An optimized reagent for a second-generation sequencing-by-synthesis reaction

CN116334196BActive Publication Date: 2026-09-25SHENZHEN SALUS BIOMED CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202210965593.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-08-12
Publication Date
2026-09-25
Estimated Expiration
2042-08-12

AI Technical Summary

Technical Problem

但在信号采集过程中,因为缺乏成像缓冲液的保护,荧光信号淬灭的很快,而且整体的测序质量也有较大幅度的下降

Benefits of technology

[0007]为了寻找能够在信号采集和合成反应同时进行过程中具有良好保护作用的试剂,对反应的缓冲体系进行了调整,当采用HEPES、SSC、Tricine、磷酸盐等缓冲体系时,相比于现有的Tris对于核酸分子的保护作用以及反应产生荧光的淬灭抑制具有良好效果。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116334196B_ABST
    Figure CN116334196B_ABST
Patent Text Reader

Abstract

The application discloses an optimized reagent for a second-generation gene sequencing synthesis reaction, which comprises a buffer, a soluble salt, a polymerase and a nucleotide analogue, and the buffer is at least one selected from HEPES buffer, SSC buffer, Tricine buffer and PBS buffer. According to the reagent for the synthesis reaction, at least the following beneficial effects are achieved: in order to find a reagent which can have a good protection effect in the process of simultaneous signal acquisition and synthesis reaction, the buffer system of the reaction is adjusted, and when HEPES, SSC, Tricine, phosphate and other buffer systems are used, the protection effect of the buffer system on nucleic acid molecules and the quenching inhibition of reaction fluorescence generation are better than those of the existing Tris.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of gene sequencing, specifically relating to an optimized second-generation gene sequencing synthesis reaction reagent. Background Technology

[0002] Existing next-generation sequencing (SBS) technologies, represented by Illumina's bridge amplification technology and BGI's DNBSEQ technology, both identify and differentiate the four bases (A, C, G, and T / U) in a DNA sequence by detecting fluorescence signals. Specifically, these methods use dNTPs (dATP, dCTP, dGTP, dTTP) with fluorescent and blocking groups, each carrying different fluorescent groups. Current SBS-based sequencing methods include the following three steps: 1. Synthesis reaction: Under the action of polymerase, dNTPs with fluorescent and blocking groups are added to the 3′ end of the sequencing strand; 2. Signal acquisition: After the polymerization reaction, an optical imaging system acquires the fluorescence signal; 3. Excision reaction: After signal acquisition, a suitable excision reagent is added to cleave the fluorescent and blocking groups from the dNTPs, returning them to their native state for the next cycle.

[0003] Due to limitations in current optical imaging systems and the nature of sequencing reagents, the above three steps can usually only be performed sequentially. To address this, attempts have been made to synchronize the polymerization reaction with the signal acquisition step in sequencing. This not only shortens the sequencing cycle time but also reduces the types of reagents in the sequencing kit, lowering sequencing costs. However, during signal acquisition, the fluorescence signal is rapidly quenched due to the lack of imaging buffer protection, and the overall sequencing quality also decreases significantly. Therefore, it is necessary to optimize the sequencing synthesis reagents to ensure overall sequencing quality while simultaneously conducting fluorescence signal acquisition and synthesis reactions. Summary of the Invention

[0004] This application aims to address at least one of the technical problems existing in the prior art. To this end, this application proposes an optimized second-generation gene sequencing synthesis reaction reagent. The synthesis step of sequencing using this reagent can protect nucleic acid molecules from damage or minimize damage, while suppressing fluorescence signal quenching, thereby ensuring overall sequencing quality.

[0005] According to one aspect of this application, a synthetic reaction reagent is provided, comprising a buffer, a soluble salt, a polymerase, and a nucleotide analog, wherein the buffer is selected from at least one of HEPES (4-hydroxyethylpiperazine ethanesulfonic acid) buffer, SSC (sodium citrate) buffer, Tricine (tris(hydroxymethyl)methylglycine) buffer, and PBS (phosphate buffer).

[0006] The synthetic reaction reagents according to this application have at least the following beneficial effects:

[0007] In order to find reagents that can provide good protection during the simultaneous signal acquisition and synthesis reaction, the reaction buffer system was adjusted. When using buffer systems such as HEPES, SSC, Tricine, and phosphate, the protective effect on nucleic acid molecules and the quenching inhibition of fluorescence generated by the reaction are better than the existing Tris buffer system.

[0008] In some embodiments of this application, the buffer is either HEPES buffer or SSC buffer. These two buffer systems offer the best protection for nucleic acid molecules and the best inhibition of fluorescence quenching, resulting in higher sequencing quality under the same conditions.

