Application of GS3, GW8 and / or GS9 genes in regulating stigma exhumation rate in rice

By screening and knocking out the GS3, GW8, and GS9 genes, the pistil exposure rate in rice was increased using CRISPR/Cas9 technology, solving the problem of low stigma exposure rate in rice and achieving a significant increase in stigma exposure rate and hybrid seed production efficiency.

CN116334122BActive Publication Date: 2026-07-17SOUTH CHINA AGRICULTURAL UNIVERSITY

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SOUTH CHINA AGRICULTURAL UNIVERSITY
Filing Date
2022-07-05
Publication Date
2026-07-17

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively clone genes that regulate the exposure of stigmas in rice, resulting in low seed production efficiency and low stigma exposure rate in hybrid rice, which hinders the promotion and application of hybrid rice.

Method used

By studying the development process of rice spikelets, the GS3, GW8 and GS9 genes were screened out, and these genes were knocked out in japonica rice ZH11 using CRISPR/Cas9 technology to increase the pistil exposure rate and construct mutants with high stigma exposure rate.

Benefits of technology

It significantly improved the stigma exposure rate of rice by more than 50%, made the grains more slender and elongated, increased the number of grains per plant, and enhanced the efficiency of hybrid seed production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116334122B_ABST
    Figure CN116334122B_ABST
Patent Text Reader

Abstract

This invention discloses the application of GS3, GW8, and / or GS9 genes in regulating stigma exposure rate in rice. Through systematic analysis of the molecular characteristics and biological functions of cloned rice grain shape genes, this invention identified three key genes potentially involved in regulating rice grain shape and stigma exposure. Expression analysis revealed that GS3, GW8, and / or GS9 genes are highly expressed during the rapid growth phase of the stigma. Knocking out GS3, GW8, and / or GS9 genes in japonica rice Zhonghua 11 using CRISPR / Cas9 technology increased the stigma exposure rate of three-pronged plants by more than 50% compared to the wild type. Simultaneously, it was found that GS3, GW8, and / or GS9 have an additive effect on the stigma exposure rate trait in rice, exhibiting the following order: three-pronged > two-pronged > single-pronged. This indicates that editing GS3, GW8, and / or GS9 genes can significantly improve the stigma exposure rate in rice, providing a theoretical basis and excellent gene resources for the genetic improvement of rice stigma exposure rate.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of agricultural molecular biotechnology. More specifically, it relates to the application of the GS3, GW8, and / or GS9 genes in regulating the stigma exhumation rate in rice. Background Technology

[0002] Rice (Oryza sativa L.) is an important food crop, and my country is one of the world's largest producers and consumers of rice. Sufficient rice production plays a crucial role in ensuring China's food security. Hybrid rice is the most effective way to increase rice yield, especially inter-subspecies hybridization between indica and japonica rice, which can further increase rice yield by about 20% and is a major direction for future breeding. However, the low stigma exposure rate of sterile lines severely restricts hybrid seed production, which is a key bottleneck limiting the promotion of hybrid rice.

[0003] Stigma exsertion in rice refers to the phenomenon where the stigma of a floret remains exposed outside the glumes after it has closed. The percentage of florets with exposed stigmas in a single panicle is called the stigma exsertion rate (SER). After stigma exsertion, its activity can be maintained for 3-7 days. In F1 hybrid rice seed production, the seed setting rate of florets with exposed stigmas is as high as 64%-90%, while the seed setting rate of non-exposed florets is only 15.7%. Therefore, increasing the stigma exsertion rate in rice is an effective method to promote the development and popularization of hybrid rice. Currently, quantitative trait loci (QTLs) are used to precisely locate the major QTLs for stigma exsertion in rice, thereby regulating and increasing seed production yield. However, since most of the QTL loci located are low in contribution and heritability, they are difficult to apply to marker-assisted breeding. At the same time, due to the difficulty in investigating stigma exposure and the influence of environmental factors, no gene regulating stigma exposure has been cloned yet, and the genetic mechanism affecting the stigma exposure rate of rice is still unclear. Improving the stigma exposure rate of rice can enhance the seed production efficiency of hybrid rice. Therefore, improving the stigma exposure rate has become one of the effective means of improving traits in the commercial seed production technology of hybrid rice. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to overcome the defects and deficiencies of the above-mentioned problems and to provide the application of GS3, GW8 and / or GS9 genes in regulating the stigma exposure rate of rice.

