A method of enhancing cellulose synthesis to improve the production efficiency of human epidermal growth factor secretion
Patent Information
- Application Number
- CN202310382114.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-02-25
- Publication Date
- 2026-09-25
- Estimated Expiration
- 2042-02-25
AI Technical Summary
基于生物被膜的固定化连续发酵体系已应用于L-苏氨酸等小分子产品(中国专利号CN201910392765.7)的生产中,但是目前还没有应用于人表皮生产因子的报道,且大肠杆菌生物被膜相关基因(如bcsB、fimH、csgAB)以及其他一些生理基因(如moaE、gshB、yceA、ychJ)对hEGF分泌和生产的影响也未见报道
[0033]1、通过moaE基因、gshB基因、yceA基因、ychJ基因的弱化或者bcsB基因、csgAcsgB基因、fimH基因表达的强化,能够有效提高大肠杆菌细胞在多种发酵条件下分泌人表皮生长因的效率,并有利于细胞在多种固体表面吸附生长形成生物被膜。
Smart Images

Figure CN116355825B_ABST
Abstract
Description
[0001] This invention is a divisional application filed on February 25, 2022, for a method to improve the secretion and production efficiency of human epidermal growth factor (202210176910X). Technical Field
[0002] This invention belongs to the fields of genetic engineering and fermentation engineering, and specifically relates to a method for improving the secretion efficiency of human epidermal growth factor using Escherichia coli. Background Technology
[0003] Biosynthetic pharmaceutical proteins are attracting increasing attention due to their perceived higher safety compared to chemical synthesis. *E. coli* offers numerous advantages, such as a short growth cycle, ease of high-density culture, a well-defined genetic background, and rapid conversion of exogenous genes, making it a common candidate for recombinant protein expression. However, achieving commercial production of recombinant proteins remains a challenge, one of the most significant being the poor protein secretion capacity of *E. coli*. Issues such as inclusion body formation, protein degradation, cellular metabolic burden, and inefficient transport / transport systems during production can all contribute to low protein secretion efficiency. To improve *E. coli* protein secretion efficiency, various methods have been explored, including selecting highly efficient signal peptides (such as the signal sequences of OmpA and PelB) to guide proteins into the *E. coli* protein secretion pathway; modifying key transport proteins or accessory proteins involved in transmembrane transport; co-expression of fusion proteins and molecular chaperones; and optimizing fermentation process parameters and culture medium formulations.
[0004] Recombinant human epidermal growth factor (rhEGF) is a potential therapeutic protein widely used as a healing agent for various chronic wounds. Its extracellular expression in *E. coli* BL21(DE3) using the PelB signal peptide has been successfully achieved (Chinese Patent No. CN111471636A). Secreting hEGF into the culture medium greatly simplifies product recovery and reduces separation costs in downstream fermentation processes. However, hEGF secretion efficiency is low, and it is typically produced using traditional free fermentation methods. Under stress conditions such as shear force, the viability of cells producing hEGF decreases, preventing continuous use. Current research focuses on improving hEGF protein secretion, primarily through methods such as codon optimization (Chinese Patent No. CN1360022A), signal peptide optimization (Chinese Patent No. CN1854294A), and temperature induction (Chinese Patent No. CN102952817A) to increase yield.
[0005] To improve hEGF protein secretion efficiency, this study adopted different approaches to develop new strategies. For example, it investigated the effects of biofilm formation-related genes or other unknown genes on human epidermal growth factor (HGF) secretion efficiency from the perspective of physiological processes such as *E. coli* biofilm formation. Furthermore, it established a biofilm-based continuous fermentation process. *E. coli* biofilms consist of colonies embedded in an extracellular polymeric substance (EPS) matrix, forming a complex cell community. Cells encased in the biofilm adhere to the surface of a solid medium, continuously renewing themselves through nutrient absorption and withstanding adverse conditions. Immobilized continuous fermentation systems based on biofilms have been applied to the production of small molecule products such as L-threonine (Chinese Patent No. CN201910392765.7), but there are currently no reports of their application to human HGF. Furthermore, the effects of *E. coli* biofilm-related genes (such as bcsB, fimH, csgAB) and other physiological genes (such as moaE, gshB, yceA, ychJ) on hEGF secretion and production have not been reported. Summary of the Invention
[0006] Purpose of the invention: The technical problem to be solved by the present invention is to provide a recombinant Escherichia coli and its construction method, which addresses the shortcomings of the prior art.
[0007] Another technical problem to be solved by the present invention is to provide a method for improving the secretion and production efficiency of human epidermal growth factor.
[0008] To solve the first technical problem mentioned above, the present invention discloses a recombinant Escherichia coli, wherein the Escherichia coli is modified by any one or more of the following methods;
[0009] A. Weaken the expression of one or more of the following genes: moaE, gshB, yceA, and ychJ.
[0010] B. Enhance the expression of one or more of the following genes: bcsB, csgA, csgB, and fimH.
[0011] Specifically, the moaE gene (NCBI Gene ID: 945399) encodes a protein involved in the biosynthesis of molybdopine; the gshB gene (NCBI Gene ID: 947445) encodes a glutathione synthase; the yceA gene (NCBI Gene ID: 945601) encodes a tRNA U34 hydroxylase; and the ychJ gene (NCBI Gene ID: 945828) encodes an NTF2-like domain protein.