[0009] In some embodiments of this application, the concentration of the buffer in the buffer solution is 0.1 mM to 1000 mM, specifically, it can be 0.1 mM, 0.2 mM, 0.5 mM, 1 mM, 2 mM, 5 mM, 10 mM, 20 mM, 30 mM, 40 mM, 50 mM, 60 mM, 70 mM, 80 mM, 90 mM, 100 mM, 200 mM, 300 mM, 400 mM, 500 mM, 600 mM, 700 mM, 800 mM, 900 mM, or 1000 mM. Further, the concentration of the buffer solution is 1–500 mM, 2–300 mM, 10–200 mM, or 20–100 mM. Here, the buffer refers to the component in the buffer solution that performs a buffering function; for example, the buffer in HEPES buffer solution is 4-hydroxyethylpiperazine ethanesulfonic acid.

[0010] In some embodiments of this application, the synthetic reaction reagent also includes an antioxidant. When the fluorescence of a fluorescent group is excited by means such as laser, the laser energy may cause significant photodamage and photobleaching to nucleic acid molecules. To eliminate the strong oxidizing effect of singlet oxygen generated under laser and to protect nucleic acid molecules, an antioxidant is introduced into the synthetic reaction reagent.

[0011] In some embodiments of this application, the antioxidant is selected from at least one of ascorbic acid, sulfite, polyphenols, Trolox (water-soluble vitamin E), glycine, reduced glutathione (GSH), or salts thereof. Among these, salt-type antioxidants include, but are not limited to, ascorbic acid salts, sulfites, bisulfites, and polyphenolic acid salts.

[0012] In some embodiments of this application, the polyphenol is gallic acid or an ester.

[0013] In some embodiments of this application, the antioxidant is selected from at least one of ascorbate, gallic acid or its derivatives (such as C1-C18 alkyl esters and alkenyl esters of gallic acid, for example, methyl gallate, ethyl gallate, propyl gallate, butyl gallate, pentyl gallate... hexadecyl gallate, heptadecanyl gallate, octadecyl gallate, 9-octadecenyl gallate, 6,9,12-octadectrienyl gallate, catechin gallate, epicatechin gallate, gallocatechin gallate, gallocatechinol gallate), bisulfite, Trolox, glycine, and reduced glutathione.

[0014] In some embodiments of this application, the final concentration of the antioxidant is 0.1 mM to 100 mM, specifically, it can be 0.1 mM, 0.2 mM, 0.5 mM, 1 mM, 2 mM, 5 mM, 10 mM, 20 mM, 30 mM, 40 mM, 50 mM, 60 mM, 70 mM, 80 mM, 90 mM, or 100 mM. Further, the final concentration of the antioxidant is 0.2 mM to 80 mM, 0.5 mM to 50 mM, or 1 to 20 mM.

[0015] In some embodiments of this application, the synthetic reaction reagents also include a polymerase protectant. To protect the polymerase and prevent interference with the synthetic reaction, a certain amount of polymerase protectant is introduced into the synthetic reaction reagents.

[0016] In some embodiments of this application, the polymerase protectant is selected from at least one of bovine serum albumin, trehalose, glycerol, polyethylene glycol, gelatin, and glucose.

[0017] In some embodiments of this application, the polymerase protectant is selected from at least one of bovine serum albumin, trehalose, and glycerol.

[0018] In some embodiments of this application, the final concentration of the polymerase protectant is 0.01 mM to 100 mM, specifically, it can be 0.01 mM, 0.02 mM, 0.05 mM, 0.1 mM, 0.2 mM, 0.5 mM, 1 mM, 2 mM, 5 mM, 10 mM, 20 mM, 30 mM, 40 mM, 50 mM, 60 mM, 70 mM, 80 mM, 90 mM, or 100 mM. Further, the final concentration of the polymerase protectant is 0.01 to 50 mM.

[0019] In some embodiments of this application, the synthetic reaction reagents also include at least one of gallic acid, glycerol, ascorbate, and bovine serum albumin.

[0020] In some embodiments of this application, the synthetic reaction reagents also include gallic acid and glycerol.

[0021] In some embodiments of this application, the synthetic reaction reagents also include at least one of gallic acid and gallic acid derivatives, with a total final concentration of 1-20 mM; and 1-20% volume fraction of glycerol.

[0022] In some embodiments of this application, the synthetic reaction reagents also include at least one of gallic acid and gallic acid derivatives, with a total final concentration of 1-10 mM; and 1-10% volume fraction of glycerol.

[0023] In some embodiments of this application, the synthetic reaction reagents also include at least one of gallic acid and gallic acid derivatives, as well as ascorbate.

[0024] In some embodiments of this application, the synthetic reaction reagents also include at least one of gallic acid and gallic acid derivatives, with a total final concentration of 1 to 20 mM; and 1 to 20 mM of ascorbate.

[0025] In some embodiments of this application, the synthetic reaction reagents also include at least one of gallic acid and gallic acid derivatives, with a total final concentration of 1 to 10 mM; and 1 to 10 mM of ascorbate.

[0026] In some embodiments of this application, the synthetic reaction reagents also include bovine serum albumin and gallic acid.

[0027] In some embodiments of this application, the synthetic reaction reagents further include 0.01 to 50 mM bovine serum albumin; at least one of gallic acid and gallic acid derivatives, with a total final concentration of 1 to 20 mM.