[0005] The first objective of this invention is to provide applications of the GS3, GW8 and / or GS9 genes.

[0006] The second objective of this invention is to provide a formulation that improves the stigma exposure rate of rice.

[0007] The third objective of this invention is to provide a breeding method for increasing the stigma exposure rate of rice.

[0008] The above-mentioned objective of this invention is achieved through the following technical solution:

[0009] This invention studies the morphological changes of the glumes and pistils (including styles and stigmas) during rice spikelet development. We found that the glumes and pistils grow synchronously, with faster growth in the S11a to S12 stages. Then, based on gene function and their genetic impact on rice agronomic traits, we analyzed cloned rice grain shape genes and ultimately screened out three genes: GS3, GW8, and GS9, whose nucleotide sequences are shown in SEQ ID NO: 1–3. The GS3, GW8, and GS9 genes are negative regulators of grain length and / or positive regulators of grain width. Loss-of-function alleles of the GS3, GW8, and GS9 genes can improve grain quality without adversely affecting other rice agronomic traits.

[0010] This invention's research shows that GS3, GW8, and GS9 exhibit similar expression patterns during pistil development, with their expression levels peaking at the S11b stage, where pistil growth rate is highest, and significantly decreasing at the S12 stage after pistil formation. This evidence strongly suggests that GS3, GW8, and GS9 may regulate stigma exhumation and could serve as suitable candidate targets for improving rice stigma exhumation. Further, this invention uses CRISPR / Cas9 technology to knock out GS3, GW8, and GS9 in japonica rice ZH11. It was found that three-protruding plants showed a stigma exhumation rate more than 50% higher than the wild type, with more slender grains and an increased number of grains per plant. Simultaneously, it was found that GS3, GW8, and / or GS9 have an additive effect on the stigma exhumation rate trait in rice, exhibiting a stigma exhumation rate order of: three protruding protrusions > two protruding protrusions > one protruding protrusion. This indicates that GS3, GW8, and / or GS9 can regulate rice stigma exhumation rate and are suitable for hybrid seed production.

[0011] Therefore, this invention provides the application of GS3, GW8 and / or GS9 genes in regulating the stigma exposure rate of rice, in increasing the stigma exposure rate of rice, in constructing transgenic rice with stigma exposure mutants, and in preparing gene preparations to increase the stigma exposure rate of rice.

[0012] This invention provides the use of reagents for knocking out the GS3, GW8 and / or GS9 genes in increasing the stigma exposure rate of rice or in the preparation of formulations that increase the stigma exposure rate of rice.

[0013] This invention provides a formulation for improving the stigma exposure rate of rice, containing a reagent for knocking out the GS3, GW8 and / or GS9 genes.

[0014] Preferably, the CRISPR / Csa9 target sequence for knocking out the GS3 gene is shown in SEQ ID NO:4.

[0015] Preferably, the CRISPR / Csa9 target sequence for knocking out the GW8 gene is shown in SEQ ID NO:5.

[0016] Preferably, the CRISPR / Csa9 target sequence for knocking out the GS9 gene is shown in SEQ ID NO:6.

[0017] This invention provides a breeding method to improve the stigma exposure rate of rice. In rice, gene knockout technology is used to knock out the GS3, GW8 and / or GS9 genes at specific sites to obtain mutant plants with high stigma exposure rate.

[0018] Preferably, the gene knockout technology is CRISPR / Csa9 technology.

[0019] Preferably, a CRISPR / Cas9 gene editing vector containing the target sequences of the GS3, GW8 and / or GS9 genes is constructed, and rice is transformed to obtain mutant lines with high stigma exposure rate.