[0012] Among them, the bcsB gene (Gene ID: 948045) is involved in cellulose synthesis, the csgA gene (Gene ID: 949055) and the csgB gene (Gene ID: 947391) are involved in the synthesis of curly pili, and the fimH gene (Gene ID: 948847) is involved in the synthesis of type I pili.
[0013] The expression of the weakened gene is performed by gene knockout in the Escherichia coli genome; the gene knockout method is CRISPR / Cas9 editing technology (Jiang, Y, et al., Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Appl Environ Microbiol. 2015 Jan 30. 81(7), 2506-14.) or λ-red homologous recombination technology (Madyagol, M. et al., 2011. Gene replacement techniques for Escherichia coli genome modification. Folia Microbiol (Praha), 56(3), 253-63.).
[0014] The enhanced gene expression is achieved by integrating the gene into the E. coli genome, using the aforementioned CRISPR / Cas9 editing technology or homologous recombination technology; or by linking the target gene to a gene expression plasmid, such as common gene expression plasmids like pBbE1a, pET28, or pETDuet.
[0015] Among them, the recombinant E. coli strains expressing the bcsB, csgAcsgB, and fimH genes through genome integration were named BL21-bcsB*, BL21-csgAcsgB*, and BL21-fimH*; the recombinant E. coli strain expressing the bcsB, csgAcsgB, and fimH genes through plasmids was named BL21-bcsB. + ,BL21-csgAcsgB + ,BL21-fimH + .
[0016] The integration sites of BL21-bcsB*, BL21-csgAcsgB*, and BL21-fimH* can be selected from Escherichia coli gene integration sites reported in existing literature, such as yjiP_yjiR, thrW_ykfN, ykgH_betA, and ileY_ygaQ (Goormans, AR et al., 2020. Comprehensive study on Escherichia coli genomic expression: Does position really matter? Metab Eng, 62, 10-19.). Alternatively, any one of the above-mentioned moaE gene, gshB gene, yceA gene, and ychJ gene knockout sites can be selected. The integrated fragment is an expression cassette consisting of a promoter, a target gene fragment, and a terminator. Preferably, the integration site is a moaE knockout site, the promoter in the expression cassette is a trc promoter, and the genome integration method is CRISPR / Cas9 editing technology or λ-red homologous recombination technology.
[0017] The above-mentioned method for constructing recombinant Escherichia coli is also within the scope of protection of this invention.
[0018] To address the second technical problem mentioned above, this invention discloses a method for improving the production efficiency of human epidermal growth factor secretion. The method involves fermenting the aforementioned recombinant *E. coli* in a culture medium until the optical density (OD) of the bacterial cells is reached. 600 When the value reaches between 0.6 and 0.8, human epidermal growth factor is produced after induction with IPTG, thus obtaining a fermentation broth containing human epidermal growth factor. By introducing the human epidermal growth factor gene into the recombinant Escherichia coli mentioned above and fermenting it in the culture medium, human epidermal growth factor can be secreted into the liquid culture medium more effectively for production, and a highly efficient continuous fermentation system can also be established.
[0019] The culture medium contains 5-15 g / L tryptone, 1-30 g / L yeast extract, 0-12 g / L sodium chloride, 0-50 g / L glucose, 0-10 mL / L glycerol, 0-14.4 g / L dipotassium hydrogen phosphate, and 0-5 g / L potassium dihydrogen phosphate.
[0020] In the culture medium, when the sodium chloride content is not 0 g / L, the contents of glycerol, dipotassium hydrogen phosphate, and potassium dihydrogen phosphate are all 0 g / L. That is, the culture medium contains 5-15 g / L of tryptone, 1-30 g / L of yeast extract, 0.001-12 g / L of sodium chloride, and 0-50 g / L of glucose. Preferably, it contains 8-12 g / L of tryptone, 2-7 g / L of yeast extract, 8-12 g / L of sodium chloride, and 0-6 g / L of glucose. More preferably, it contains 10 g / L of tryptone, 5 g / L of yeast extract, 10 g / L of sodium chloride, and 0 or 5 g / L of glucose.
[0021] In the culture medium, when the sodium chloride content is 0 g / L, the glucose content is 0 g / L, and the contents of glycerol, dipotassium hydrogen phosphate, and potassium dihydrogen phosphate are not 0 g / L. That is, the culture medium contains 5-15 g / L of tryptone, 1-30 g / L of yeast extract, 0.001-10 mL / L of glycerol, 0.001-14.4 g / L of dipotassium hydrogen phosphate, and 0.001-5 g / L of potassium dihydrogen phosphate.
[0022] The fermentation process includes the addition of isopropyl-β-D-thiogalactoside IPTG; preferably, 0.01–1.5 mM isopropyl-β-D-thiogalactoside is added during the fermentation process; preferably, 1 mM isopropyl-β-D-thiogalactoside is added during the fermentation process.
[0023] The fermentation temperature is 25–37°C; preferably, the fermentation temperature is 25°C.
