A trypsin m-9 protein mutant and use thereof

CN116355884BActive Publication Date: 2026-09-11SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310507521.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-05-06
Publication Date
2026-09-11
Estimated Expiration
2043-05-06

AI Technical Summary

Technical Problem

但小菜蛾胰蛋白酶Trypsin-9对Cry1Ac原毒素的增效作用有限,仍不能很好的满足提高Cry1Ac原毒素杀虫效率的需求

Benefits of technology

[0031] This invention obtained a Trypsin M-9 protein mutant through site-directed mutagenesis, which effectively enhances the insecticidal activity of Cry1Ac protoxin against cruciferous vegetable pests. Compared with the same dose of Cry1Ac protoxin, adding a small amount of Trypsin M-9 protein mutant significantly increases the mortality rate of Cry1Ac protoxin against diamondback moth, fall armyworm, flea beetle, beet armyworm, cabbage caterpillar, and beet armyworm; the mortality rate is 95.79% for diamondback moth, 95.01% for fall armyworm, 87.2% for flea beetle, 82.97% for beet armyworm, and 75.3% for both cabbage caterpillar and beet armyworm, all higher than the mortality rates of the same dose of Cry1Ac protoxin used alone. The Trypsin M-9 protein mutant described in this invention can be used as an synergist to enhance the control of Cry1Ac protoxin against cruciferous vegetable pests. It can also be used to prepare control agents for cruciferous vegetable pests, providing a new control strategy for cruciferous vegetable pests.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116355884B_ABST
    Figure CN116355884B_ABST
Patent Text Reader

Abstract

The application discloses a Trypsin M-9 protein mutant and application thereof. The application provides a Trypsin M-9 protein mutant, wherein the protein mutant is obtained through site-directed mutation, and can effectively improve the insecticidal activity of Cry1Ac protoxin on cruciferous vegetable pests. Compared with the same dose of Cry1Ac protoxin, a small amount of the Trypsin M-9 protein mutant can significantly improve the mortality of Plutella xylostella, Spodoptera frugiperda, Phyllotreta striolata, Spodoptera exigua, Pieris rapae and Prodenia litura on Cry1Ac protoxin. The Trypsin M-9 protein mutant can be used as a synergist to strengthen the prevention and control of Cry1Ac protoxin on cruciferous vegetable pests, and can be used for preparing a preparation for preventing and controlling cruciferous vegetable pests, and provides a new prevention and control strategy for preventing and controlling cruciferous vegetable pests.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology. More specifically, it relates to a Trypsin M-9 protein mutant and its applications. Background Technology

[0002] Currently, agricultural pest control still relies primarily on chemical pesticides. With the prolonged and extensive use of pesticides, the "3R" problem (replacing pesticides with chemical pesticides, reducing pesticide residues, and reducing pesticide use) is unavoidable; among these, pesticide resistance is particularly prominent. For example, the beet armyworm (Spodopteraexigua Hübner) has developed resistance to traditional pesticides such as organophosphates and pyrethroids, as well as to newer pesticides such as abamectin and amides. Furthermore, the long-term and excessive use of pesticides has also caused environmental and food safety problems, leading to the development of highly effective and environmentally friendly microbial insecticides.

[0003] Bacillus thuringiensis (Bt) is a Gram-positive bacterium harmless to humans and animals. However, when dissolved in the alkaline environment of the midgut of insects, it releases a protoxin, which is then activated by proteases to form insecticidal toxin proteins. Bacillus thuringiensis can form two types of insecticidal proteins: spore-forming insecticidal proteins (δ-endotoxins) and vegetative insecticidal proteins (VIPs). δ-endotoxins are further divided into Cry toxins and Cyt toxins. Cry toxins are toxic to Lepidoptera, Coleoptera, and Diptera pests, while Cyt toxins are primarily toxic to Diptera pests. Bt formulations made from Bacillus thuringiensis insecticidal proteins are considered the most widely used, highly effective, and environmentally friendly microbial insecticides.

[0004] The diamondback moth (Plutella xylostella (Linnaeus)) is one of the most serious pests of cruciferous vegetables, causing economic losses of up to $5 billion annually. The diamondback moth has developed severe resistance to all insecticides, including Bt formulations, making its control increasingly difficult. Research on insect resistance to Bt mainly focuses on two aspects: the activation of Bt Cry toxin by midgut proteases and the binding of midgut receptors to active Bt toxins; among these, insect trypsin, as the main protein for Bt Cry toxin activation, has been extensively studied. Chinese patent CN111778267A discloses a diamondback moth trypsin Trypsin-9 gene, finding that Trypsin-9 plays an important role in the activation of Cry1Ac protoxin in the midgut of the diamondback moth. However, the synergistic effect of diamondback moth trypsin-9 on Cry1Ac protoxin is limited and still cannot adequately meet the needs of improving the insecticidal efficiency of Cry1Ac protoxin. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to overcome the shortcomings of the existing diamondback moth trypsin-9 in improving the insecticidal effect of Cry1Ac protoxin, and to provide a truncated mutant of TrypsinM-9 and its application.

[0006] The first objective of this invention is to provide a Trypsin M-9 protein mutant.

[0007] A second objective of this invention is to provide a gene encoding the mutant of the said protein.

[0008] A third objective of this invention is to provide a recombinant plasmid for expressing the Trypsin M-9 protein mutant.

[0009] A fourth objective of this invention is to provide a recombinant cell for expressing the Trypsin M-9 protein mutant.

[0010] A fifth objective of this invention is to provide the application of the Trypsin M-9 protein mutant or the recombinant cells in enhancing the toxicity of Cry1Ac protoxin to cruciferous vegetable pests.

[0011] A sixth object of the present invention is to provide the use of the Trypsin M-9 protein mutant or the recombinant cell as an adjuvant or in the preparation of an agent that enhances the toxicity of Cry1Ac protoxin to cruciferous vegetable pests.