[0028] In some embodiments of this application, the synthetic reaction reagents further include 0.01 to 10 mM bovine serum albumin; at least one of gallic acid and gallic acid derivatives, with a total final concentration of 1 to 10 mM.

[0029] In some embodiments of this application, the synthetic reaction reagents also include at least one of bovine serum albumin, gallic acid and gallic acid derivatives, and ascorbate.

[0030] In some embodiments of this application, the synthetic reaction reagents further include bovine serum albumin with a final concentration of 0.01 mM to 50 mM; at least one of gallic acid and gallic acid derivatives, with a total final concentration of 1 to 20 mM; and ascorbate with a final concentration of 1 mM to 20 mM.

[0031] In some embodiments of this application, the synthetic reaction reagents further include bovine serum albumin with a final concentration of 0.01 mM to 10 mM; at least one of gallic acid and gallic acid derivatives, with a total final concentration of 1 to 20 mM; and ascorbate with a final concentration of 1 mM to 10 mM.

[0032] In some embodiments of this application, the ascorbate is sodium ascorbate.

[0033] In some embodiments of this application, the final concentration of the soluble salt is 1 mM to 200 mM.

[0034] In some embodiments of this application, the soluble salt includes at least one of ammonium salt, magnesium salt, and sodium salt.

[0035] In some embodiments of this application, the soluble salts include ammonium salts, magnesium salts, and sodium salts.

[0036] In some embodiments of this application, the ammonium salt is selected from at least one of ammonium sulfate and ammonium chloride.

[0037] In some embodiments of this application, the final concentration of the ammonium salt is 1 mM to 50 mM, specifically, it can be 1 mM, 2 mM, 5 mM, 10 mM, 20 mM, 30 mM, 40 mM, or 50 mM. Further, the final concentration of the ammonium salt is below 40 mM, below 30 mM, or below 20 mM. Further, the final concentration of the ammonium salt is 5 mM to 20 mM. Further, the ammonium salt is 5 mM to 20 mM ammonium sulfate.

[0038] In some embodiments of this application, the magnesium salt is selected from at least one of magnesium sulfate and magnesium chloride.

[0039] In some embodiments of this application, the final concentration of the magnesium salt is 1 mM to 20 mM, specifically, it can be 1 mM, 2 mM, 5 mM, 10 mM, 15 mM, or 20 mM. Further, the final concentration of the magnesium salt is less than 10 mM and less than 5 mM. Further, the ammonium salt is 1 mM to 5 mM magnesium sulfate.

[0040] In some embodiments of this application, the sodium salt is sodium chloride.

[0041] In some embodiments of this application, the final concentration of sodium chloride is 1 mM to 100 mM, specifically, it can be 1 mM, 2 mM, 5 mM, 10 mM, 20 mM, 30 mM, 40 mM, 50 mM, 60 mM, 70 mM, 80 mM, 90 mM, or 100 mM. Further, the final concentration of sodium chloride is 10 mM to 90 mM, 20 mM to 80 mM, 30 mM to 70 mM, or 40 mM to 60 mM.

[0042] In some embodiments of this application, the nucleotide analogue is a deoxynucleotide analogue.

[0043] In some embodiments of this application, the deoxynucleotide analogues include analogues of at least one of deoxyribonucleic acid adenine (dATP), deoxyribonucleic acid guanine (dGTP), deoxyribonucleic acid thymine (dTTP), and deoxyribonucleic acid cytosine (dCTP).

[0044] In some embodiments of this application, the nucleotide analog is a nucleotide modified with a fluorescent group and / or a blocking group. Fluorescent groups include, but are not limited to, FAM, HEX, TAMRA, Cy3, Cy3.5, Cy5, Cy5.5, Cy7, Texas, ROX, JOE, R6G, EDANS, IFluor, Alexa Fluor, FITC, etc. Blocking groups include, but are not limited to, azide, amino, allyl, phosphate, 3′-O-(2-cyanoethyl), etc.

[0045] In some embodiments of this application, the polymerase is a DNA polymerase. Preferably, the polymerase has a strong catalytic ability for nucleotide analogs, such as polymerase 9N.

[0046] A second aspect of this application provides a sequencing method comprising the following steps:

[0047] Synthesis: Nucleotide analogs are ligated to primers that hybridize to the nucleic acid molecules to be tested in a buffer solution. The nucleotide analogs are modified with fluorescent and blocking groups before or after ligation. The buffer solution is selected from at least one of HEPES buffer, SSC buffer, Tricine buffer, and phosphate buffer.

[0048] Collection: Excite fluorescent groups to generate fluorescent signals, and identify the fluorescent signals to determine the base type;

[0049] Excision: Excision of the blocking group and the fluorescent group;

[0050] Repeated synthesis-collection-removal cycle.

[0051] In this context, nucleotide analogs modified with fluorescent and blocking groups refer to the direct and simultaneous modification of a fluorescent and blocking group at at least one position of the base, ribose, or other components of the nucleotide analog, or the indirect modification through the binding of other molecules modified with fluorescent and / or blocking groups to the nucleotide analog. The fluorescent and blocking groups can be independently modified onto the nucleotide analog before or after it is attached to a primer.