[0024] Wherein, the fermentation is free fermentation or immobilized fermentation; the fermentation is single-batch fermentation, continuous fermentation or repeated batch fermentation; the fermentation is immobilized repeated batch fermentation.
[0025] The carrier for immobilized fermentation is any one or more combinations of cotton fiber, polyester fiber, activated carbon, nonwoven fabric, polylactic acid, nylon fiber, wood pulp cotton, activated carbon, polyethylene, polyvinyl alcohol, silk, polyurethane, clay, and metal. The carrier exists as the material itself, or in any form derived from its processing, such as cloth strips, resin, sponge, sponge-like materials, plastic sheets, plastic springs, and glass slides.
[0026] The amount of carrier used in the immobilized fermentation is 5-100 g / L; preferably, the amount of carrier used in the immobilized fermentation is 5-60 g / L; more preferably, the amount of carrier used in the immobilized fermentation is 10-50 g / L.
[0027] In this invention, free fermentation refers to fermentation in a culture medium in which cells exist in a free suspension state without the addition of a solid carrier.
[0028] In this invention, the immobilized fermentation refers to adding a solid carrier to the culture medium, allowing cells to adsorb and grow on the solid carrier, thus carrying out fermentation.
[0029] In this invention, single-batch fermentation refers to the process in which no nutrients are added to or removed from the fermentation broth after inoculation in the culture medium until the fermentation is completed (18-72 hours).
[0030] In this invention, continuous fermentation refers to releasing a certain amount of fermentation broth during the fermentation process while simultaneously adding fresh culture medium to the reactor, thereby achieving continuous fermentation. The release of fermentation broth can be intermittent, such as releasing 4 / 5, 2 / 3, 1 / 2, 1 / 3, or 1 / 4 of the reaction volume each time, and then replenishing with the same volume of fresh culture medium for fermentation; or it can be continuous, that is, continuously releasing a portion of fermentation broth while continuously replenishing with the same volume of fermentation broth.
[0031] In this invention, the immobilized repeated batch fermentation, as a special method of continuous fermentation, refers to adding a solid carrier to the culture medium. When one cycle of fermentation is completed, the fermentation liquid is completely released, the solid carrier is retained, and then a new fermentation culture medium is added to continue the next batch of fermentation, and so on.
[0032] Beneficial effects: Compared with the prior art, the present invention has the following advantages:
[0033] 1. By weakening the expression of moaE, gshB, yceA, and ychJ genes or enhancing the expression of bcsB, csgAcsgB, and fimH genes, the efficiency of human epidermal growth factor secretion by Escherichia coli cells under various fermentation conditions can be effectively improved, and the cells can be more likely to adsorb and grow on various solid surfaces to form biofilms.
[0034] 2. This invention provides a method for producing human epidermal growth factor by immobilized fermentation of Escherichia coli. It utilizes solid materials as immobilized carriers for the adsorption and growth of Escherichia coli. The immobilized bacteria can be reused repeatedly, increasing the bacterial density. There is no need to prepare seeds during the fermentation process, enabling long-term continuous fermentation, thereby increasing the fermentation speed, reducing downtime, increasing production intensity, and saving culture resources and fermentation costs.
[0035] 3. This invention provides a method for improving the production efficiency of human epidermal growth factor through biofilm, which improves the ability of Escherichia coli to secrete and produce human epidermal growth factor, thereby increasing the efficiency of Escherichia coli in producing human epidermal growth factor by 1 to 2 times in single-batch free fermentation and immobilized continuous fermentation, and realizing the continuous production of human epidermal growth factor. Attached Figure Description
[0036] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments, and the advantages of the present invention in the above and / or other aspects will become clearer.
[0037] Figure 1 Plasmid maps for overexpression of bcsB, csgAcsgB, and fimH.
[0038] Figure 2 To verify the results of enzyme digestion after hot transfection of plasmid pBbE1a into BL21, positive transformants were selected and plasmids were extracted. From left to right, the results are: pBbE1a-bcsB digestion, pBbE1a plasmid digestion, pBbE1a-csgAcsgB digestion, pBbE1a plasmid digestion, pBbE1a-fimH digestion, and pBbE1a plasmid digestion.
[0039] Figure 3 The images shown are, in order, nucleic acid electrophoresis images of positive transformant colonies selected from BL21 with the moaE, gshB, yceA, and ychJ genes knocked out (with the PCR results of wild-type BL21 colonies as a control).
[0040] Figure 4 The images, in order, are nucleic acid electrophoresis images of positive transformant colonies selected from BL21 cells with moaE knockout sites integrating bcsB, csgAcsgB, and fimH genes, verified by PCR (with wild-type BL21 colony PCR results as a control).
[0041] Figure 5 The figures show the relative biomass of 96-well plates stained with crystal violet. In Figure A, the control consists of the human epidermal growth factor-producing plasmid pET30a-hEGF introduced into wild-type BL21 and the empty plasmid pBbE1a; in Figure B, the control contains only one plasmid, pET30a-hEGF.
[0042] Figure 6 The results of SDS-PAGE gel electrophoresis for single-batch fermentation using LB medium and IPTG concentration of 1 mM, and the results of relative quantitative analysis of protein gel using Image Lab.