[0012] A seventh object of the present invention is to provide the use of the Trypsin M-9 protein mutant or the recombinant cell in the control of cruciferous vegetable pests or in the preparation of formulations for the control of cruciferous vegetable pests.

[0013] The eighth object of the present invention is to provide a synergist that enhances the toxicity of Cry1Ac protoxin to pests of cruciferous vegetables.

[0014] The ninth objective of this invention is to provide a formulation for controlling pests of cruciferous vegetables.

[0015] The above-mentioned objective of this invention is achieved through the following technical solution:

[0016] This invention obtained a protein mutant, named TrypsinM-9, by mutating different amino acid sites of the protease Trypsin-9 protein. This mutant effectively enhances the toxicity of Cry1Ac protoxin to cruciferous vegetable pests. This mutant can effectively improve the insecticidal activity and efficiency of Cry1Ac protoxin. Therefore, this invention seeks protection for the obtained TrypsinM-9 protein mutant and its applications.

[0017] This invention provides a Trypsin M-9 protein mutant, the amino acid sequence of which is shown in SEQ ID NO.1.

[0018] The present invention also provides a gene encoding the mutant of the said protein. Specifically, the nucleotide sequence of the gene is shown in SEQ ID NO.2.

[0019] The present invention also provides a recombinant plasmid for expressing the Trypsin M-9 protein mutant, the recombinant plasmid containing the nucleotide sequence shown in SEQ ID NO.2.

[0020] Specifically, the expression plasmid is pMT-V5-HisA.

[0021] The present invention also provides a recombinant cell for expressing the Trypsin M-9 protein mutant, wherein the recombinant cell contains the above-mentioned recombinant plasmid.

[0022] Specifically, the cells are S2 cells.

[0023] This invention utilizes S2 cells to construct a cell line that stably expresses the Trypsin M-9 protein mutant, enabling the large-scale production of viable recombinant Trypsin M-9 protein mutants.

[0024] The present invention also claims protection for the use of the Trypsin M-9 protein mutant or the recombinant cells in enhancing the toxicity of Cry1Ac protoxin to cruciferous vegetable pests.

[0025] The present invention also claims protection for the use of the Trypsin M-9 protein mutant or the recombinant cell as an adjuvant or in the preparation of an agent that enhances the toxicity of Cry1Ac protoxin to cruciferous vegetable pests.

[0026] The present invention also claims protection for the use of the Trypsin M-9 protein mutant or the recombinant cells in the control of cruciferous vegetable pests or in the preparation of formulations for the control of cruciferous vegetable pests.

[0027] The present invention also provides an synergist to enhance the toxicity of Cry1Ac protoxin to cruciferous vegetable pests, wherein the synergist contains the TrypsinM-9 protein mutant.

[0028] The present invention also provides a formulation for controlling pests of cruciferous vegetables, the formulation containing the TrypsinM-9 protein mutant and Cry1Ac protoxin.

[0029] Specifically, the cruciferous vegetable pests mentioned in this invention are one or more of the following: diamondback moth, cabbage caterpillar, fall armyworm, beet armyworm, and yellow striped flea beetle; the Cry1Ac protoxin is produced by Bacillus thuringiensis, specifically Bacillus thuringiensis strain HD73.

[0030] The present invention has the following beneficial effects:

[0031] This invention obtained a Trypsin M-9 protein mutant through site-directed mutagenesis, which effectively enhances the insecticidal activity of Cry1Ac protoxin against cruciferous vegetable pests. Compared with the same dose of Cry1Ac protoxin, adding a small amount of Trypsin M-9 protein mutant significantly increases the mortality rate of Cry1Ac protoxin against diamondback moth, fall armyworm, flea beetle, beet armyworm, cabbage caterpillar, and beet armyworm; the mortality rate is 95.79% for diamondback moth, 95.01% for fall armyworm, 87.2% for flea beetle, 82.97% for beet armyworm, and 75.3% for both cabbage caterpillar and beet armyworm, all higher than the mortality rates of the same dose of Cry1Ac protoxin used alone. The Trypsin M-9 protein mutant described in this invention can be used as an synergist to enhance the control of Cry1Ac protoxin against cruciferous vegetable pests. It can also be used to prepare control agents for cruciferous vegetable pests, providing a new control strategy for cruciferous vegetable pests. Attached Figure Description

[0032] Figure 1 Figure 1 shows the electrophoresis results of the Trypsin M-9 protein mutant gene sequence and the enzyme digestion identification results of its recombinant plasmid; Figure 2 shows the PCR amplification electrophoresis results of the Trypsin M-9 protein mutant; Figure 3 shows the double enzyme digestion identification results of the recombinant plasmid of the Trypsin M-9 protein mutant; Figure 4 shows the gene sequence of the Trypsin M-9 protein mutant after double enzyme digestion; Figure 5 shows the colony PCR identification results.

[0033] Figure 2 The results of identifying the expression of the Trypsin M-9 protein mutant in S2 cells.

[0034] Figure 3 The results show the sensitivity of third-instar larvae of the diamondback moth to Cry1Ac protoxin.

[0035] Figure 4 The effects of different concentrations of Cry1Ac protoxin on the development of diamondback moth are shown in the figure. In the figure, A represents the effect of 20 μg / mL Cry1Ac protoxin on the development of 4th instar larvae of diamondback moth; B represents the effect of 100 μg / mL Cry1Ac protoxin on the development of 4th instar larvae of diamondback moth; C represents the effect of 20 μg / mL Cry1Ac protoxin on the development of prepupae of diamondback moth; and D represents the effect of 100 μg / mL Cry1Ac protoxin on the development of 4th instar larvae of diamondback moth.

[0036] Figure 5 The effect of Cry1Ac protoxin on the feeding of diamondback moth is shown in the figure. The left side of each petri dish in the figure is the artificial feed without Cry1Ac protoxin, and the right side is the artificial feed with Cry1Ac protoxin. A to D in the figure represent the feeding of diamondback moth after 0, 6, 12 and 18 hours of feeding, respectively.

