using universal primers for the vector to identify the bacterial strains, and strains with correct sequencing results were preserved.

[0079] (3) Expression of fusion protein

[0080] After successful identification, the expression strains were cultured in LB medium at 37°C and 220 rpm until the OD600 reached 0.6-0.8. Then, IPTG was added to a final concentration of 1 mM, and the culture was induced for 20 h at 30°C and 220 rpm. The expressed bacterial cells were enriched by centrifugation, then SDS-PAGE loading buffer was added, and the mixture was boiled in water for 10 min, followed by centrifugation at 12000 rpm for 1 min at 4°C. The supernatant was then used for SDS-PAGE electrophoresis to detect protein expression levels.

[0081] The results of surface display expression vector-induced expression of FDH-GDH fusion protein are shown in Figure 7 As can be seen, all fusion proteins were expressed.

[0082] Example 3 Whole-cell catalytic reaction of FDH-GDH fusion protein

[0083] (1) Induction of expression: Single clones of each expression strain from Example 2 were picked and activated in 3 ml of LB medium containing kanamycin at 37°C overnight. 3% activation solution was inoculated into 10 ml of LB medium containing kanamycin at 37°C and 220 rpm until the OD600 reached 0.6-0.8. IPTG was added to a final concentration of 1 mM, and the culture was continued at 30°C and 220 rpm for 20 h. The cells were collected by centrifugation at 10000 rpm and 4°C for 10 min. The cells were resuspended in PBS and washed twice.

[0084] (2) Whole-cell catalysis

[0085] Prepare the catalytic buffer: 20 g / L glycerol, 10 g / L NAD+, 3 mM NAHCO3, 1X PBS buffer.

[0086] The bacterial cells were resuspended in catalytic buffer. The mixture was incubated at 37°C with shaking at 100 rpm for 48 h. After the catalytic reaction was complete, the catalytic solution was collected and centrifuged at 12000 rpm for 10 min at 4°C. The supernatant was collected, and the yields of DHA and formic acid were determined by HPLC. The results are shown below. Figure 8As shown, FDH-GDH fusion proteins with different surface displays and linker linkage methods all have good co-catalytic ability to produce DHA and formic acid. Among them, the IN3 protein surface display and 3×GGGGS as the linker have the best effect.

[0087] Example 4: Co-evolution of FDH-GDH fusion protein

[0088] (1) Construction of a formic acid-containing biosensor strain: The expression of the FHLA gene (amino acid sequence shown in SEQ: NO. 9) was initiated using the Tac promoter. The FHLA promoter regulates the expression of the Kana resistance gene. The DNA sequence of the entire formic acid biosensor is shown in SEQ: NO. 10. The formic acid biosensor plasmid was synthesized at Guangzhou Aiji Biotechnology Co., Ltd., and transformed into Rosetta (DE3) Escherichia coli. The plasmid was then spread on LB agar plates containing 50 mg / L streptomycin and chloramphenicol. The plates were incubated overnight at 37°C. Single clones were picked and cultured in LB liquid medium containing 50 mg / L streptomycin and chloramphenicol at 37°C and 220 rpm until the OD600 value reached 0.4. Competent cells were prepared using a supercompetent cell preparation kit and stored at -80°C for later use.

[0089] (2) Obtaining the FDH-GDH mutant library plasmid: The IN3-(GGGGS)3-FDH-GDH recombinant fusion protein gene was amplified using BioLab's ready-to-use error-prone PCR kit, with 0.1 ng and 1 ng DNA as templates, for 30, 40, 50, and 60 cycles respectively. The amplified DNA was collected and a highly complex mutant library was prepared. The amplified fragment was seamlessly cloned into pET32a using Novizan's seamless cloning kit.

[0090] (3) Screening: The FDH-GDH mutant library plasmid was transformed into competent E. coli cells containing a formic acid biosensor and cultured at 37°C and 220 rpm in LB broth containing 50 mg / L streptomycin, ampicillin, and chloramphenicol until the OD600 value reached 0.8. IPTG was added to a final concentration of 1 mM, and the cells were cultured at 30°C and 220 rpm for another 20 h. The cells were collected by centrifugation at 10000 rpm and 4°C for 10 min. The cells were resuspended in PBS and washed twice. The cells were then resuspended in catalytic culture medium (5 g / L glycerol, 1 g / L NAD+, 20 mM NAHCO3, 1X PBS buffer, 1X LB broth) and cultured at 37°C and 100 rpm with shaking for 5 h. The bacterial strains were plated on kanamycin resistance selection plates (0.1 mM IPTG, 500 mg / L kanamycin, 15 g / L agar, 5 g / L glycerol, 1 g / L NAD+, 20 mM NAHCO3, 1X PBS buffer, 1X LB medium). Fast-growing single-clone colonies were picked and sequenced for verification. The principle of the selection is as follows: Figure 9 As shown.

[0091] (4) Whole-cell catalysis: The sequenced plasmid was transformed into competent *E. coli* Rosetta (DE3) cells, and whole-cell catalysis was performed after induction of expression. The catalytic buffer was prepared as follows: 20 g / L glycerol, 10 g / L NAD+, 3 mM NaHCO3, and 1X PBS buffer. The bacterial cells were resuspended in the catalytic buffer. The cells were incubated at 37°C with shaking at 100 rpm for 48 h. After the catalytic reaction, the catalytic solution was collected and centrifuged at 12000 rpm for 10 min at 4°C. The supernatant was collected, and DHA was detected by HPLC. Figure 10-11 As shown, compared with the pre-evolutionary FDH-GDH fusion protein, the evolved FDH-GDH fusion protein significantly increases the production of DHA and formic acid.

[0092] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. An FDH-GDH surface-displayed fusion protein, characterized in that: The amino acid sequence of the fusion protein is shown in SEQ ID No. 11 or SEQ ID No.

13.

2. The gene encoding the fusion protein displayed on the surface of the FDH-GDH according to claim 1, characterized in that... Its nucleotide sequence is shown in SEQ ID No. 12 or SEQ ID No.

14.

3. An FDH-GDH surface-displaying fusion protein expression vector, characterized in that... The vector contains the encoding gene of the FDH-GDH surface-displaying fusion protein as described in claim 2.

4. The FDH-GDH surface-displaying fusion protein expression vector according to claim 3, characterized in that... The carrier is pET28a, and the surface display system adopts Lpp-OmpA or IN3 surface display system.

5. An engineered bacterium for displaying FDH-GDH fusion protein on its surface, characterized in that... It contains the fusion protein expression vector as described in claim 3 or 4.

6. The engineered bacteria displayed on the surface of the FDH-GDH fusion protein according to claim 5, characterized in that... The engineered bacteria is Escherichia coli.

7. The application of engineered bacteria displayed on the surface of the FDH-GDH fusion protein according to claim 5 or 6 in the catalytic synthesis of 1,3-dihydroxyacetone.

Images