[0020] The present invention has the following beneficial effects:

[0021] This invention discloses the application of GS3, GW8, and / or GS9 in regulating stigma exposure rate in rice. Through systematic analysis of the molecular characteristics and biological functions of cloned rice grain shape genes, this invention reveals that GS3, GW8, and GS9 may be key genes involved in regulating rice grain shape and stigma exposure. Expression analysis showed that GS3, GW8, and GS9 are highly expressed during the rapid stigma growth stages (S11a and S11b). Knockout of the GS3, GW8, and GS9 genes in japonica rice ZH11 using CRISPR / Cas9 technology increased the stigma exposure rate of three-mutant plants by more than 50% compared to the wild type, while also resulting in more slender grains and an increased number of grains per plant. Hybridization of three-mutant plants with ZH11 resulted in the separation of double-mutant and single-mutant materials with different genes. It was found that GS3, GW8, and / or GS9 have an additive genetic effect on the stigma exposure rate trait in rice, exhibiting a stigma exposure rate order of: three-mutant > double-mutant > single-mutant. This indicates that editing the GS3, GW8, and / or GS9 genes can significantly increase the stigma exposure rate in rice, providing a theoretical basis and excellent gene resources for the genetic improvement of the stigma exposure rate in rice. Attached Figure Description

[0022] Figure 1Identification of GS3, GW8, and GS9 as regulatory genes for stigma exposure in rice; (a) Dynamic changes in glumes and pistils during spikelet development in ZH11, with S8b-S12 stages determined according to (Zhang D and Wilson ZA, Stamen specification and other development in rice), Bar = 1 mm; (b) Pearson correlation between spikelet area and total length of stigma and style; (c) qRT-PCR analysis data of GS3, GW8, and GS9 in pistils at S11a, S11b, and S12 stages, expressed as mean ± SEM, n = 3;

[0023] Figure 2 Sequence analysis of GS3, GW8, and GS9 knockout mutants; target sites are shown in light blue, and mutation information is highlighted in pink boxes;

[0024] Figure 3 To investigate the synergistic regulation of rice glumes and pistils by GS3, GW8, and GS9; (ah) Comparison of glume shape between ZH11 and various knockout combinations of GS3, GW8, and GS9, Bar = 1 mm. (ip) Comparison of pistil shape between ZH11 and various knockout combinations of GS3, GW8, and GS9, Bar = 1 mm. (qv) Statistical data on glume length (q), glume width (r), glume length / glume width (s), stigma length (t), style length (u), and total stigma and style length (v) of ZH11 and various knockout mutants of GS3, GW8, and GS9. "**" indicates that ZH11 and its various knockout mutants are statistically significant through a two-tailed t-test, P < 0.01. Data are expressed as mean ± SEM, n = 10.

[0025] Figure 4 To investigate the synergistic regulation of rice glumes and pistils by GS3, GW8, and GS9; (af) Comparison of glume shape between ZH11 and various knockout combinations of GS3, GW8, and GS9, Bar = 1 mm; (gl) Comparison of pistil shape between ZH11 and various knockout combinations of GS3, GW8, and GS9, Bar = 1 mm; (mo) Statistical data on glume length (m), glume width (n), glume length / glume width (o), stigma length (p), style length (q), and total stigma and style length (r) of ZH11 and various knockout mutants of GS3, GW8, and GS9; "**" indicates that ZH11 and its various knockout mutants are statistically significant through a two-tailed t-test, P < 0.01, and data are expressed as mean ± SEM, n = 10;

[0026] Figure 5The effects of GS3, GW8, and GS9 on important agronomic traits of rice; (ad) comparison of grain shape (a), grain length (b), grain width (c), and thousand-grain weight (d) of ZH11 and GS3 / GW8 / GS9 triads; (eh) comparison of panicle shape (e), panicle length (f), number of primary branches (g), and number of secondary branches (h) of ZH11 and GS3 / GW8 / GS9 triads; (il) comparison of plant type (i), plant height (j), number of tillers (k), and number of grains per plant (l) of ZH11 and GS3 / GW8 / GS9 triads; Bar = 1 cm in (a) and (e), Bar = 10 cm in (i), and "**" indicates ZH11. The knockout mutants and their various knockout mutants were statistically significant by the two-tailed t-test, P<0.01, and the data are expressed as mean ± SEM; n=8 for (bc), (fh) and (jl), and n=5 for (d);

[0027] Figure 6 The stigma exposure rate and outcrossing rate of ZH11 and gs3 / gw8 / gs9 trimutations are shown below. (a) Stigma exposure phenotype of ZH11 and gs3 / gw8 / gs9 trimutations after flowering, with red arrows indicating exposed stigmas, Bar = 1 cm; (b) Statistical analysis of stigma exposure rate, SSE: unilateral stigma exposure rate, DSE: bilateral stigma exposure rate, TSE: total stigma exposure rate, n = 10; (c) F1 seeds of ZH11 or gs3 / gw8 / gs9 trimutations and astaxanthin-treated rice, with orange-red rice grains representing outcrossed seeds; (d) Outcrossing rate of ZH11 and gs3 / gw8 / gs9 trimutations, with "**" indicating that ZH11 and its various knockout mutants are statistically significant through a two-tailed t-test, P < 0.01. Data are expressed as mean ± SEM, n = 4. Detailed Implementation

[0028] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.