[0043] Figure 7 The results of hEGFSDS-PAGE gel electrophoresis in the continuously fermented broth immobilized using LB medium and cotton fiber as the immobilization carrier. Figure 7 In lane A, the bands are BSA, control 1, BL21-bcsB. + 1,BL21-csgAcsgB + 1,BL21-fimH +1, Control 2, BL21-bcsB + 2,BL21-csgAcsgB + 2,BL21-fimH + 2 (Control 1 and Control 2 are parallel experiments, both of which involve introducing empty plasmid pBbE1a and human epidermal growth factor plasmid into BL21(DE3); Figure 7 Lane B contains the following bands in sequence: BSA, control (with a human epidermal growth factor plasmid introduced into B21(DE3)), BL21ΔmoaE, BL21ΔgshB, BL21ΔyceA, BL21ΔmoaE, BL21-bcsB*, BL21-csgAcsgB*, and BL21-fimH*.
[0044] Figure 8 The results of relative quantitative analysis of hEGF using Image Lab software during immobilized continuous fermentation with cotton fiber as the immobilization medium in LB medium are shown.
[0045] Figure 9 The optical density (OD) of cells in the continuous fermentation broth immobilized using LB medium and cotton fiber as the immobilization carrier was measured. 600 . Detailed Implementation
[0046] The following embodiments will make the scope of the invention more readily understood by those skilled in the art. The descriptions in the embodiments are for illustrative purposes only and should not, and will not, limit the invention as detailed in the claims. The immobilization and expression of recombinant proteins using bacterial strains will also be included within the scope of this invention.
[0047] The embodiments of this invention provide detailed implementation methods and specific operating procedures based on the technical solutions described herein. All reagents used in the following embodiments are commercially available. Unless otherwise specified, the experimental methods described in the following embodiments are conventional methods.
[0048] The following examples illustrate the method of the present invention in detail through genetic modification and continuous fermentation with surface immobilization, using human epidermal growth factor as the target product.
[0049] The Escherichia coli used in the following examples is BL21(DE3).
[0050] The yeast extract used in the following examples is OXOID.
[0051] The recombinant bacteria BL21-bcsB involved in the following examples + ,BL21-csgAcsgB + ,BL21-fimH +BL21-bcsB*, BL21-csgAcsgB*, BL21-fimH*, BL2ΔmoaE, BL21ΔgshB, BL21ΔyceA and BL21ΔychJ are respectively based on Escherichia coli BL21(DE3) as the initiating bacteria.
[0052] Unless otherwise specified, the control strain *E. coli* BL21(DE3) described in the following examples refers to the following: If the control strain *E. coli* BL21(DE3) expresses the target gene via plasmid pBbE1a, it is compared to recombinant *E. coli* that expresses the target gene via plasmid pBbE1a; if the control strain *E. coli* BL21(DE3) is wild-type BL21(DE3), it is compared to recombinant *E. coli* modified using two other methods (integration expression and gene knockout), it is compared to recombinant *E. coli* that is modified using two other methods (integration expression and gene knockout), it is compared to recombinant *E. coli* that is modified using only the method pET30a-hEGF.
[0053] The plasmid for producing human epidermal growth factor is constructed using the human epidermal growth factor gene SEQ ID NO.1 and plasmid pET30a according to Chinese invention application: CN 111471636 A, and named pET30a-hEGF.
[0054] The plasmid that produces human epidermal growth factor was introduced into the successfully constructed chassis strain to obtain a kanamycin-resistant single plasmid strain (by modifying the E. coli genome) and a kanamycin + ampicillin-resistant double plasmid strain (by expressing the target gene through plasmid pBbE1a).
[0055] During the strain construction process, primers were designed using the software SnapGene, and the synthesis and sequencing of relevant primer sequences (SEQ ID NO.2-65) were provided by General Electric.
[0056] The molecular biology experiments in the examples, including plasmid construction, enzyme digestion, competent cell preparation, and transformation, were performed in accordance with "Molecular Cloning: A Laboratory Manual".
[0057] Example 1 Constructing the recombinant bacterium BL21-bcsB by overexpressing the bcsB, csgAcsgB, and fimH genes via plasmid. + ,BL21-csgAcsgB + ,BL21-fimH +
[0058] 1.1 Extract plasmid pBbE1a according to the steps of the plasmid extraction kit (Axygen AxyPrep Plasmid Miniprep Kit), and double digest the vector at the BglII and AvrII sites.
[0059] 1.2 PCR of the target fragment was performed using the *E. coli* BL21 genome as a template. Using plasmid pBbE1a as a template, the terminator portion was PCR-mediated, and the two fragments were ligated together via overlap PCR for subsequent plasmid construction. Primers for the target gene fragment were designed using SnapGene software. The nucleotide sequences are shown in SEQ ID NO. 2-11. (Of the two selected restriction sites on plasmid pBbE1a, the BglII site is after the trc promoter, while the terminator is before the AvrII site. SEQ ID NO. 4 and 5 are used as upstream and downstream primers. After PCR of the terminator with this plasmid as a template, it was overlapped with the bcsB gene and then ligated to plasmid pBbE1a via one-step cloning. SEQ ID NO. 5 can also be used as the downstream primer for the overlap PCR of three genes simultaneously; SEQ ID NO. 8 and SEQ ID NO. 11 are the upstream primers for the terminators of the csgAcsgB and fimH genes, respectively.)