[0052] In some embodiments of this application, signal acquisition begins immediately after synthesis. Using the aforementioned buffer system allows signal acquisition and synthesis reactions to occur almost simultaneously. Signal acquisition can be initiated once a nucleotide analog has been attached to the primer strand of some nucleic acid molecules, without requiring the synthesis of at least one nucleotide analog in all nucleic acid molecules before signal acquisition, thus significantly shortening sequencing time. Furthermore, there is no need to add signal acquisition reagents separately during the acquisition step.

[0053] In some embodiments of this application, the nucleic acid molecules to be tested and the primers are immobilized on a solid-phase carrier.

[0054] In some embodiments of this application, the solid-phase support includes a flow tank. For reaction devices including flow tanks, since tens of thousands of amplification clusters formed by nucleic acid molecules to be tested are immobilized thereon, and the reaction solution, including the binding reaction reagent, needs a certain passage time in it, the synthesis reaction and signal acquisition are carried out simultaneously in the above-mentioned reaction process. During the synthesis reaction, signal acquisition is immediately started for the amplification clusters for which the nucleotide analogue has been introduced.

[0055] In some embodiments of this application, data acquisition begins immediately after the synthesis begins (0-60 seconds). For example, signal acquisition may begin immediately after the synthesis step at 1 second, 2 seconds, 3 seconds, 5 seconds, 10 seconds, 15 seconds, 20 seconds, 25 seconds, 30 seconds, 35 seconds, 40 seconds, 45 seconds, 50 seconds, 55 seconds, or 60 seconds.

[0056] In some embodiments of this application, the reaction temperature for collection is 35–70°C. Specifically, it can be 35°C, 40°C, 45°C, 50°C, 55°C, 60°C, 65°C, or 70°C. Further, the reaction temperature for collection is 40–60°C or 45–55°C.

[0057] In some embodiments of this application, the nucleotide analogue includes a first nucleotide analogue and a second nucleotide analogue. The first nucleotide analogue is modified with both a blocking group and a fluorescent group, while the second nucleotide analogue is modified only with a blocking group. Synthesis and collection include:

[0058] Synthesis: The first nucleotide analog is ligated to the primer that hybridizes to the nucleic acid molecule to be tested in a buffer solution, and the hybridization is blocked;

[0059] Collection: Excite the fluorescent group to generate a fluorescent signal, identify the base type by recognizing the fluorescent signal, and simultaneously link the second nucleotide analog to the primer that is not linked to the first nucleotide analog and block it.

[0060] It is understandable that sequencing processes that achieve reversible ligation of at least one nucleotide and fluorescence detection by modifying at least one of the blocking group and fluorescent group onto a nucleotide analog in other ways can also be completed using the above-described synthesis-collection-excision cycle.

[0061] In some embodiments of this application, the buffer solution also includes at least one of an antioxidant and a polymerase protectant.

[0062] In some embodiments of this application, the antioxidant is selected from at least one of ascorbic acid, sulfurous acid, polyphenols, Trolox, glycine, reduced glutathione, or salts thereof.

[0063] In some embodiments of this application, the polyphenol is gallic acid or an ester.

[0064] In some embodiments of this application, the antioxidant is selected from at least one of ascorbate, gallic acid or ester, bisulfite, Trolox, glycine, and reduced glutathione.

[0065] In some embodiments of this application, the polymerase protectant is selected from at least one of bovine serum albumin, trehalose, and glycerol.

[0066] In some embodiments of this application, the buffer solution also includes at least one of gallic acid, glycerol, ascorbate, and bovine serum albumin.

[0067] In some embodiments of this application, the buffer solution also includes gallic acid and glycerol.

[0068] In some embodiments of this application, the buffer solution also includes gallic acid and ascorbate.

[0069] In some embodiments of this application, the buffer solution also includes bovine serum albumin and gallic acid.

[0070] In some embodiments of this application, the buffer solution also includes bovine serum albumin, gallic acid, and ascorbate.

[0071] In some embodiments of this application, the buffer solution also includes soluble salts.

[0072] In some embodiments of this application, the soluble salt includes at least one of ammonium salt, magnesium salt, and sodium salt.

[0073] In some embodiments of this application, the ammonium salt is selected from at least one of ammonium sulfate and ammonium chloride.

[0074] In some embodiments of this application, the magnesium salt is selected from at least one of magnesium sulfate and magnesium chloride.

[0075] In some embodiments of this application, the sodium salt is sodium chloride. Attached Figure Description

[0076] Figure 1 This document describes the changes in signal intensity and sequencing quality Q30 at different cycle numbers when using a Tris-HCl and HEPES buffer system in one embodiment of this application.

[0077] Figure 2 This is an embodiment of the present application showing the changes in sequencing quality Q30 and phasing value at different signal acquisition temperatures.

