A BHK-21 cell line for promoting replication of picornavirus, construction method and application thereof

Abstract

The application belongs to the field of genetic engineering, and particularly relates to a BHK-21 cell line for promoting replication of viruses of the Picornaviridae family, a construction method and application. The application provides sgRNA which is specifically targeted to KLHL34, the sgRNA can be specifically targeted to the KLHL34 gene, and the sgRNA is combined with CRISPR-Cas9 technology to realize knockout of the KLHL34 gene in the BHK-21 cell line, and a monoclonal cell line obtained can significantly promote replication of viruses FMDV of the Picornaviridae family, and can improve the production amount and antigen yield of the FMDV vaccine, and can be used as a production cell line of the Picornaviridae virus vaccine, especially the FMDV vaccine, and has a wide application prospect.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering, specifically relating to a BHK-21 cell line that promotes the replication of microRNAviridae viruses, its construction method, and its application. Background Technology

[0002] Picomaviridae is the family of RNA viruses, comprising the smallest group of RNA viruses, mainly including genera such as Enterovirus, Rhinovirus, Cardivirus, and Oral Evovirus. Foot-and-mouth disease (FMD) is an acute, febrile, highly contagious animal disease caused by foot-and-mouth disease virus (FMDV), severely affecting cloven-hoofed animals such as pigs, cattle, and sheep. FMDV is a single-stranded positive-sense RNA virus belonging to the genus FMDV within the family Picomaviridae. It has seven serotypes: O, A, C, SAT1, SAT2, SAT3, and Asia1. There is no cross-immunity between serotypes, and even cross-immunity varies between different strains of the same serotype. Because its genome is single-stranded positive-sense RNA, it has high variability and easily generates new strains, resulting in vaccines not being able to completely cover the strains circulating in the field. This poses a significant challenge to the immunization and control of foot-and-mouth disease. Developing highly effective vaccines is currently the most effective measure to control this disease, and selecting cell lines that allow the virus to multiply efficiently is a prerequisite for preparing highly effective vaccines. Therefore, it is urgent to carry out relevant work.

[0003] CRISPR-Cas9 is an adaptive immune defense system developed by bacteria and archaea over long periods of evolution to combat invading viruses and foreign DNA. Based on this prokaryotic adaptive immune defense system, CRISPR-Cas9 gene editing technology was developed. This technology uses artificially designed sgRNA to recognize the target genomic sequence and guide the Cas9 protease to effectively cleave the DNA double strand, creating a double-strand break. Normally, cells use non-homologous end joining (NHEJ) or homology-directed repair (HDR) pathways to repair these breaks, achieving gene knockout and modification. The former often results in base insertion or deletion mismatches during repair, causing frameshift mutations that render the target gene nonfunctional, thus achieving specific gene knockout.

[0004] KLHL34It is a member of the Kelch-like (KLHL) gene family, encoding a group of proteins with a BTB / POZ domain, a BACK domain, and 5-6 Kelch motifs. Perez-Torrado et al. discussed how the BTB / POZ domain promotes binding with other proteins, and its function involves a variety of intracellular molecular mechanisms, including the control of cytoskeleton organization and the selection of ion channels. Mutations in certain KLHL genes can lead to Mendelian diseases or human cancers.

[0005] This invention first provides a specific target KLHL34 The sgRNA of the gene, which can specifically target KLHL34 Genes, combined with CRISPR-Cas9 technology, were implemented in BHK-21 cells. KLHL34 Gene knockout, obtained KLHL34 BHK-21- gene knockout monoclonal cell line KLHL34 -KO can significantly promote the replication of small RNA virus FMDV, increase the production volume and antigen yield of small RNA virus vaccines, and can be used as a production cell line for small RNA virus vaccines, with broad application prospects. Summary of the Invention

[0006] To address the above problems, the present invention first provides a specific targeting method. KLHL34 The sgRNA of the gene, which can specifically target KLHL34 Genes, combined with CRISPR-Cas9 technology, were implemented in BHK-21 cells. KLHL34 Gene knockout, obtained KLHL34 BHK-21- gene knockout monoclonal cell line KLHL34 -KO can significantly promote the replication of small RNA virus FMDV, increase the production volume and antigen yield of small RNA virus vaccines, and can be used as a production cell line for small RNA virus vaccines. Specifically, it includes the following: Firstly, the present invention provides a specific targeting KLHL34 The sgRNA of the gene, wherein the sgRNA includes sgRNA-1 and / or sgRNA-2; The target sequence of the sgRNA1 is: TGGTCACGCGGGTGCCGTTG; The target sequence of the sgRNA2 is: GGTGCCAACCCGTAACGTAG.