[0037] Figure 6The figures show the synergistic effect of different dosages of Trypsin M-9 protein mutant on Cry1Ac protoxin. In the figures, Control represents 50 μL of blank cell lysis buffer + 20 μL of 80 μg / mL Cry1Ac protoxin; 1 represents 20 μL of recombinant cell lysis buffer expressing Trypsin M-9 protein mutant + 20 μL of 80 μg / mL Cry1Ac + 30 μL of blank cell lysis buffer; 2 represents 30 μL of recombinant cell lysis buffer expressing Trypsin M-9 protein mutant + 20 μL of 80 μg / mL Cry1Ac protoxin + 20 μL of blank cell lysis buffer; 3 represents 40 μL of recombinant cell lysis buffer expressing Trypsin M-9 protein mutant + 20 μL of 80 μg / mL Cry1Ac protoxin + 10 μL of blank cell lysis buffer; and 4 represents 50 μL of recombinant cell lysis buffer expressing Trypsin M-9 protein mutant + 20 μL of 80 μg / mL Cry1Ac protoxin. Cry1Ac protoxin; 5 is 50 μL of recombinant cell lysate expressing Trypsin M-9 protein mutant + 20 μL of blank cell lysate.

[0038] Figure 7 The results show the synergistic effect of Trypsin-9 and TrypsinM-9 protein mutants on Cry1Ac protoxin; CK is 50 μL ddH2O.

[0039] Figure 8 The results are broad-spectrum bioassays of Trypsin M-9 protein mutant and Trypsin-9-enhanced Cry1Ac protoxin, respectively. Detailed Implementation

[0040] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.

[0041] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.

[0042] Example 1: Obtaining and Cloning of Trypsin M-9 Protein Mutants

[0043] This invention obtained protein mutants with different effects by mutating different amino acid sites of the diamondback moth protease Trypsin-9 protein. Through continuous adjustment, a protein mutant that effectively enhances the toxicity of Cry1Ac protoxin to cruciferous vegetable pests and has a better synergistic effect than the original protein (Trypsin-9 protein) was obtained and named TrypsinM-9 protein mutant. The gene and protein sequence of the diamondback moth protease Trypsin-9 protein have been disclosed in Chinese Patent Publication No. CN111778267A.

[0044] Specifically, this invention utilizes reverse transcription PCR to perform site-directed mutagenesis on the nucleotide sequence of the gene encoding the CDS region of the diamondback moth trypsin-9 protein, obtaining a TrypsinM-9 protein mutant with broad-spectrum synergistic insecticidal activity against Bacillus thuringiensis Cry1Ac protoxin. The amino acid sequence of the protein mutant is shown below (SEQ ID NO.1), and is 240 aa in length.

[0045]

[0046] Note: The black boxes in the sequence represent the prozymogen cleavage site (RIVGG); the gray shading represents the catalytic triplet (H, D, S); the underlined positions represent the enzyme activity-related elements (DSGGP); the amino acid residues that make up the three cysteine ​​residues are represented by italics and underlines, which can form three pairs of disulfide bonds; the bold and underlined parts are the mutated amino acids, which are mutated from A to T, from TIDR to NVSN, from FGAVV to TIAAL, from EY to AF, from V to A, from ID to TA, and from RT to SS.

[0047] The nucleotide sequence of the gene encoding the Trypsin M-9 protein mutant is shown below (SEQ ID NO.2):

[0048] GTCCCTCGCACTTCACAAAGGATTGTGGGAGGATCCACTACCAACGTTAGCAACTACCCCACAATCGCCGCTCTGCTGTTCCTCTCGAATGGAGGATTCTTCCGCCAGCATTGCGGTGGATCCATCATCAATGAAAATGCTGT CTTAACTGCTGCGCACTGTCTGCACCGCAGGAGAAACGACCAATTCCGCATCCGTGTCGGTTCAACCCAAGCCAGCAGCGGCGGCAGCGTGCACGCAGTCAACCGGTTGATTTCACACGCGAGCTTCAACCACAACACCCAGGA CAATGACCTCGCCATCATGAGGACCACCACCCAGATCAACTTCCTCCCTGGATTGGTCGCAGCTGGCACCTTTCGCTGGGTCTAACTACAACGTGCCTGACGGTGCCTCCGTCTGGGCTATCGGCTGGGGAGCTGGACGACCCAACGGTCCCGGATCTGAGCAGCTGCGTCACGTGGAGATCTGGACCGTGAACCAGGCGGTCTGCAGGGCTCGCTA TCAGAACATCAGAATGACTGTTACGGACAACATGCTGTGGCTCGGGCTGGCTCGACGTGGGCGGCCGCGACCAGTGCACGGGAGACTCTGGTGGCCCCCTGCTCCATGATAATGTGGTCATAGGAGTCTCATCGTGGGGCCAGGGCTGTGCGTCGGCTGCTTTCCCCGGTGTCAACGCTCGTGTATCCCGCTACACTGCCTGGATCTCTTCCAATGCA

[0049] The specific experimental procedure is as follows:

[0050] (1) The midgut of a 4th instar diamondback moth was obtained by dissection, and total RNA was extracted from the midgut of the diamondback moth using the Trizol method;

[0051] (2) Using Takara's PrimeScript TM The RT Master Mix reagent was used to reverse transcribe the obtained total RNA into cDNA first strand. The reaction system for cDNA reverse transcription is shown in Table 1. The reaction system was prepared according to Table 1, mixed well, centrifuged for 1 min, and cDNA reverse transcription was performed. The reaction conditions were: 37℃, 30 min; 85℃, 5 s; 10℃ to end the reaction.