[0060] PCR system (100 μL aliquoted into 5 tubes): 20 μL 5×PS Buffer, 10 μL dNTP Mix, 1 μL each of forward and reverse primers, 1 μL template, 1 μL Prime STAR enzyme, 67 μL dd H2O
[0061] PCR conditions: 95℃, 10 min; 95℃, 10 s; 55℃, 15 s; 72℃, 2 min (extension time varies depending on fragment length), 38 cycles.
[0062] 1.3 Construction of recombinant plasmids
[0063] The purified linearized vector obtained in step 1.1 was ligated to the target gene fragment obtained in step 1.2 according to the instructions of the ClonExpress II One Step Cloning Kit to obtain recombinant plasmids pBbE1a-bcsB, pBbE1a-csgAcsgB, and pBbE1a-fimH. The plasmid maps for overexpressing bcsB, csgAcsgB, and fimH are shown below. Figure 1 As shown.
[0064] 1.4 The constructed recombinant plasmid was thermally transferred into BL21 competent cells, and positive transformants were screened on LB plates containing 100 μg / mL ampicillin.
[0065] 1.5 After selecting positive transformants and culturing them in liquid culture, plasmids were extracted and digested with enzymes. Following enzyme digestion, nucleic acid electrophoresis was performed for verification. Figure 2 As shown.
[0066] Example 2 Construct recombinant E. coli BL21ΔmoaE, BL21ΔgshB, BL21ΔyceA, and BL21ΔychJ gene knockouts.
[0067] The method disclosed in the reference (Jiang, Y, et al., Multigene editing in the Escherichia coligenome via the CRISPR-Cas9 system.) was used to knock out the moaE, gshB, yceA, and ychJ genes in the Escherichia coli genome using CRISPR-Cas9 technology. The modified strains were named BL21ΔmoaE, BL21ΔgshB, BL21ΔyceA, and BL21ΔychJ, respectively.
[0068] The specific steps include:
[0069] 2.1 Obtaining the repair template
[0070] Using the Escherichia coli BL21 genome as a template, primers were designed with 500 bp upstream and downstream of the target gene for PCR. After gel recovery, the products were ligated by overlap PCR. The primer nucleotide sequences are shown in SEQ ID NO.12-27. The PCR conditions were the same as in step 1.2 of Example 1.
[0071] 2.2 Construction of pTarget-moaE plasmid, pTarget-gshB plasmid, pTarget-yceA plasmid, and pTarget-ychJ plasmid
[0072] a. Using pTargetF plasmid as a template, reverse PCR was performed using primer pairs moaE-N20, gshB-N20, yceA-N20, and ychJ-N20. The primer nucleotide sequences are shown in SEQ ID NO.28-35. A DNA fragment of approximately 2.1 kb in length was obtained.
[0073] moaE-N20: CATCCCCGGATAGTGTTCGA
[0074] gshB-N20:CGTTAAGTCAGAGAACCAGG
[0075] yceA-N20:TCGCCCAAAAACATTCAGCG
[0076] ychJ-N20:GCATCCCTCTTGTGGAGCAG
[0077] PCR system (100 μL aliquoted into 5 tubes): 50 μL 2×PS Buffer, 20 μL dNTPs, 3 μL each of forward and reverse primers, 1 μL template, 1 μL KOD enzyme, 21 μL dd H2O
[0078] PCR conditions: 95℃, 10 min; 95℃, 10 s; 55℃, 15 s; 72℃, 2 min 30 s (extension time varies depending on fragment length), 38 cycles.
[0079] b. Digest the PCR product with Dpn I enzyme according to the following system: 7 μL PCR product, 1 μL Dpn I enzyme, 10× Buffer, 1 μL ddH2O. After digesting the original template, transfer the product to Trans1 T1 competent cells, plate them on streptomycin-resistant LB plates, and incubate overnight at 37°C. The next day, pick colonies and inoculate them into test tubes for preservation.
[0080] 2.3 Obtaining recombinant Escherichia coli BL2ΔmoaE, BL21ΔgshB, BL21ΔyceA and BL21ΔychJ
[0081] a. The plasmid pCas was transformed into the host bacterium BL21(DE3) by heat shock, plated on a plate containing 50 μg / mL kanamycin resistance, and screened at 30°C.
[0082] b. Select positive clones and prepare BL21-Cas9 electrocompetent cells by referring to the literature (Jiang, Y, et al., Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system.). During the preparation process, 10 mM arabinose was added to induce RED expression.
[0083] c. Electroporate the plasmid obtained in step 2.2 and the repair template fragment obtained in step 2.1 into BL21-Cas9 competent cells. After reviving at 30°C for 2 hours, screen the cells using plates containing kanamycin sulfate (50 μg / mL) + streptomycin sulfate (40 μg / mL).
[0084] d. After incubation at 30℃ for 20 h, the clones were verified by colony PCR. The colony PCR verification results are as follows: Figure 3 As shown, the nucleotide sequence of the verification primer is SEQ ID NO.66-73.