[0029] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.

[0030] The GS3, GW8, and GS9 gene sequences used in this invention are shown below:

[0031] GS3 gene (SEQ ID NO:1): ATGGCAATGGCGGCGGCGCCCCGGCCCA AGTCGCCGCCGGCGCCGCCCGACCCATGCGGCCGCCACCGCCTCCAGCTC GCCGTCGACGCGCTCCACCGCGAGATCGGATTCCTCGAGGGTGAAATAAATTCAATCGAAGGGATCCACGCTGCCTCCAGATGCTGCAGAGAGGTTGACG AATTCATCGGAAGAACTCCTGATCCATTCATAACGATTTCATCGGAGAAGCGAAGTCATGATCATTCTCACCACTTCTTGAAGAAGTTTCGCTGTTTGTGC AGAGCAAGTGCGTGCTGCCTCAGCTACCTCTCCTGGATCTGCTGCTGCAGC AGCGCCGCCGGCGGCTGCTCATCCTCCTCCTCCTCCTCCTTCAACCTCAAGAGGCCGAGCTGCTGCTGCAACTGCAACTGCAACTGCTGCTCCTCCTCCTCC TCCTCATGTGGGGCGGCGTTAACGAAGAGTCCGTGTCGCTGCCGCCGCCGCAGCTGCTGCTGCCGTCGCTGCTGCTGCGGCGGCGTCGGCGTCCGCGCGT GCGCGAGCTGCAGCTGCTCCCCGCCGTGCGCGTGCTGCGCGCCGCCGTGC GCGGGATGCTCGTGCCGCTGCACCTGCCCGTGCCCGTGCCCCGGCGGCTGCTCCTGCGCGTGCCCGGCGTGCAGGTGCTGCTGCGGCGTCCCTCGTTGCTG CCCCCCCTGCTTGTGA;

[0032] GW8 gene (SEQ ID NO:2): ATGGAGTGGGATCTCAAGATGCCGCCGG CGGCGAGCTGGGAGCTAGCCGACGAGCTGGAGAACAGCGGCGGCGGGGGTGTACCGGCGGCGGTATCGTCGTCATCGGCTGCGGTTGGTGGCGGCGTCA ATGCGGGGGGTGGTGGCAGGCAGGAGTGCTCGGTCGACCTCAAGCTCGGCGGGTTGGGGGAGTTCGGCGGCGGCGGCGCGCAGCCGCGGGTCGCCGTGG CGGGCGAGCCGGCCAAGGGGAAGGGGCCAGCGGCCGCCGCCACGGGAGCAGCAGCAGCAGCGTCGTCGGCGCCGGCGAAGCGGCCGCGCGGTGCGGCG GCGGCGGGGCAGCAGCAGTGCCCGTCGTGCGCGGTGGACGGGTGCAAGGAGGACCTGAGCAAGTGCCGCGACTACCATCGCCGGCACAAGGTGTGCGAGGCCCACTCCAAGACCCCCCTCGTCGTCGTCTCCGGCCGCGAGATGCGCTTCTGCCAGCAGTGCAGCAGGTTTCACTTGCTTCAGGAGTTTGATGAGGCCA AGCGCAGCTGTAGAAAGCGACTAGATGGGCACAACCGTCGCCGCAGGAAGCCACAGCCAGATCCCATGAACTCTGCAAGTTATCTTGCAAGCCAACAAG GGGCAAGATTCTCACCGTTCGCGACGCCGAGACCGGAGGCAAGCTGGACAGGGATGATCAAAACCGAGGAGAGCCCATACTACACGCACCACCAAATC CCTCTTGGCATCAGCAGCAGGCAGCAGCATTTCGTTGGCTCCACCTCTGACGGCGGCCGCCGCTTCCCTTTCCTCCAGGAAGGCGAGATCAGCTTCGGCAC CGGCGCCGGCGCCGGCGGCGTGCCAATGGATCAGGCAGCAGCTGCTGCTG CTGCTTCAGTGTGCCAGCCACTTCTGAAGACGGTAGCTCCTCCTCCTCCTCCTCATGGCGGCGGCGGCAGCGGCGGCGGCAAGATGTTCTCCGATGGTGGGTTGACACAAGTGCTCGACTCCGATTGTGCTCTCTCTCTTCTGTCAGCTCCGGCGAACTCCACGGCCATCGACGTCGGCGGTGGCCGGGTGGTCGTCCAGCC GACCGAGCACATCCCCATGGCGCAGCCTCTCATCTCTGGCCTTCAGTTCGGCGGCGGCGGCGGCAGCTCAGCCTGGTTCGCGGCGCGGCCGCATCATCAGGCGGCCACCGGCGCCGCCGCCACCGCCGTCGTCGTCTCGACGGCCGGTTTCTCCTGCCCGGTGGTGGAGAGCGAGCAGCTGAACACAGTCCTGAGCTCCAA TGACAATGAGATGAACTACAATGGGATGTTTCACGTCGGCGGCGAAGGCTCATCGGATGGCACGTCGTCGTCTCTGCCGTTCTCATGGCAGTAG;