[0052] Table 1 cDNA reverse transcription system

[0053]

[0054] (3) Primers were designed using the CDS region sequence of the Trypsin-9 gene as a template to remove the Trypsin-9 signal peptide and perform site-directed mutagenesis on its amino acids; the primer sequences (5'-3') used are shown below:

[0055] Upstream primer: GTCCCTCGCACTTCACAAAGGATTGTGGGAGGATCCACTAC CAACGTTAGCAACTACCCCACAATCGCCGCTCTG;

[0056] Downstream primers: TGCATTGGAAGAGATCCAGGCAGTGTAGCGGGATACACGAGCGTTGACACCGGGGAAAGCAGCC;

[0057] (4) Using the cDNA obtained from reverse transcription as a template, perform PCR amplification with the above primers. After preparing the reaction system, mix gently, centrifuge briefly, and place on a PCR instrument for PCR amplification. The PCR amplification reaction system is as follows: 2 μL cDNA, 12.5 μL 2×Taq PCRStarMix, 1 μL upstream primer (20 μM), 1 μL downstream primer (20 μM), and RNase-free ddH2O to a final volume of 25 μL; or 25 μL 2×HiFi Taq PCR StarMix (Genstar), 1 μL upstream primer (20 μM), 1 μL downstream primer (20 μM), 2 μL cDNA, and ddH2O to a final volume of 50 μL. The reaction program is: 94℃ 2 min → (94℃ 30 s → 57℃ 30 s → 72℃ 1 min) × 30 cycles → 72℃ 5 min → 10℃, End. After PCR, the PCR products were detected by 1% agarose gel electrophoresis. The electrophoresis conditions were: 100V for 30min.

[0058] The PCR amplification and electrophoresis results of the Trypsin M-9 protein mutant are as follows: Figure 1 As shown in A, by Figure 1 As can be seen from A in the figure, the present invention amplifies a single band whose size matches the expectation.

[0059] (5) The target fragment was purified and recovered using the TIANGEN DNA gel recovery kit, and its concentration, purity and recovery quality were detected using a Therom NANODROP instrument and 1% agarose gel electrophoresis.

[0060] (6) The target fragment was cloned into the cloning vector pMD19-T via TA cloning to construct the recombinant plasmid pMD19-Trypsin-M9; the ligation system is shown in Table 2:

[0061] Table 2T Carrier Connection System

[0062]

[0063] Ligation was performed overnight at 16°C. The product of overnight ligation was transformed into Escherichia coli DH5α strain to obtain recombinant bacteria containing recombinant plasmid pMD19-Trypsin-M9. After sequencing to determine the sequence of the target fragment, glycerol bacteria containing recombinant plasmid pMD19-Trypsin-M9 were stored. The plasmid DNA was stored at -20°C, and the glycerol bacteria containing the recombinant plasmid were stored at -80°C.

[0064] Example 2: High-efficiency expression of Trypsin M-9 protein mutant

[0065] 1. Construction of recombinant plasmid pMT-TrypsinM-9

[0066] To facilitate the ligation of the gene sequence encoding the Trypsin M-9 protein mutant shown in SEQ ID NO.1 to the expression vector pMT-V5-HisA, and to meet the translation requirements of pMTVipHisA and ensure correct translation of the inserted sequence, this invention adds a T base from a signal peptide at the very beginning of the sequence. Simultaneously, this invention redesigned the PCR amplification primers, introducing EcoRI and Xho I restriction sites at both ends of the upstream primer (pMT-TrypsinM-9UP) and downstream primer (pMT-TrypsinM-9down), respectively. The primer (5'-3') sequences are shown below:

[0067] pMT-TrypsinM-9UP:

[0068] pMT-TrypsinM-9down:

[0069] The italicized parts are protective bases, and the underlined parts are enzyme cleavage sites.

[0070] After preparing the reaction system with the primers described above, mix gently, centrifuge briefly, and place on a PCR instrument for PCR amplification. The PCR amplification reaction system was as follows: 2×HiFi Taq PCR StarMix 25 μL, upstream primer (20 μM) 1 μL, downstream primer (20 μM) 1 μL, DNA 2 μL, and ddH2O added to a total volume of 50 μL. The reaction program was: 94℃ 2 min → (94℃ 30 s → 55℃ 30 s → 72℃ 1 min) × 30 cycles → 72℃ 5 min → 10℃, End. After PCR, the PCR products were detected by 1% agarose gel electrophoresis under the following conditions: 100V electrophoresis for 30 min.

[0071] The target fragment was purified and recovered using the TIANGEN DNA gel extraction kit and Takara QuickCut. TM EcoR I and QuickCut TM Xho I was used to double digest the target fragment and the pMTBip V5 His-A vector, as shown in Table 3. After digestion at 37℃ for 15 min, the digested target fragment and the digested pMTBip V5 His-A vector fragment were recovered.

[0072] Table 3 Enzyme digestion reaction system

[0073]

[0074] The double-digested empty vector DNA and PCR products were recovered and ligated using the Takara DNA Ligation kit. The ligation system is shown in Table 4.

[0075] Table 4. T4 DNA ligation system

[0076]

[0077]

[0078] After preparing the ligation system according to Table 4, add an equal volume of Solution I, mix well, centrifuge briefly, and incubate overnight at 16°C. The ligation product is then transformed into DH5α bacteria (adding 1 μL of Solution III per 10 μL of reaction solution can improve transformation efficiency). Positive single colonies are screened by colony PCR, and the recombinant plasmid pMT-TrypsinM-9 is extracted and verified by double enzyme digestion. The double enzyme digestion results of the recombinant plasmid of the TrypsinM-9 protein mutant are shown below. Figure 1 As shown in B; the gene sequence of the Trypsin M-9 protein mutant after double enzyme digestion is shown in Figure B. Figure 1 As shown in C; the colony PCR identification results are as follows. Figure 1As shown in D in the diagram. (By...) Figure 1 It is evident that the present invention has successfully constructed the recombinant plasmid pMT-TrypsinM-9, which is a mutant of the TrypsinM-9 protein.