[0078] Figure 3 This is an example of the changes in signal intensity and sequencing quality Q30 of a control group using gallic acid, sodium L-ascorbate, and BSA as synthetic reaction reagents or without any additives at different cycle numbers. Detailed Implementation

[0079] The following will clearly and completely describe the concept and technical effects of this application in conjunction with embodiments, so as to fully understand the purpose, features and effects of this application. Obviously, the described embodiments are only some embodiments of this application, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of this application without creative effort are all within the scope of protection of this application.

[0080] The embodiments of this application are described in detail below. The described embodiments are exemplary and are only used to explain this application, and should not be construed as limiting this application.

[0081] In the description of this application, "several" means one or more, "multiple" means two or more, "greater than," "less than," and "exceeding" are understood to exclude the stated number, while "above," "below," and "within" are understood to include the stated number. The use of "first" and "second" in the description is merely for distinguishing technical features and should not be construed as indicating or implying relative importance, or implicitly indicating the number of indicated technical features, or implicitly indicating the order of the indicated technical features.

[0082] Unless otherwise defined, all technical and scientific terms used in this application have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used herein is for the purpose of describing embodiments of this application only and is not intended to limit this application.

[0083] In the description of this application, the terms "one embodiment," "some embodiments," "illustrative embodiment," "example," "specific example," or "some examples," etc., refer to specific features, structures, materials, or characteristics described in connection with that embodiment or example, which are included in at least one embodiment or example of this application. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples.

[0084] Example 1: Optimization of the Synthesis Reagent Buffer System

[0085] This embodiment provides a method for sequencing the human genome, including the following steps:

[0086] 1. Sequencing library construction

[0087] (1) Nucleic acid extraction: The genomic DNA of the sample was extracted and purified using a rapid DNA extraction kit (TIANGEN, KG203). For specific operation instructions, please refer to the kit.

[0088] (2) Library construction: The library was constructed using the Novizan VAHTS Universal Plus DNA Library Prep Kit for Illumina (catalog number: ND617-02). For specific instructions, please refer to its operation manual.

[0089] (3) Library quality control: Concentration detection and fragment length quality control are performed on the enriched library.

[0090] After the above operations, a library sample of approximately 50 nM in length and approximately 1–1000 bp was obtained.

[0091] 2. Preparation of sequencing chips for use

[0092] Library denaturation, library loading, and chip surface amplification were performed using the Illumina MiSeq sequencer and its accompanying sequencing kit (MiSeq Reagent Kitv3) to obtain DNA amplification clusters. Sequencing primers ACACTCTTTCCCTACACGACGCTCTTCCGATC (SEQ ID No. 1) were then added. After hybridization, the DNA amplification clusters hybridized with sequencing primers were immobilized in the flow cell of the sequencing chip, awaiting the next sequencing reaction.

[0093] 3. Sequencing

[0094] (1) Sequencing reagent preparation

[0095] Synthetic reaction reagent 1: 50mM Tris-HCl, 50mM NaCl, 10mM (NH4)2SO4, 0.02mg / ml polymerase 9N (Salus-bio), 3mM MgSO4, 1mM EDTA, and 1μM each of dATP, dCTP, dGTP and dTTP (first nucleotide analogs) with blocking and fluorescent groups; wherein, 50mM Tris-HCl can be replaced with 3×SSC, 50mM HEPES, 50mM MTTricine, 50mM PBS, 50mM TAPS, or 50mM MOPS.

[0096] Synthesis Reagent 2: 50mM Tris-HCl (which can be replaced with 3×SSC, 50mM MEPES, 50mM Tricine, 50mM PBS, 50mM TAPS, or 50mM MOPS along with Synthesis Reagent 1), 50mM NaCl, 10mM (NH4)2SO4, 0.02mg / ml polymerase 9N (Salus-bio), 3mM MgSO4, 1mM EDTA, and 1μM each of dATP, dCTP, dGTP, and dTTP (second nucleotide analogues) with only blocking groups;

[0097] Elution buffer: 5×SSC, Tween 20 0.05%;

[0098] Prewash buffer: 50 mM Tris-HCl, 0.5 mM NaCl, 10 mM EDTA, Tween 20 0.05%;

[0099] Removal reaction solution: 20mM THPP, 0.5M NaCl, 50mM Tris-HCl, pH 9.0, Tween20 0.05%.

[0100] Among them, the blocking group is an azide group. The fluorescent groups of dATP, dCTP, dGTP and dTTP, which contain both blocking and fluorescent groups, are Cy5, ROX, AF-532 and IF-700, respectively. Taking dCTP as an example, the two are shown below:

[0101]

[0102] (2) Sequencing reaction cycle

[0103] a) Synthesis reaction: In the amplified chip, a syringe pump injected 200 μl of pre-wash buffer into the flow cell of the sequencing chip at a rate of 800 μl / min. Then, a syringe pump injected 200 μl of synthesis reaction reagent 1 into the flow cell of the sequencing chip at a rate of 800 μl / min. The temperature was set to 55℃, and the reaction was allowed to proceed for 10 s. Afterward, a syringe pump injected 200 μl of synthesis reaction reagent 2 containing different buffer systems at a rate of 800 μl / min. The buffer systems for synthesis reaction reagents 1 and 2 pumped into the four flow cells of chip 1 were Tris-HCl buffer, 3×SSC buffer, HEPES buffer, and Tricine buffer, respectively. The buffer systems for synthesis reaction reagents 1 and 2 pumped into the four flow cells of chip 2 were Tris-HCl buffer, PBS buffer, TAPS buffer, and MOPS buffer, respectively. The temperature was set to 50℃.