[0033] GS9 gene (SEQ ID NO:3): ATGGAGGCAGCAGCCCAAGAAAGGGAGC TGCAGCTGCTGCAGCTGCAGGGAGTGTCCTGGCCTTTCCACGCGATGGAGGCAGCGAGAAGCAGCAGCTGGGACGCCACCACCAGCAGCGGCAGCAGCA GCGGCGCCAGCGGCGGCGGCGGCGGCGATTGCTTCCTGCTCGGTTGGGAGCCGCCGTTCGCCGCCGGCTGCCTCGGCGTCCTCGCCGCCGACGTCCACGG CCTCTTCCCACTCTACATGGAGTCGCCGCCGGCGCCGCCGCAGCAGGACGCGGTGGCATTGCCGGAGGAGCTCGACGACCTTCTCCTGAATTTCTGGGAC GCAAGCAGCGACCAGCAGCAACAACAACAACAGGTCGCCTTCAATTCCAGCTGCATCCTGCAGGAGAAGACGAGCAGCACCACTGCCACTGCAACCACC ACCAACTCCAACTCCAACTTCTTCTACGACGACGATGATCTCCTGGGCTCGATTTTCTCGACGGGTCCCACATTGCCAGAGAAAGGCGTGGCAGAGCCACT ACTCAGCAGCTCATCCTCCAACTGCCAGGCGGACCCACAGGTCAGTGAGGTTAGTGGGGCCCAGCCGCAGGCCACTCCGGCCGCGCCAGGTGTCGCGCGG GCCCCACCTCGCTGCTCCTCCTCCTCGTCGCTGAAGCGCGCCGCGCCGGCGGAGGACGCGGCGGCGGAGGCGGAGTACTGCAGACAGAGCAGCAGCAAGC GGCGAAGGGAGGCGGAGACGCCGACGCCGGAGAAGTCGGCGGCGGCGGCGGCGGCGCCGGCGTGCAGGGTGCTGCGCCCGTTCGCGGTGCTGAAGCCGG ACGGGCTGGACGGCGGCGCGACGCTGGCGGACATCAACGCGCGGATCCTGATGCGGCCGTCGCGGCCGGTGCGCCACCCCGTCGGCGAGTTCGCGTGCGCGCCGCGCGTGTCGGCGGACAAGCCGGGGCTCTCCGGCAAGGCCGTCGCC GGCTTCACCAGGCTGCACAACCCCGGGACGCGGCACCATCACCATCATACGAACCAGAGGCTAG.

[0034] Example 1: Identification of GS3, GW8, and GS9 as regulatory genes for stigma exposure in rice

[0035] 1. Test Methods

[0036] (1) Experimental materials: Japonica rice Zhonghua 11 (ZH11) was obtained from Baige Biotechnology Co., Ltd.