[0079] 2. Construction of the pMT-Trypsin M-9-S2 cell line

[0080] (1) The pMT-TrypsinM-9 recombinant plasmid and the antibiotic plasmid were co-transfected into S2 cells:

[0081] S2 cells (Invitrogen, USA) were plated in 30 mm cell culture dishes and cultured in SIM SF medium (containing 10% fetal bovine serum, Gibco, #10099141C). When the cells were cultured overnight at 27°C and grew to cover 70%–80% of the culture dish, the pMT-TrypsinM-9 recombinant plasmid and the antibiotic plasmid pCoBlast (Invitrogen, USA) were co-transfected into S2 cells (Invitrogen, USA). The co-transfection reagent was FugENE HD Transfection Reagent (Promega, USA).

[0082] The specific process is as follows:

[0083] ① Under normal growth conditions, transfection is performed when the cells are in the logarithmic growth phase and cover 70% to 80% of the culture dish;

[0084] ② Mix 20 μg of pMT-TrypsinM-9 recombinant plasmid and 1 μg of pCoBlast endotoxin-free plasmid in 100 μL of SIMSF medium, then add 10 μL of FugENE HD Transfection Reagent and gently mix by pipetting. Let stand at room temperature for 10 min.

[0085] ③ Add the resulting mixture to a cell culture dish;

[0086] ④ 48 hours after transfection, observe the cells under a microscope and remove cells that are growing abnormally or are unstable;

[0087] ⑤ Collect and centrifuge the cells transfected for 72 hours, replace with fresh cell culture medium, replace with fresh S2 cell culture medium, and add Blastidine S to a final concentration of 25 μg / mL; continue to culture the S2 cells transfected with pMT-TrypsinM-9 using antibiotics until cell clones resistant to this antibiotic appear.

[0088] 3. Expression of pMT-Trypsin M-9-S2 cell line

[0089] Trypsin M-9 expression was induced for 48 h by adding copper sulfate to a final concentration of 500 μM in culture medium containing Blastidine S (25 μg / mL) resistant cell clones. Cells were then collected by centrifugation at 3000 rpm for 2 min, removing the culture medium. Cells were resuspended in 100–200 μL IRA cell lysis buffer, lysed on ice for 30 min, and then centrifuged at 12000 rpm for 2 min. The supernatant was collected. SDS-PAGE electrophoresis and Western blotting were used to detect Trypsin M-9 expression in the cells. Verified cells were further passaged in culture medium containing 25 μg / mL antibiotic for expansion, and protein was collected for later use.

[0090] Cell lysates were boiled and then subjected to SDS-PAGE electrophoresis and Western blot to detect the expression level of Trypsin M-9 protein mutant in cells. The results of Trypsin M-9 protein mutant expression identification in S2 cells are as follows: Figure 2 As shown. By Figure 2 It can be seen that the His antibody can hybridize with Trypsin M-9 protein, indicating that the present invention has successfully obtained the Trypsin M-9 protein mutant through recombinant expression. The Trypsin M-9 protein can be expressed after transient transfection, but the expression level is low. In stable cell lines, the Trypsin M-9 protein is significantly increased. The above results indicate that the Trypsin M-9 protein mutant described in the present invention can be stably and extensively expressed in S2 cells.

[0091] Example 3: Obtaining and Detecting the Toxicity of Cry1Ac Prototoxin

[0092] 1. Purification of Cry1Ac protoxin

[0093] A seed culture of activated Bacillus thuringiensis HD73 strain was obtained by streaking the seed culture onto LB solid agar plates. After single colonies grew, they were picked and transferred to LB liquid agar and incubated at 220 rpm and 30°C for 12 h. The bacterial culture was then transferred to 1 / 2 LB medium at a ratio of 1:100 and incubated at 220 rpm and 30°C for 28.5 h. The precipitate was collected by centrifugation at 8000g for 10 min at 4°C. The precipitate was washed once with 1M NaCl (pre-cooled) and once with ddH2O (sterilized and pre-cooled), and then centrifuged at 8000g for 10 min at 4°C. The precipitate was collected and rinsed with Buffer A (50 mM Na2CO3, 50 mM EDTA-Na2, 3% β-ME, pH 10). Resuspend the sample in 10.0°C, adjust the pH to 9.6–10, and incubate on ice for 1 hour at 100 rpm / min. Centrifuge at 13,000 g for 20 minutes at 4°C and collect the supernatant. Adjust the pH of the collected supernatant to 4.5 with 4 M NaAc-HAc and incubate overnight at 4°C. Centrifuge at 13,000 g for 15 minutes at 4°C, wash twice with ddH2O, and dissolve the precipitate with 50 mM Na2CO3 (pH 9.6) to obtain the Cry1Ac protoxin.

[0094] 2. Determination of the toxicity of Cry1Ac protoxin to diamondback moth

[0095] The extracted Cry1Ac protoxin was diluted with sterile ddH2O to six different concentrations (20, 40, 60, 80, 100, and 120 μg / mL). A control group containing only sterile ddH2O was also included. Each treatment had four replicates, with ten diamondback moths per replicate. One gram of artificial feed was added to each sterile petri dish (9 cm in diameter), and 250 μL of the Cry1Ac protoxin dilution was dropped onto the feed in each dish. A control group containing sterile ddH2O was also included. After thorough mixing, ten third-instar diamondback moth larvae that had been starved for approximately 4 hours were selected and placed in each dish. The larvae were then transferred to an artificial climate chamber where temperature and humidity conditions were consistent with normal rearing. After 56 hours, the number of live larvae in each dish was counted, and the mortality rate for each treatment was calculated. Referring to the mortality rate of the control group, the corrected mortality rate for each treatment was obtained using Abbott's formula (Abbott, 1987). SPSS was then used to calculate the corrected mortality rate for each treatment. 22 Probit analysis was performed and the slope of the toxicity regression equation was calculated for its sublethal dose (LC25) and its 95% confidence interval (Finney, 1971).