[0104] b) Signal acquisition: While the synthetic reaction reagent 2 is being pumped into the flow cell of the sequencing chip by the injection pump, the laser irradiation is started through the signal acquisition system to collect the fluorescence signal of the entire sequencing chip, analyze the base signal bound at each position, and determine the base at that position.

[0105] c) Excision reaction: After signal acquisition, 200 μl of elution buffer was pumped in at a rate of 800 μl / min, followed by 200 μl of excision reaction solution at a rate of 800 μl / min. The temperature was set to 60℃ and the reaction was carried out for 1 min. Then, 200 μl of elution buffer was added and the washing was repeated once.

[0106] Repeat steps a) through c) to proceed to the next sequencing cycle. Perform a total of 100 sequencing cycles.

[0107] Sequencing results

[0108] The percentage decrease in sequencing signal intensity (compared by the intensity of base A signal in different cycles) and sequencing quality Q30 after SE100 sequencing with different buffer systems are shown in Table 1:

[0109] Table 1. SE100 sequencing signal attenuation percentage and Q30

[0110]

[0111]

[0112] The results in the table show that under HEPES, 3×SSC, and Tricine and PBS buffer conditions, the signal reduction rate was only below 70%, with the lowest being only 60%, indicating that these buffer systems have a good inhibitory effect on fluorescence signal quenching. Furthermore, their Q30 values ​​remained above 80%, indicating that these buffer systems have a good protective effect on DNA. Among these, HEPES or 3×SSC buffer systems are preferred.

[0113] The curves showing the changes in SE100 and Q30 for the synthesis reagents using HEPES and Tris-HCl are as follows: Figure 1 As shown in the figure, the synthetic reaction reagents in the HEPES buffer system can produce better sequencing results.

[0114] Example 2: Signal Acquisition Temperature Optimization

[0115] Sequencing library construction

[0116] Library construction and quality control were performed according to Example 1 to obtain a library sample of approximately 50 nM with a length of approximately 1–1000 bp. Library denaturation, loading, chip surface amplification, and hybridization were then performed using an Illumina MiSeq sequencer and its accompanying sequencing kit (MiSeq Reagent Kit v3). DNA amplification clusters hybridized with sequencing primers were immobilized in the flow cell of the sequencing chip, awaiting the sequencing reaction.

[0117] sequencing

[0118] (1) Sequencing reagent preparation

[0119] Synthetic reaction reagent 1: 50mM HEPES, 50mM NaCl, 10mM (NH4)2SO4, 0.02mg / ml polymerase 9N (Salus-bio), 3mM MgSO4, 1mM EDTA, and 1μM each of dATP, dCTP, dGTP and dTTP with blocking and fluorescent groups.

[0120] Synthetic reaction reagent 2: 50mM HEPES, 50mM NaCl, 10mM (NH4)2SO4, 0.02mg / ml polymerase 9N (Salus-bio), 3mM MgSO4, 1mM EDTA, and 1μM each of dATP, dCTP, dGTP and dTTP with only blocking groups;

[0121] Elution buffer: 5×SSC, Tween 20 0.05%;

[0122] Prewash buffer: 50 mM Tris-HCl, 0.5 mM NaCl, 10 mM EDTA, Tween 20 0.05%;

[0123] Removal reaction solution: 20mM THPP, 0.5M NaCl, 50mM Tris-HCl, pH 9.0, Tween20 0.05%.

[0124] (2) Sequencing reaction cycle

[0125] a) Synthesis reaction: In the amplified chip, a syringe pump was used to pump 200 μl of pre-wash buffer into the flow cell of the sequencing chip at a rate of 800 μl / min. Then, a syringe pump was used to pump 200 μl of synthesis reaction reagent 1 into the flow cell of the sequencing chip at a rate of 800 μl / min. The temperature was set to 55℃ and the reaction was allowed to proceed for 10 s. After that, a syringe pump was used to pump 200 μl of synthesis reaction reagent 2 at a rate of 800 μl / min. The experimental temperatures on the surface of different batches of chips were set to 25℃, 35℃, 40℃, 45℃, 50℃, 55℃, 60℃ and 65℃, respectively.

[0126] b) Signal Acquisition: Simultaneously with the injection of synthetic reagent 2 into the flow cell of the sequencing chip, laser irradiation is initiated via signal acquisition elution. Fluorescence signals from the entire sequencing chip are simultaneously acquired, and the base signal bound at each location is analyzed to determine the base at that location. After 2 minutes of reaction with synthetic reagent 2, 200 μl of elution buffer is injected at a rate of 300 μl / min. The signal acquisition process ends (or is about to end) precisely when the injection pump completes its extraction.