[0007] Preferably, sgRNA1 is a double-stranded fragment formed by annealing sgRNA1-F and sgRNA1-R; and sgRNA2 is a double-stranded fragment formed by annealing sgRNA2-F and sgRNA2-R. sgRNA1-F: 5'-CACCGTGGTCACGCGGGTGCCGTTG-3'; sgRNA1-R: 5'-AAACCAACGGCACCCGCGTGACCAC-3'; sgRNA2-F: 5'-CACCGGGTGCCAACCCGTAACGTAG-3'; sgRNA2-R: 5'-AAACCTACGTTACGGGTGGCACCC-3'.

[0008] Secondly, the present invention provides the sgRNA described in the first aspect for knockout KLHL34 Genes or in preparation KLHL34 Applications in gene knockout cell lines.

[0009] Thirdly, the present invention provides a method for knocking out KLHL34 Reagents or kits for gene sequencing, said reagents or kits comprising the sgRNA described in the first aspect above, or targeted knockout. KLHL34 Gene targeting vector; the targeted knockout KLHL34 The gene targeting vectors include the coding sequences of the sgRNA and Cas9 protein genes described in the first aspect above.

[0010] Fourthly, the present invention provides KLHL34 A method for constructing a cell line that encodes a loss-of-function protein, the method comprising: using a CRISPR / Cas9 system, knocking out the sgRNA described in the first aspect of the above-mentioned cell line... KLHL34 Gene.

[0011] Fifthly, the present invention provides KLHL34 A method for constructing a gene knockout BHK-21 cell line, wherein the method comprises: using a CRISPR / Cas9 system, knocking out the gene knockout BHK-21 in the BHK-21 cell line using the sgRNA described in the first aspect above. KLHL34 Gene.

[0012] Preferably, the method includes the following steps: (1) Preparation of the specific target described in the first aspect above KLHL34 sgRNA of a gene; (2) Anneal the sgRNA prepared in step (1) and ligate it into the PX459 plasmid to obtain a recombinant plasmid that simultaneously expresses the Cas9 protein gene and the targeting sgRNA sequence. (3) Transfect the recombinant plasmid prepared in step (2) into BHK-21 cells, and obtain the desired results using puromycin antibiotic selection and cell limiting dilution method. KLHL34BHK-21 cell line with gene function loss.

[0013] Sixthly, the present invention provides a method for constructing and obtaining [something] using the method described in the fifth aspect above. KLHL34 Gene knockout BHK-21 cell line.

[0014] In a seventh aspect, the present invention provides the provisions described in the sixth aspect above. KLHL34 Application of gene knockout BHK-21 cell line as a cell line for the production of microRNAviridae viruses or viral vaccines.

[0015] Preferably, the microRNAviridae virus is foot-and-mouth disease virus.

[0016] The beneficial effects of this invention are: ① This invention provides a targeted KLHL34 The sgRNA of the gene, which can specifically target KLHL34 Genes, combined with CRISPR-Cas9 technology, can be used in BHK-21 cells. KLHL34 Gene knockout is accurate and efficient; ② This invention provides a method for transfecting the sgRNA into BHK-21 cells using CRISPR-Cas9 technology to construct... KLHL34 Methods for establishing a BHK-21 cell line with loss of gene-encoded protein function; ③ Obtaining a monoclonal cell line BHK-21- according to the method described in this invention. KLHL34 -KO can significantly promote the replication of microRNAviridae virus FMDV, increase the production volume and antigen yield of microRNAviridae virus FMDV vaccines, and can be used as a production cell line for microRNAviridae virus or viral vaccines, with broad application prospects. Attached Figure Description

[0017] Figure 1 Targeted KLHL34 Schematic diagram of sgRNAs in a genomic region; Figure 2 BHK-21- KLHL34 -Analysis of gene deletion mutants in the KO-1 cell line; Figure 3 BHK-21- KLHL34 -Analysis of gene deletion mutants in the KO-2 cell line; Figure 4 Western blot analysis of the knockout cell line BHK-21- KLHL34 -KOs KLHL34 Protein level results for genes; Figure 5 KLHL34 BHK-21-, a gene function loss cell line KLHL34-KOs cell viability assay results; Figure 6 Relative quantitative detection of FMDV infection BHK-21- KLHL34 -WT and BHK-21- KLHL34 -Differences in mRNA levels of KOs at different time points; Figure 7 Western blot detection of FMDV in BHK-21- KLHL34 -WT and BHK-21- KLHL34 Differences in protein levels in KOs cells; Figure 8 FMDV at BHK-21- KLHL34 -Results of viral titer detection after proliferation in KOs cells. Detailed Implementation

[0018] To make the objectives, technical solutions, and advantages of this invention clearer, the various embodiments of this invention will be described in detail below with reference to the accompanying drawings. However, those skilled in the art will understand that many technical details have been provided in the embodiments of this invention to facilitate a better understanding of this application. However, the technical solutions claimed in this application can be implemented even without these technical details and various variations and modifications based on the following embodiments.