[0085] e. Positive clones are inoculated into LB broth (kanamycin resistant), 0.5 mM IPTG is added, and the mixture is incubated at 30°C for 8-20 hours. Single colonies are then streaked onto kanamycin resistant plates to verify the elimination of plasmid pTarget. Positive bacteria with pTarget eliminated can be used for the next round of gene editing.
[0086] f. Liquid culture at 37℃, streak single colonies on antibiotic-free plates, and verify the elimination of plasmid pCas by spotting or liquid culture to obtain gene knockout recombinant E. coli (antibiotic-free). Using this E. coli as a host, human epidermal growth factor is expressed and produced.
[0087] Example 3 Construct recombinant bacteria integrating the expression of bcsB, csgAcsgB, and fimH genes (taking integration into the moaE knockout site as an example): BL21-bcsB*, BL21-csgAcsgB*, BL21-fimH*
[0088] 3.1 Building and Repairing Template Integration Fragments
[0089] a. Using the Escherichia coli genome as a template, PCR of the target gene fragment was performed. Using plasmid pBbE1a as a template, PCR of the trc promoter was performed. Using the Escherichia coli MG1655 genome as a template, PCR of the target gene fragment was performed. The PCR products were recovered and ligated by overlap PCR to form an expression cassette. The primer nucleotide sequences are shown in SEQ ID NO.36-65.
[0090] b. Using the Escherichia coli genome as a template, select the upstream and downstream homologous arms of the knockout site gene, perform PCR, and then recover the product by gel extraction.
[0091] c. Use the gel-recovered products (upper and lower homologous arms and expression cassette) as templates for overlap PCR ligation.
[0092] 3.2 Constructing mutant sgRNA plasmids: i.e., the pTarget plasmid used to knock out moaE.
[0093] 3.3 Transformation of the integrated fragment and screening of transformants: Same as in Example 2, colony PCR verification results are as follows Figure 4 As shown, the nucleotide sequence of the verification primer is SEQ ID NO.66-67.
[0094] Table 1 Primer List
[0095]
[0096]
[0097]
[0098] Example 4 96-well plate crystal violet staining method for characterizing biofilm formation
[0099] 4.1 Specific experimental steps
[0100] a. The recombinant strains constructed in Examples 1-3 and the corresponding control strain, *Escherichia coli* BL21(DE3), were cultured in LB medium (for strains expressing the target gene via plasmid, 100 μg / mL ampicillin antibiotics were added) at 37°C and 200 rpm until the logarithmic growth phase. The bacterial culture was then diluted with sterile water to OD. 600 =0.1.
[0101] b. Add 200 μL of LB liquid medium to a 96-well plate (IPTG needs to be added to the medium for induction of overexpression strains), then inoculate 20 μL of diluted bacterial solution into the medium, and incubate at 37°C to allow E. coli to form a film at the bottom of the 96-well plate.
[0102] c. Afterwards, discard the LB liquid medium, rinse 2-3 times with PBS, fix with methanol at 4°C for 15 min, discard and air dry, add 1% crystal violet for staining for 15 min; discard the crystal violet staining solution, rinse with PBS, add 200 μL of 33% glacial acetic acid and gently shake for 30 min to decolorize and dissolve the crystal violet, then use a microplate reader to measure the OD... 570 Read the data and compare the biomass of the bottom film.
[0103] d. Replace LB medium with LBG medium (with 6 g / L glucose added), repeat the above experimental procedure, and observe the differences in film formation of the strains in the glucose-added medium.
[0104] 4.2 Experimental Results: (e.g.) Figure 5 As shown, plasmid expression of the three genes bcsB, csgAcsgB, and fimH significantly promoted biofilm formation at the bottom of 96-well plates. Integrated expression of these three genes was less effective than plasmid expression, but still promoted biofilm formation to some extent. Knockout of the gshB, yceA, and ychJ genes did not show a significant promoting effect in LB medium, but the addition of glucose resulted in better biofilm formation than the control. Knockout of the moaE gene did not significantly promote biofilm formation.
[0105] Example 5 Congo red binding method for characterizing biofilm formation
[0106] 5.1 Experimental Procedure
[0107] a. Select recombinant strains constructed in Examples 1-3 and control strain Escherichia coli BL21(DE3) and culture them overnight in 5 mL LB liquid (strains expressing the target gene via plasmid need to be supplemented with 100 μg / mL ampicillin). Transfer 1% to 5 mL LB / LBG medium (LBG medium contains 6 g / L more glucose than LB medium) and culture until the logarithmic growth phase. Add 0.5 mM IPTG to induce incubation at 25°C for 20 h (gene knockout strains do not need to be induced with IPTG).
[0108] b. After diluting to the same OD value, take 2 mL of bacterial culture, centrifuge, gently resuspend twice with PBS, and centrifuge again.
[0109] c. Add 1 mL of PBS to suspend the bacterial cells, add Congo red (CR) for staining (1 g dissolved in 100 ml, add 10 μl), shake at 150 rpm, react at 25 °C for 10 min, centrifuge, observe the color of the precipitate and supernatant, and perform a full-wavelength scan of the supernatant to read the value at OD = 485 nm.