[0127] c) Excision reaction: After signal acquisition, the syringe pump immediately pumped 200 μl of excision reaction solution at a rate of 1000 μl / min, and the temperature was kept at 55℃ for 1 min. Then, the syringe pump pumped 200 μl of elution buffer at a rate of 1200 μl / min.

[0128] Repeat steps a) through c) to perform the next sequencing cycle. Perform a total of 100 sequencing cycles.

[0129] Sequencing results

[0130] Sequencing results as follows Figure 2As shown in the figure, signal acquisition of the chip varies significantly at different temperatures. Signal acquisition can be completed at temperatures ranging from 35 to 70°C, with the optimal temperature range being 45–60°C, and 50°C being the most optimized. At 50°C, the sequencing quality Q30 is approximately 88%, and the phasing value, an indicator of the adequacy of the synthesis reaction, is also the lowest, at approximately 20%.

[0131] Example 3: Optimization of other components in the synthesis reaction reagents

[0132] Sequencing library construction

[0133] Library construction and quality control were performed according to Example 1 to obtain a library sample of approximately 50 nM with a length of approximately 1–1000 bp. Library denaturation, loading, chip surface amplification, and hybridization were then performed using an Illumina MiSeq sequencer and its accompanying sequencing kit (MiSeq Reagent Kit v3). DNA amplification clusters hybridized with sequencing primers were immobilized in the flow cell of the sequencing chip, awaiting the sequencing reaction.

[0134] sequencing

[0135] (1) Sequencing reagent preparation

[0136] The sequencing reagents used for sequencing differ from those in Example 2 only in that other additives were added to the synthetic reaction reagents 1 and 2.

[0137] Sequencing reaction cycle

[0138] a) Synthesis reaction: In the amplified chip, a syringe pump injects 200 μl of pre-wash buffer into the flow cell of the sequencing chip at a rate of 800 μl / min. Then, a syringe pump injects 200 μl of synthesis reaction reagent 1 into the flow cell of the sequencing chip at a rate of 800 μl / min. The temperature is set to 55 °C, and the reaction is allowed to proceed for 10 s. Afterward, a syringe pump injects 200 μl of synthesis reaction reagent 2 containing the added component at a rate of 800 μl / min. One of the four flow cells of the chip contains synthesis reaction reagents 1 and 2 without the added component for use as a control. These are synthesis reaction reagents with different added components, respectively, and the temperature is set to 50 °C.

[0139] b) Signal acquisition: While the synthetic reaction reagent 2 is being pumped into the flow cell of the sequencing chip by the injection pump, the laser irradiation is initiated by signal acquisition elution to acquire the fluorescence signal of the entire sequencing chip, analyze the base signal bound at each position, and determine the base at that position.

[0140] c) Excision reaction: After signal acquisition, 200 μl of elution buffer was pumped in at a rate of 800 μl / min, followed by 200 μl of excision reaction solution at a rate of 800 μl / min. The temperature was set to 60℃ and the reaction was carried out for 1 min. Then, 200 μl of elution buffer was added and the washing was repeated once.

[0141] Repeat steps a) through c) to proceed to the next sequencing cycle. Perform a total of 100 sequencing cycles.

[0142] Sequencing results

[0143] To address the singlet oxygen generated by laser irradiation and the resulting photodamage and photobleaching of DNA, we explored the use of components such as sodium L-ascorbate, sodium azide, sodium bisulfite, ethyl gallate, gallic acid, pyrogallol, hydroquinone, Trolox, and L-reduced glutathione (GSH) as additives in the synthesis reaction reagents 1 and 2. In addition, to protect the polymerase, we also explored the use of bovine serum albumin (BSA), trehalose, glycerol, polyethylene glycol (PEG), gelatin, and glucose.

[0144] Among the aforementioned additives, those exhibiting good antioxidant effects include sodium L-ascorbate, gallic acid, sodium bisulfite, Trolox, and L-reduced glutathione (GSH). Components providing good protection for polymerases include BSA, trehalose, and glycerol. The final concentrations of these additives or their combinations in reagents 1 and 2 of the synthesis reaction, as well as the signal degradation rate and Q30 value after SE100 sequencing, are shown in Table 2.

[0145] Table 2. Reagents for synthesis with different added components

[0146]

[0147]

[0148] Comparing the above results, it can be seen that the antioxidants L-ascorbic acid sodium, gallic acid, sodium bisulfite, Trolox, GSH, BSA, glycerol, and trehalose are superior to the combination without any added ingredients in at least one aspect of signal reduction ratio and Q30. More preferred combinations are gallic acid and BSA, gallic acid and glycerol, L-ascorbic acid sodium and gallic acid, L-ascorbic acid sodium, gallic acid sodium and BSA, and gallic acid esters and L-ascorbic acid sodium. The most preferred combination is gallic acid, L-ascorbic acid sodium, and BSA, as shown in the sequencing results of this combination. Figure 3As shown in the figure, the sequencing SE100 results obtained with synthetic reagent 1 containing gallic acid, L-ascorbic acid sodium, and BSA showed significantly higher levels of both base A signal intensity and Q30 value during cycling compared to the control group without any added components.