[0037] (2) The stigmas of 11-flowered japonica rice at different developmental stages were observed and photographed using a stereomicroscope and statistically analyzed.

[0038] (3) RNA extraction from rice stigma samples:

[0039] The stigmas of fresh japonica rice floret 11 from the S11b and S12 stages were selected, ground into powder in liquid nitrogen, and RNA was extracted using the Trizol method under RNase-free conditions.

[0040] (4) RNA reverse transcription and qRT-PCR:

[0041] Sample RNA according to Hifair III. Reverse transcription was performed to synthesize cDNA according to the instructions of the kit (gDNase). The reaction system is shown in Table 1.

[0042] Table 1. cDNA Synthesis Reaction System

[0043]

[0044] The sample was diluted with cDNA:ddH2O at a ratio of 1:9, and then followed the Hieff procedure. The qRT-PCR experiment was performed using the SYBR GreenMaster Mix (No Rox) qPCR kit. The reaction primers, system, and procedure are shown in Tables 2, 3, and 4.

[0045] Table 2 Quantitative Primer Sequence List

[0046]

[0047] Table 3 qRT-PCR reaction system

[0048]

[0049] Table 4 qRT-PCR amplification program

[0050]

[0051] 2. Test Results

[0052] By studying the morphological changes of the glumes and pistils (including style and stigma) during spikelet development, we found that the glumes and pistils grow synchronously, with faster growth in the S11a to S12 stage. Figure 1 As shown in ab, this suggests that the size of the glume and pistil may be jointly regulated by grain type genes. Then, we conducted a comprehensive analysis of the cloned rice grain type genes based on their functions and their genetic impact on rice agronomic traits. Ultimately, three genes, GS3, GW8, and GS9, were identified. GS3 is associated with rice grain length and weight (Fan C, Xing Y, Mao H et al., GS3, a major QTL for grain length and weight and minor QTL for grain width and thickness in rice, encodes a putative transmembrane protein); GW8 is associated with rice grain shape and quality (Wang S, Wu K, Yuan Q et al., Control of grain size, shape, and quality by OsSPL16 in rice); and GS9 is associated with rice grain length and quality (Zhao DS, Li QF, Zhang CQ et al., GS9 acts as a transcriptional activator to regulate rice grain shape and appearance quality). These three genes are negative regulators of grain length and / or positive regulators of grain width. Loss-of-function alleles of these genes can improve grain quality without adversely affecting agronomic traits of rice. Therefore, we hypothesize that knocking out these genes in rice could increase the grain length / width ratio and increase pistil length, thereby improving SER.

[0053] Furthermore, based on qRT-PCR results, we also showed that GS3, GW8, and GS9 exhibited similar expression patterns in developing pistils, as shown in the following figures. Figure 1 As shown in c, its expression level was highest at the S11b stage, when the pistil growth rate was the highest, and decreased significantly at the S12 stage after pistil formation. This evidence strongly suggests that GS3, GW8, and GS9 may regulate SER and could serve as suitable candidate targets for the improvement of rice SER.

[0054] Example 2: Creation and Phenotypic Analysis of GS3, GW8, and GS9 Mutant Materials

[0055] 1. Test Methods

[0056] (1) Screening and designing CRISPR / Csa9 target sequences specific to GS3, GW8, and GS9 genes, and performing off-target analysis using the website http: / / skl.scau.edu.cn / . The CRISPR / Csa9 target sequences specific to GS3, GW8, and GS9 genes are shown below:

[0057] GS3(SEQ ID NO:4):CGAGGTACAATCTATCTCT;

[0058] GW8 (SEQ ID NO:5):GGTATCGTCGTCATCGGCTG;

[0059] GS9 (SEQ ID NO: 6): CGCGATGGAGGCAGCGAGA.

[0060] These target sequences were introduced into sgRNA expression cassettes to construct CRISPR / Cas9 gene editing vectors. After the CRISPR / Cas9 gene editing vectors were verified by PCR sequencing, they were transformed into ZH11 rice using Agrobacterium-mediated transformation. The genetic transformation of rice was entrusted to Baige Company.