[0096] The sublethal dose of Cry1Ac protoxin to diamondback moth larvae is shown in Table 5. The corresponding LC25 after 36 h of treatment is 20 μg / mL.

[0097] Table 5. Sensitivity determination of third-instar larvae of the diamondback moth to Cry1Ac protoxin.

[0098]

[0099] The results of the sensitivity test of third instar larvae of the diamondback moth to Cry1Ac protoxin are as follows: Figure 3 As shown, by Figure 3 It is known that Cry1Ac protoxin at concentrations of 20 μg / mL, 40 μg / mL, 60 μg / mL, 80 μg / mL, 100 μg / mL, and 120 μg / mL is toxic to diamondback moth in a concentration-dependent manner. Low concentrations of Cry1Ac protoxin have a low mortality rate, while high concentrations have a high mortality rate.

[0100] The effects of different concentrations of Cry1Ac protoxin on the development of diamondback moth, such as Figure 4 As shown; Figure 4 In the figure, A and C represent the effects of 20 μg / mL Cry1Ac protoxin on the development of fourth instar larvae and prepupae of diamondback moth. Figure 4 B and D in the figure represent the effects of 100 μg / mL Cry1Ac protoxin on the development of 4th instar larvae of the diamondback moth. Figure 4 It was found that 20 μg / mL and 100 μg / mL of Cry1Ac protoxin had a significant impact on 4th instar larvae. Compared with the control, 20 μg / mL of Cry1Ac protoxin mainly prolonged development and made the larvae smaller; 100 μg / mL of Cry1Ac protoxin mainly caused diarrhea in 4th instar larvae and made the larvae less vigorous.

[0101] 3. Effects of Cry1Ac protoxin on the feeding of diamondback moth

[0102] (1) Rearing of diamondback moths

[0103] Diamondback moths were reared at a temperature of 25±1℃, a photoperiod of 16h:8h (light:dark), and a relative humidity of 75%. Larvae were fed an artificial diet containing: 40g yeast powder, 75g wheat germ powder, 2g multivitamins, 2g sorbic acid, 2g parabens, 2g ascorbic acid, 20g sucrose, 6g radish seeds, 12g agar, 2ml rapeseed oil, 3-4 drops linoleic acid, and 500ml water. Adult moths were fed a 10% honey solution for nutrition. Eggs were collected using egg cards soaked in radish juice.

[0104] (2) Effects of Cry1Ac protoxin on feeding of diamondback moth

[0105] Diamondback moths were fed artificial feed until the first day of their fourth instar. Thirty fourth instar larvae were then starved for 4 hours. Two 0.1g pieces of artificial feed were placed in a petri dish and mashed into a paste. 30μL of double-distilled water was added to the feed on the left side, and 30μL of Cry1Ac (20μg / mL) protoxin was added to the feed on the right side. The starved fourth instar larvae were then transferred to the bottom of the petri dish with a paintbrush, allowing them to choose their feed freely. The number of larvae consuming the two feeds was observed and photographed every 6 hours. The experiment was repeated 5 times.

[0106] (3) Experimental Results

[0107] The effects of Cry1Ac protoxin on the feeding of diamondback moth are as follows: Figure 5 As shown; Figure 5 The left side of each culture dish contains artificial feed without Cry1Ac prototoxin, and the right side contains artificial feed with Cry1Ac prototoxin. Figure 5 In the figures, A through D represent the feeding behavior of the diamondback moth after 0, 6, 12, and 18 hours of rearing, respectively. Figure 5 It was found that Cry1Ac protoxin (20 μg / mL) affects the feeding choices of diamondback moths, causing them to avoid feed containing Cry1Ac protoxin, and this phenomenon becomes more pronounced over time. Initially, after 4 hours of starvation, diamondback moths were excited and rushed towards food upon seeing it; after 6 hours, the feeding difference between the two types of food was still not obvious; however, after 12 hours, a clear difference in feeding between the two types of food became apparent, with most moths going to the feed without Cry1Ac protoxin; after 18 hours, no diamondback moths were found at the feed containing Cry1Ac protoxin. These results indicate that Cry1Ac protoxin affects the feeding behavior of diamondback moths, and feed containing Cry1Ac protoxin is undesirable.

[0108] Example 4: Recombinant protein Trypsin enhances Cry1Ac protoxin

[0109] 1. Synergistic effect of different dosages of Trypsin M-9 on Cry1Ac prototoxin

[0110] (1) Rearing of diamondback moths

[0111] The rearing of diamondback moths is the same as in Example 3;

[0112] (2) Preparation of Trypsin M-9 protein mutant

[0113] Recombinant cells expressing the Trypsin M-9 protein mutant were induced to express the protein by adding copper sulfate to a final concentration of 500 μM in a culture medium containing Blastidine S (25 μg / mL) resistance for 48 h. After centrifugation at 3000 rpm for 2 min, the culture medium was removed and the cells were collected. The cells were resuspended in 100–200 μL of RIPA cell lysis buffer. After lysis on ice for 30 min, the cells were centrifuged at 12000 rpm for 2 min and the supernatant was collected. The Trypsin M-9 (10 μg / mL) cell lysis buffer was prepared for later use.