[0149] As can be seen from the above embodiments, when using the sequencing synthesis reaction reagents provided in this application, fluorescence signal acquisition can be performed synchronously with the synthesis reaction at a relatively high temperature (e.g., 35–70°C) during sequencing, shortening the sequencing time while ensuring that the overall sequencing quality remains at a high level. Furthermore, when using the above method for sequencing, since no additional separately prepared signal acquisition reagents are required, signal acquisition is performed directly within the existing synthesis reaction temperature and reaction buffer system, reducing the types of reagents in the sequencing kit and lowering sequencing costs.

[0150] The embodiments of the present invention have been described in detail above. However, the present invention is not limited to the above embodiments. Within the scope of knowledge possessed by those skilled in the art, various changes can be made without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof can be combined with each other unless otherwise specified.

Claims

1. A synthetic reaction reagent, characterized in that, The buffer comprises 1-100 mM sodium chloride, 5-20 mM ammonium sulfate, 1-5 mM magnesium sulfate, polymerase, nucleotide analog, 0.01-50 mM bovine serum albumin, 1-20 mM gallic acid, and 1-20 mM L-ascorbic acid sodium, wherein the buffer is HEPES buffer, SSC buffer, or PBS buffer. The nucleotide analogue is a deoxynucleotide analogue, and the deoxynucleotide analogue is at least one of dATP, dCTP, dGTP and dTTP; The concentration of the buffer in the buffer solution is 20~100mM; The nucleotide analogues include a first nucleotide analogue and a second nucleotide analogue, wherein the first nucleotide analogue is modified with a blocking group and a fluorescent group, and the second nucleotide analogue is modified with only a blocking group.

2. The synthetic reaction reagent according to claim 1, characterized in that, The concentrations of bovine serum albumin, gallic acid, and sodium L-ascorbate in the synthetic reaction reagents are 0.01–10 mM, 1–20 mM, and 1–10 mM, respectively.

3. The synthetic reaction reagent according to claim 1, characterized in that, The concentrations of bovine serum albumin, gallic acid, and sodium L-ascorbate in the synthetic reaction reagents are 0.01–10 mM, 1–10 mM, and 1–10 mM, respectively.

4. The synthetic reaction reagent according to claim 1, characterized in that, The concentration of sodium chloride is 40~60 mM.

5. The synthetic reaction reagent according to claim 1, characterized in that, The polymerase is a DNA polymerase.

6. The synthetic reaction reagent according to claim 1, characterized in that, The polymerase is polymerase 9N.

7. A sequencing method, characterized in that, Includes the following steps: Synthesis: In a buffer solution, a polymerase is used to ligate the first nucleotide analog to the primer hybridizing to the nucleic acid molecule to be tested, and the hybridization is blocked. The buffer solution is HEPES buffer, SSC buffer, or PBS buffer, and the buffer solution contains 1-100 mM sodium chloride, 5-20 mM ammonium sulfate, 1-5 mM magnesium sulfate, 0.01-50 mM bovine serum albumin, 1-20 mM gallic acid, and 1-20 mM L-ascorbic acid sodium. The concentration of the buffer in the buffer solution is 20-100 mM. Collection: Excite the fluorescent group to generate a fluorescent signal, identify the fluorescent signal to obtain the base type, and at the same time, link the second nucleotide analog to the primer that is not linked to the first nucleotide analog and block it; Removal: Removal of the blocking group and the fluorescent group; Repeat the cycle of synthesis-acquisition-removal; The first nucleotide analog is modified with both a blocking group and a fluorescent group, while the second nucleotide analog is modified with only a blocking group. Both the first and second nucleotide analogs are deoxynucleotide analogs, and the deoxynucleotide analogs are at least one of dATP, dCTP, dGTP, and dTTP.

8. The sequencing method according to claim 7, characterized in that, The data acquisition begins immediately after the synthesis begins.

9. The sequencing method according to claim 7, characterized in that, The nucleic acid molecule to be tested and the primers are immobilized on a solid-phase carrier.

10. The sequencing method according to claim 9, characterized in that, The solid support includes a flow channel.

11. The sequencing method according to claim 7, characterized in that, The data acquisition begins immediately 0-60 seconds after the start of the synthesis.

12. The sequencing method according to claim 7, characterized in that, The reaction temperature for the sample collection was 35~70 ℃.

13. The sequencing method according to claim 7, characterized in that, The reaction temperature for the sample collection was 45~60 ℃.

14. The sequencing method according to claim 7, characterized in that, The concentration of bovine serum albumin in the buffer solution is 0.01~10 mM, the concentration of gallic acid is 1~20 mM, and the concentration of sodium L-ascorbate is 1~10 mM.

15. The sequencing method according to claim 7, characterized in that, The concentration of sodium chloride is 40~60 mM.

Citation Information

Patent Citations

  • Rinsing liquid for nucleic acid extraction purification

    CN105734044A

  • Enzyme reaction solution for constructing sequencing library and application of enzyme reaction solution

    CN111763664A