[0110] 5.2 Experimental Results: Recombinant bacteria expressing the three genes bcsB, csgAcsgB, and fimH showed significant binding with Congo red, and the binding effect was further enhanced after adding glucose to the culture medium. No significant binding with Congo red was observed after integrating and expressing bcsB, csgAcsgB, and fimH, and knocking out moaE, gshB, yceA, and ychJ; however, the binding effect was slightly better than the control after adding glucose.
[0111] Congo red binding rate = 1 - OD 485 / OD 485(PBS+CR) The Congo red binding rate of the modified strains is shown in Table 2.
[0112] Table 2
[0113]
[0114]
[0115] Example 6 SDS-PAGE gel electrophoresis was used to detect protein bands and perform relative quantification.
[0116] 6.1 Protein electrophoresis sample preparation: Take 1 mL of fermentation broth into a 1.5 mL centrifuge tube, measure OD600, centrifuge at 8000 rpm for 2 min, take 21 μL of supernatant, add 7 μL of 4*SDS Loading buffer, mix thoroughly, and incubate at 95℃ for 5 min.
[0117] 6.2 Gel preparation: Prepare 16.5% protein gel according to the Sangon Tricine-SDS-PAGE Gel Preparation kit.
[0118] 6.3 Sample loading: Mount the protein gel plate into the vertical electrophoresis tank and add electrophoresis buffer. Pipette 20 μL of sample into the sample wells and add protein marker to the corresponding wells.
[0119] Electrophoresis buffer preparation: 4×Buffer 35mL + pure water 105mL + 10% SDS 1.4mL
[0120] 4×Buffer Preparation: Tris 6g + Glycine 28.8g + Pure Water 500mL
[0121] 6.4 Electrophoresis: Turn on the power supply, adjust the voltage to 120V, and adjust the electrophoresis time according to the size of the protein sample.
[0122] 6.5 Staining and destaining: After electrophoresis, remove the protein gel, stain it for 1 hour, then remove it and add destaining solution until the background color disappears completely. Pour off the destaining solution and take pictures of the protein gel using a gel imaging system.
[0123] 6.6 Using 50 mg / L hEGF standard or 250 mg / L BSA as controls, relative quantitative analysis of the target bands on the protein gel was performed using Image Lab, followed by bacterial cell optical density OD analysis. 600 The values are converted.
[0124] Example 7 Single-batch free fermentation
[0125] 7.1 Activation: Glycerol bacteria (the recombinant strains constructed in Examples 1-3 and the control strain Escherichia coli BL21(DE3)) were inoculated into 5 mL of LB medium (with the corresponding antibiotics added; for single plasmid strains, 50 μg / L kanamycin sulfate antibiotics were added, and for double plasmid strains, 50 μg / L kanamycin sulfate antibiotics and 100 μg / L ampicillin antibiotics were added), with an inoculation volume of 10 μL. The medium was incubated in a shaker at 37°C for 12 h at a speed of 200 rpm.
[0126] 7.2 Inoculation: Dispense the culture medium into 500mL shake flasks and sterilize them. The volume of the liquid is 100mL. Then add the appropriate antibiotic. The inoculation amount is 1%. Shake the flask at 200rpm and incubate at 37℃.
[0127] 7.3 Induction: To be OD 600 =0.6-0.8, add 1mM IPTG and induce at 25℃ for 48h to obtain fermentation broth containing product hEGF.
[0128] 7.4 Product Detection: The detection method is described in Example 6. The SDS-PAGE electrophoresis results are as follows: Figure 6 As shown, after quantitative analysis using software, based on OD... 600 The multiples of the relative increase in hEGF production are calculated, as shown in Table 3.
[0129]
[0130]
[0131] Example 8 Single-batch free fermentation induced by different IPTG concentrations
[0132] 8.1 The method is the same as in Example 7, except that the effects of three different IPTG concentrations (0.2 mM, 0.5 mM, and 1 mM) on the efficiency of human epidermal growth factor production were studied during fermentation.
[0133] 8.2 Experimental Results: Quantitative analysis using software was performed based on OD... 600 The multiple of increase in relative hEGF production was calculated, as shown in Table 4.
[0134] Table 4
[0135]
[0136] Example 9 Single-batch free fermentation in different culture media
[0137] 9.1 The method is the same as in Example 7, except that the effects of three different culture medium components on the efficiency of human epidermal growth factor production were studied during fermentation.
[0138] A.LB medium: tryptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L;
[0139] B.LBG medium: tryptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L, glucose 5 g / L;
[0140] C.TB medium: tryptone 12 g / L, yeast extract 24 g / L, disodium hydrogen phosphate 9.4 g / L, potassium dihydrogen phosphate 2.2 g / L, glycerol 5 mL / L.
[0141] 9.2 Experimental Results: Quantitative analysis using software was performed based on OD... 600 The multiples of increase in hEGF production relative to the control strain in different culture media were calculated, as shown in Table 5.
[0142] Table 5
[0143]
[0144]
[0145] Example 10 Immobilized continuous fermentation
[0146] 10.1 The activation, inoculation, and induction methods are the same as in Example 7, except that an immobilization carrier (cotton fiber, 40 g / L) is added to the shake flask for continuous immobilization and fermentation.