[0114] (3) Treatment of diamondback moth with Cry1Ac protoxin

[0115] Three hundred healthy, uniformly aged third-instar larvae of the diamondback moth were randomly selected and starved for 4 hours on the first day. The Cry1Ac protoxin was diluted to 80 μg / mL using RNase-free ddH2O. 20 μL of the diluted Cry1Ac protoxin and different volumes of Trypsin M-9 cell lysis buffer (10 μg / mL) were added to every 0.1 g of artificial feed, as detailed below:

[0116] Control: 50 μL blank cell lysate + 20 μL 80 μg / mL Cry1Ac protoxin;

[0117] Treatment 1: 20 μL Trypsin M-9 cell lysis buffer (10 μg / mL) + 20 μL 80 μg / mL Cry1Ac protoxin + 30 μL blank cell lysis buffer;

[0118] Treatment 2: 30 μL Trypsin M-9 cell lysis buffer (10 μg / mL) + 20 μL 80 μg / mL Cry1Ac protoxin + 20 μL blank cell lysis buffer;

[0119] Treatment 3: 40 μL Trypsin M-9 cell lysis buffer (10 μg / mL) + 20 μL 80 μg / mL Cry1Ac protoxin + 10 μL blank cell lysis buffer;

[0120] Treatment 4: 50 μL Trypsin M-9 cell lysate (10 μg / mL) + 20 μL 80 μg / mL Cry1Ac protoxin;

[0121] Treatment 5: 50 μL Trypsin M-9 cell lysis buffer (10 μg / mL) + 20 μL blank cell lysis buffer;

[0122] The treated larvae were divided into 6 groups, and each group was further divided into 4 subgroups as replicates. Each replicate group contained 10 third-instar larvae of the diamondback moth. The number of surviving larvae was recorded every 8 hours until all larvae died. Data processing and chart creation were performed using Graphpad 8.0 software. The number of dead larvae was counted, survival curves were plotted, and Student's T test was used for significance analysis.

[0123] (4) Experimental Results

[0124] The synergistic effect of different dosages of Trypsin M-9 on Cry1Ac prototoxin was determined as follows: Figure 6 As shown; by Figure 6 The results showed that after feeding the diamondback moth with a mixture of 50 μL Trypsin M-9 cell lysate (10 μg / mL) and Cry1Ac protoxin for 2 days, the survival rate was 0%; after feeding the diamondback moth with a mixture of 40 μL or 30 μL Trypsin M-9 cell lysate (10 μg / mL) and Cry1Ac protoxin for 2 days, the survival rate was 6.667%; after feeding the diamondback moth with a mixture of 20 μL Trypsin M-9 cell lysate (10 μg / mL) and Cry1Ac protoxin for 2 days, the survival rate was 16.667%; while after feeding the diamondback moth with Cry1Ac protoxin alone for 2 days, the survival rate was 39.11%; and after feeding the diamondback moth with Trypsin M-9 cell lysate (10 μg / mL) alone for 2 days, the survival rate was 91.667%. These results indicate that Trypsin M-9 cell lysate (10 μg / mL) has a significant synergistic effect on Cry1Ac protoxin.

[0125] 2. Synergistic effect of Trypsin-9 and TrypsinM-9 protein mutants on Cry1Ac protoxin (1) Treatment of diamondback moth with Cry1Ac protoxin

[0126] Two hundred healthy, uniformly aged third-instar larvae of the diamondback moth were randomly selected and starved for 4 hours on the first day. Cry1Ac protoxin was diluted to 80 μg / mL using RNase-free ddH2O. 20 μL of the diluted Cry1Ac protoxin was added to every 0.1 g of artificial feed, along with either 30 μL of Trypsin M-9 cell lysis buffer (10 μg / mL) or 30 μL of Trypsin M-9 cell lysis buffer (prepared using the same method as Trypsin M-9 cell lysis buffer). The control group consisted of an equal volume of S2 cell (blank cell) lysis buffer. All samples were thoroughly mixed. The treated larvae were divided into four groups, each further divided into four replicates, with 10 third-instar larvae per replicate. The preparation of the four treatments is shown below.

[0127] Blank cell lysis buffer + Cry1Ac: 30 μL blank cell lysis buffer + 20 μL 80 μg / mL Cry1Ac protoxin;

[0128] Mutant: Trypsin M-9 cell lysate + Cry1Ac: 30 μL Trypsin M-9 cell lysate + 20 μL 80 μg / mL Cry1Ac protoxin

[0129] Raw: Trypsin-9 cell lysis buffer + Cry1Ac: 30 μL Trypsin-9 cell lysis buffer + 20 μL 80 μg / mL Cry1Ac protoxin

[0130] ddH2O + Cry1Ac: 30 μL ddH2O + 20 μL 80 μg / mL Cry1Ac protoxin

[0131] CK: 50 μL Trypsin M-9 cell lysis buffer

[0132] (2) Experimental Results

[0133] The synergistic effect of Trypsin-9 and TrypsinM-9 protein mutants on Cry1Ac prototoxin was as follows: Figure 7 As shown. By Figure 7 It was found that after feeding a mixture of Trypsin-M-9 cell lysate and Cry1Ac protoxin for 48 hours, 30 μL of Trypsin-M-9 cell lysate (10 μg / mL) significantly enhanced the efficacy of Cry1Ac protoxin, resulting in a 0% survival rate for diamondback moths. After feeding a mixture of Trypsin-M-9 cell lysate and Cry1Ac protoxin for 48 hours, 30 μL of Trypsin-M-9 cell lysate (10 μg / mL) significantly enhanced the efficacy of Cry1Ac protoxin, resulting in a 19.808% survival rate for diamondback moths. In contrast, feeding a mixture of blank cell lysate and Cry1Ac protoxin for 48 hours resulted in a 33.046% survival rate. The survival rate of diamondback moths after 48 hours was 33.420%; the survival rate after 48 hours of feeding with only Trypsin M-9 cell lysate (10 μg / mL) was 91.304%. These results indicate that Trypsin M-9 cell lysate (10 μg / mL), i.e., the Trypsin M-9 protein mutant, has a significant synergistic effect on Cry1Ac protoxin, and the synergistic effect of Trypsin M-9 protein mutant on protoxin Cry1Ac is significantly higher than that of Trypsin-9 protein on Cry1Ac toxin (p = 0.001).

[0134] Example 5: Toxicity determination of Trypsin M-9 protein mutant-enhanced Cry1Ac protoxin against vegetable pests.