[0061] (2) Measurement of characteristics of florets and stigmas: Florets two hours before opening were selected for observation and photography under a stereomicroscope. The length and width of the florets were measured using Image J software. Florets two hours before opening were selected, and the stigmas were separated from the florets. They were observed and photographed under a stereomicroscope. The length of the stigmas and styles were measured and recorded using Image J software.

[0062] 2. Test Results

[0063] After genotype identification, such as Figure 2 As shown, under the ZH11 background, two different GW8 single-pronged attacks, one GS3 single-pronged attack, and two GS9 single-pronged attacks were obtained respectively. Figure 2 a); two different GS3 / GW8 double-penetration events, two different GS3 / GW9 double-penetration events, and one GW8 / GW9 double-penetration event ( Figure 2 b); Two different GS3 / GW8 / GS9 triple-penetration events ( Figure 2 c).

[0064] By statistically analyzing the stigma and style lengths, and the length and width of the spikelets of ZH11 and different mutant materials, the results are as follows: Figure 3 and 4 As shown, in the single-protrusion material, GW8 increased the stigma and style length by 16.38% and decreased the glume width by 16.71%, while the glume length itself did not change significantly; GS3 increased the stigma and style length by 36.09% and the glume length by 10.67%, with no significant change in glume width; furthermore, GS9 increased the stigma and style length by 15.61% and the glume length by 9.07%, while also decreasing the lemma width by 12.61%.

[0065] In the double-pronged materials, the stigma and style of GS3 / GSSW8 increased by 34.33%, that of GW8 / GS9 by 19.07%, and that of GS9 / GS3 by 35.51%. Regarding glumes, the glumes of GS3 / GSSW8 increased by 11.29% in length and decreased by 14.72% in width; that of GW8 / GS9 increased by 4.97% in length and decreased by 20.32% in width; and that of GS9 / GS3 increased by 24.54% in length and decreased by 9.4% in width.

[0066] In the three-pronged material, the stigma style was significantly longer, increasing by 44.45% relative to the wild type; the florets were slender, with the glumes increasing in length by 23.75% and decreasing in width by 18.02%. These data indicate that GS3, GW8, and GS9 synergistically regulate the growth of rice glumes and pistils.

[0067] Example 3: Statistical analysis of important agronomic traits of the GS3 / GW8 / GS9 tri-protrusions

[0068] 1. Test Methods

[0069] Investigation of rice agronomic traits: After the grains are fully ripe, cut the main panicle of the target plant below the panicle neck node, put it in a kraft paper envelope, write the variety name and plant number on the envelope; bundle the same materials together for the purpose of seed testing.

[0070] The specific characteristics investigated are as follows:

[0071] (1) Plant height: from the base of the rice plant to the top of the highest tiller, measured in centimeters;

[0072] (2) Number of tillers: The number of tillers that produce 5 or more grains after grain filling;

[0073] (3) Number of grains per plant: The total number of grains of effective tillers per plant after grain filling;

[0074] (4) Ear length: The length of the grain from the neck node of the ear to the top of the ear, excluding the awn length, and is measured in centimeters;

[0075] (5) Number of primary branches: The number of branches that originate from the main branch;

[0076] (6) Number of secondary branches: The number of branches that originate from the primary branches;

[0077] (7) Grain length: Select 20 grains with normal shape from the same growing position and measure the length of each grain with vernier calipers.

[0078] (8) Grain width: Select 20 grains with normal shape from the same growing position and measure the width of each grain with vernier calipers.

[0079] (9) Thousand-grain weight: Dry the grains thoroughly, remove the chaff, and randomly select 1,000 plump grains to weigh (or weigh 500 grains and then convert them to the thousand-grain weight). The difference between the two weights should not exceed 3% of their average value. Otherwise, repeat the process. The weight is measured in grams.

[0080] 2. Test Results

[0081] The results are as follows Figure 5 As shown, compared with the wild type, the GS3 / GW8 / GS9 triad exhibits a more elongated grain shape, accompanied by a decrease in thousand-grain weight. Figure 5 (ad); In terms of panicle type, there were no significant differences in panicle length, primary branch stalk, and secondary branch stalk. Figure 5 In terms of plant type, there was no significant difference in plant height, but the number of tillers and grains per plant increased significantly. Figure 5 il).

[0082] These data suggest that the GS3, GW8, and / or GS9 genes can be applied to production to improve the stigma exposure rate of sterile lines.