[0147] 10.2 At the end of each batch of fermentation, all fermentation liquid was released and fresh fermentation medium was added at the same time, and this process was repeated for 8 batches.
[0148] 10.3 Samples were taken every 12 hours to determine the OD content in the fermentation broth. 600 Numerical values, results as follows Figure 9 As shown in the figure, the cell density curves for expressing the bcsB and csgAcsgB genes via plasmids differ somewhat from the control. A significant decrease in cell density was observed in the fermentation broth in the fourth and fifth batches. Furthermore, the cell density in the fermentation broth for integrated expression of the bcsB gene also decreased significantly in the second and third batches. This may indicate that the expression of the bcsB and csgAcsB genes effectively promotes the synthesis of extracellular matrix, enabling cells to better adhere to the vector.
[0149] 10.4 Product Detection: Fermentation broth from the last fermentation time of each batch was subjected to protein electrophoresis for relative quantitative analysis of product concentration. The method was the same as in Example 6, except that OD240 was not required. 600 The values were converted. The SDS-PAGE gel electrophoresis results of hEGF in the fermentation broth are as follows: Figure 7 As shown in the figure, the results of relative quantitative analysis of hEGF after software quantitative analysis are as follows: Figure 8 As shown in Table 6, the factors that increase production are as follows.
[0150] Table 6
[0151]
[0152] Example 11 Immobilization and continuous fermentation were carried out using different materials as immobilization carriers.
[0153] The method is the same as in Example 10, except that the effect of using five different carriers on the efficiency of human epidermal growth factor production in immobilized continuous fermentation is studied.
[0154] The five immobilization carriers were cotton fiber, nonwoven fabric, activated carbon, polyester fiber, and nylon fiber.
[0155] The multiples of increase in relative hEGF production after quantitative analysis using software are shown in Table 7.
[0156] Table 7
[0157]
[0158]
[0159] Example 12 Immobilized continuous fermentation using different amounts of cotton fiber
[0160] The method is the same as in Example 10, except that the effect of five different amounts of cotton fiber used on the efficiency of human epidermal growth factor production during immobilized continuous fermentation was studied, namely 10 g / L, 20 g / L, 30 g / L, 40 g / L, and 50 g / L.
[0161] The multiples of increase in relative hEGF production after quantitative analysis using software are shown in Table 8.
[0162] Table 8
[0163]
[0164] This invention provides a method for improving the secretion and production efficiency of human epidermal growth factor. Many methods and approaches exist for implementing this technical solution; the above description is merely a preferred embodiment of the invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of this invention, and these improvements and modifications should also be considered within the scope of protection of this invention. All components not explicitly stated in this embodiment can be implemented using existing technologies.
Claims
1. A method for improving the production efficiency of human epidermal growth factor, characterized in that, Recombinant Escherichia coli was fermented in a culture medium to obtain a fermentation broth containing human epidermal growth factor. The recombinant Escherichia coli is an Escherichia coli modified by enhancing cellulose synthesis. The method of enhancing cellulose synthesis is as follows: Through overexpression bcsB Gene expression, the bcsB The nucleotide sequence of the gene is the nucleotide sequence shown in Gene ID: 948045 on NCBI; the E. coli was introduced with the human epidermal growth factor plasmid pET30a hEGF; the human epidermal growth factor gene is SEQ ID NO.
1.
2. The method according to claim 1, characterized in that, The culture medium contains 5-15 g / L tryptone, 1-30 g / L yeast extract, 0-12 g / L sodium chloride, 0-50 g / L glucose, 0-10 mL / L glycerol, 0-14.4 g / L dipotassium hydrogen phosphate, and 0-5 g / L potassium dihydrogen phosphate. When the sodium chloride content is not 0 g / L, the contents of glycerol, dipotassium hydrogen phosphate, and potassium dihydrogen phosphate are all 0 g / L. When the sodium chloride content is 0 g / L, the glucose content is 0 g / L, while the contents of glycerol, dipotassium hydrogen phosphate, and potassium dihydrogen phosphate are not 0 g / L.
3. The method according to claim 1, characterized in that, Isopropyl-β-D-thiogalactoside is added during the fermentation process.
4. The method according to claim 1, characterized in that, During the fermentation process, 0.01~1.5 mM isopropyl-β-D-thiogalactoside is added.
5. The method according to claim 1, characterized in that, The fermentation temperature is 25~37℃.
6. The method according to claim 1, characterized in that, The fermentation is an immobilized fermentation.
7. The method according to claim 6, characterized in that, The carrier for the immobilized fermentation is any one or more combinations of cotton fiber, polyester fiber, non-woven fabric, nylon fiber and activated carbon.
8. The method according to claim 6, characterized in that, The amount of carrier used in the immobilized fermentation is 5~100 g / L.
Citation Information
Patent Citations
Method for production of recombinant human epidermal growth factor by temperature induction
CN102952817A
Application of recombinant escherichia coli with overexpression of fimH gene in fermentation production of amino acid
CN110079567A
Genetically engineered bacterium for expressing human epidermal growth factor and application of genetically engineered bacterium
CN111471636A
Recombinant human epidermal growth factor and its preparing process and medicinal composition
CN1360022A
Escherichia expression system of secretory expression recombinant human epidermal growth factor
CN1854294A