[0135] (1) Preparation of Trypsin M-9 protein

[0136] Same as Example 4;

[0137] (2) Pest feeding

[0138] Two hundred healthy, uniformly aged beet armyworms, fall armyworms, diamondback moths, cabbage caterpillars, beet armyworms, and striped flea beetles (3rd instar, first day) were randomly selected and starved for 4 hours. Cry1Ac protoxin was diluted to 80 μg / mL using RNase-free ddH2O. 20 μL of Cry1Ac (80 μg / mL) protoxin and 30 μL of Trypsin M-9 cell lysate (10 μg / mL) or 30 μL of Trypsin-9 cell lysate (10 μg / mL) were added to each 0.1 g of artificial feed. The control group consisted of an equal volume of S2 cell (blank) lysate. All samples were mixed thoroughly. Each insect species was divided into 6 groups, with three replicates per group and 24 insects per replicate.

[0139] Yellow-striped flea beetle larvae were reared by spraying 30 μL of Trypsin M-9 cell lysate (10 μg / mL) or 30 μL of Trypsin-9 cell lysate (10 μg / mL) onto 2–4 mm radish tubers. The control group was reared with an equal volume of S2 cell lysate at room temperature. The radish tubers sprayed with the bacterial solution were changed daily, and the mortality rate was recorded every 8 hours. Data were collected and analyzed using SPSS statistical software after 48 hours.

[0140] (3) Experimental Results

[0141] The toxicity assay and Log-rank Mantel-Cox results of Trypsin M-9 cell lysate (10 μg / mL) against cruciferous vegetable pests are as follows: Figure 8 As shown in A in the diagram. From Figure 8 As shown in A, in vitro administration of a mixture of Trypsin M-9 cell lysate (10 μg / mL) and Cry1Ac protoxin can rapidly kill cruciferous vegetable pests. At the same dosage, the insecticidal effect is best against diamondback moth, with a survival rate of only 3.5%, while the survival rate of fall armyworm is 4.997%, flea beetle is 4.272%, beet armyworm is 17.028%, and the survival rates of cabbage caterpillar and beet armyworm are both 25.2%.

[0142] Similarly, this invention also conducted toxicity assays on cruciferous vegetable pests using unmutated Trypsin-9 cell lysate (10 μg / mL). The toxicity assay results and Log-rank Mantel-Cox assay results for Trypsin-9 cell lysate (10 μg / mL) on cruciferous vegetable pests are as follows: Figure 8 As shown in B in the diagram. (By...) Figure 8 As shown in section B, adding a mixture of unmutated Trypsin-9 cell lysate and Cry1Ac protoxin to food in vitro can also rapidly kill cruciferous vegetable pests. At the same dosage, the insecticidal effect is best against the diamondback moth, with a survival rate of 9.433%, followed by the striped flea beetle, with a survival rate of 11.811%; the survival rate of the fall armyworm is 15.939%, the survival rate of the beet armyworm is 23.443%, the survival rate of the cabbage caterpillar is 26.177%, and the survival rate of the beet armyworm is 27.673%.

[0143] The results above indicate that while the mixture of unmutated Trypsin-9 cell lysate and Cry1Ac protoxin exhibits broad-spectrum insecticidal effects against diamondback moth larvae, fall armyworm larvae, beet armyworm larvae, cabbage caterpillar larvae, and beet armyworm larvae, and also shows a strong effect against flea beetle larvae, its synergistic effect against these pests is weaker than that against Trypsin M-9 mutant cell lysate (10 μg / mL), and the difference between the two is statistically significant. Furthermore, the mixture of unmutated Trypsin-9 cell lysate and Cry1Ac protoxin shows highly significant statistical differences (p<0.001) against different cruciferous vegetable pests. This suggests that the present invention enhances the synergistic effect of Trypsin-9 against Cry1Ac protoxin through site-directed mutagenesis, and the Trypsin M-9 mutant obtained through site-directed mutagenesis has a stronger synergistic effect.

[0144] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A Trypsin M-9 protein mutant, characterized in that, The amino acid sequence of the protein mutant is shown in SEQ ID NO.

1.

2. A gene encoding the protein mutant of claim 1.

3. The application of the Trypsin M-9 protein mutant according to claim 1 in improving the toxicity of Cry1Ac protoxin to cruciferous vegetable pests, wherein the cruciferous vegetable pests are one or more of the following: diamondback moth, cabbage caterpillar, fall armyworm, beet armyworm, and yellow-striped flea beetle.

4. The use of the Trypsin M-9 protein mutant of claim 1 as an synergist or in the preparation of an agent that enhances the toxicity of Cry1Ac protoxin to cruciferous vegetable pests, wherein the cruciferous vegetable pests are one or more of the following: diamondback moth, cabbage caterpillar, fall armyworm, beet armyworm, and yellow-striped flea beetle.

5. The use of the Trypsin M-9 protein mutant and Cry1Ac protoxin as described in claim 1 in the control of cruciferous vegetable pests or in the preparation of formulations for the control of cruciferous vegetable pests, wherein the cruciferous vegetable pests are one or more of the following: diamondback moth, cabbage caterpillar, fall armyworm, beet armyworm, and yellow striped flea beetle.

6. A synergist for enhancing the toxicity of Cry1Ac protoxin against cruciferous vegetable pests, wherein the cruciferous vegetable pests are one or more of the following: diamondback moth, cabbage caterpillar, fall armyworm, beet armyworm, sugar beet armyworm, and striped flea beetle, characterized in that... The synergist contains the Trypsin M-9 protein mutant as described in claim 1.

7. A formulation for controlling pests of cruciferous vegetables, wherein the cruciferous vegetable pests are one or more of the following: diamondback moth, cabbage caterpillar, fall armyworm, beet armyworm, sugar beet armyworm, and striped flea beetle, characterized in that... The formulation contains the Trypsin M-9 protein mutant and Cry1Ac protoxin as described in claim 1.

Citation Information

Patent Citations

  • Plutella xylostella trypsin-9 gene and application thereof

    CN111778267A

  • miR-283-3p of targeting Trypsin-9 gene and application of miR-283-3p

    CN112175946A