[0083] Example 4 evaluates the hybrid seed production potential of GS3 / GW8 / GS9.

[0084] 1. Test Methods

[0085] (1) Experimental materials: Astaxanthin-containing rice (provided by Academician Liu Yaoguang's team)

[0086] (2) Examination of stigma exposure rate

[0087] Stigma exposure rate: For each individual plant, the first spike to finish flowering is selected, and the number of spikelets exposed on both sides, the number of spikelets exposed on one side, and the number of spikelets not exposed are counted. The stigma exposure rate can be calculated using the following formula:

[0088] Stigma exposure rate (%) = (Number of exposed spikelets on one side / Total number of spikelets) × 100%

[0089] Stigma exposure rate (%) = (Number of exposed spikelets on both sides / Total number of spikelets) × 100%

[0090] Total exposed column head percentage (%) = Single-sided exposed column head percentage + Double-sided exposed column head percentage

[0091] (3) Examination of cross-crossing rate

[0092] To evaluate the outcrossing rate of GS3 / GS8 / GS9, a field trial was conducted. Two rows of GS3 / GS8 / GS9 trimutation plants were planted, surrounded by four rows of astaxanthin-treated rice. Each line was replicated four times, with ZH11 serving as a control. During the flowering period, artificial pollination was performed twice daily. After 30 days, seeds of ZH11 and the mutants were harvested. The number of outcrossed seeds was counted, and the outcrossing rate was calculated as: number of outcrossed seeds (red) / total number of seeds.

[0093] 2. Test Results

[0094] The results are as follows Figure 6 As shown, compared with the wild type, the stigma exposure rate of the GS3 / GW8 / GS9 tri-protrusions was significantly increased, with the total stigma exposure rate increasing by 54.94%, the unilateral stigma exposure rate increasing by 43.7%, and the bilateral stigma exposure rate increasing by 11.24%. Figure 6 a, b). In the crossbreeding experiment, statistics showed that the crossbreeding rate of the GS3 / GW8 / GS9 triple mutant was significantly higher than that of the wild type. Compared with the wild type's crossbreeding rate of 0.14%, the crossbreeding rate of the GS3 / GW8 / GS9 triple mutant reached 2.65%. Figure 6 c, d).

[0095] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. GS3 , GW8 and GS9 The application of genes in regulating stigma exhumation rate in rice is characterized by, The GS3 , GW8 and GS9 The nucleotide sequences of the gene are shown in SEQ ID NO:1~3; the regulation of stigma exposure rate in rice is achieved by knocking out the gene in rice. GS3, GW8 and GS9 Genes can be used to increase stigma exposure.

2. The claim 1 GS3 , GW8 and GS9 The application of the gene in constructing mutant rice lines with increased stigma exposure rate is characterized by, The mutant rice line with increased stigma exposure was constructed by knocking out [a specific generatrix] in rice. GS3, GW8 and GS9 Genes can be used to increase stigma exposure.

3. Knockout GS3 , GW8 and GS9 The application of gene-based reagents in increasing the stigma exhumation rate of rice or in the preparation of formulations that increase the stigma exhumation rate of rice, wherein... GS3 , GW8 and GS9 The nucleotide sequences of the gene are shown in SEQ ID NO:1~3.

4. The application according to claim 3, characterized in that, The formulation contains knockout GS3 , GW8 and GS9 Gene knockout reagents; GS3 The CRISPR / Cas9 target sequence of the gene is shown in SEQ ID NO:4; knockout GW8 The CRISPR / Cas9 target sequence of the gene is shown in SEQ ID NO:5; knockout GS9 The CRISPR / Cas9 target sequence of the gene is shown in SEQ ID NO:

6.

5. A breeding method for increasing the stigma exposure rate of rice, characterized in that, Gene knockout technology is used in rice to modify the gene described in claim 1. GS3 , GW8 and GS9 Genes were knocked out at specific sites to obtain mutant lines with increased stigma exposure.

6. The method according to claim 5, characterized in that, The gene knockout technology is CRISPR / Cas9 technology.

7. The method according to claim 6, characterized in that, A CRISPR / Cas gene editing vector containing the target sequence of the gene described in claim 1 was constructed, and rice was transformed to obtain mutant lines with high stigma exposure rate.