[0019] definition The term "loss of protein function" refers to the loss of function of a protein-encoded protein due to frameshift mutations caused by knocking out, mutating, or inserting a portion of the gene into a protein-encoded gene segment. This invention addresses this by targeting the host cell... KLHL34 Gene targeted knockout leads to KLHL34 The loss of function of the gene-encoded protein, thereby constructing KLHL34 The BHK-21 cell line, which encodes a loss-of-function protein, was used for the proliferation of FMDV. However, this invention is not limited to this. KLHL34 Gene knockout can also be achieved through other technical means to induce gene knockout in host cells BHK-21. KLHL34 The gene-encoded protein loses its function and is used to construct KLHL34 Cell lines whose gene-encoded proteins have lost their function.

[0020] The term "gene targeting" refers to targeted transgenic technology that uses site-specific homologous recombination of DNA to modify the genetic information of cells or organisms. This mainly includes gene knockout, gene inactivation, gene knock-in, point mutation, deletion mutation, and large-segment deletion of the chromosome. "Gene knockout" specifically refers to the inactivation or deletion of a particular target gene through a specific pathway. This invention utilizes gene knockout technology to inactivate or delete a specific target gene in the host cell BHK-21. KLHL34Due to knockout, the obtained KLHL34 Monoclonal cell lines encoding loss-of-function proteins can promote the proliferation of FMDV; this invention can also promote the proliferation of FMDV by affecting host cells BHK-21. KLHL34 Gene mutation, or insertion of gene fragments, leads to KLHL34 A frameshift mutation occurred in the gene-encoded protein, and a [missing information - likely a gene or structure] was successfully constructed. KLHL34 Monoclonal cell lines whose gene-encoded proteins have lost their function.

[0021] The term "sgRNA" stands for guide RNA, which refers to a small non-coding RNA that guides the insertion or deletion of uridine residues into the kinetoplastid during RNA editing.

[0022] This invention achieves the artificial synthesis of a target KLHL34 sgRNA of genes; this invention focuses on direct targeted splicing KLHL34 Based on the gene, CRISPR / Cas9 combined specific knockout KLHL34 Gene-based methods were employed, using BHK-21 host cells as an example. KLHL34 Gene( KLHL34 The amino acid sequence is shown in SEQ ID NO.1; the CDS sequence is shown in SEQ ID NO.2. Knockout provides a strategy for improving the production efficiency of FMDV vaccines. Although this invention only targets the host cell BHK-21... KLHL34 Gene knockout yielded a gene knockout host cell, but the method described in this invention can be extrapolated and extended to other animal cells. KLHL34 Gene knockout was used to construct gene knockout cell lines that enhance FMDV antigen production.

[0023] The CRISPR / Cas9 system's targeted gene recognition and cleavage are achieved by sgRNA and Cas9. sgRNA determines the targeting specificity and cleavage activity of Cas9. This invention aims to utilize CRISPR / Cas9 gene editing technology to screen genes in vitro and in vivo. KLHL34 The sgRNA sequence of the gene, to achieve KLHL34 Accurate and efficient gene knockout yields a gene capable of promoting FMDV antigen production. KLHL34 Gene knockout monoclonal cell lines provide a new strategy for the production of FMDV vaccines.

[0024] Using CRISPR / Cas9 gene editing technology, through targeted... KLHL34 The sgRNA of the gene guides the Cas9 protein to bind to KLHL34A specific sequence location of a gene cuts the DNA double helix, causing a double-strand break. Under the action of the cell's own repair mechanism, random mutations occur. Mutations such as the deletion or insertion of nucleotides will cause changes in the reading frame of the gene, ultimately achieving the purpose of losing the function of the gene-encoded protein and obtaining a cell line that has lost the function of the gene-encoded protein.

[0025] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent companies.

[0026] The materials used in the following examples are as follows: O / BY / CHA / 2010 was obtained from the National Foot-and-Mouth Disease Reference Laboratory of Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences; BHK-21 cells were provided by our laboratory and cultured in MEM medium containing 10% fetal bovine serum and 1% penicillin antibiotics; PX459 vector was kindly provided by Professor Wu Sen of China Agricultural University.

[0027] *E. coli* Trans5α competent cells, T4 DNA ligase, and TB Green II were purchased from Takara Bio Engineering (Dalian) Co., Ltd.; restriction endonuclease BbsI was purchased from NEB; plasmid extraction kit, Trizol reagent, and protein pre-staining marker were purchased from Invitrogen; gel extraction kit and micro DNA extraction kit were purchased from OMEGA; MEM cell culture medium and 0.25% EDTA trypsin were purchased from Gibco; fetal bovine serum (FBS) was purchased from Biological Industries (BI); Polyplus jetPRIME transfection reagent was purchased from Polyplus Transfection; Western antibody dilution buffer was purchased from Beyotime Biotechnology Co., Ltd.; 10×PCR buffer was purchased from Kangwei Century Biotechnology Co., Ltd.; rabbit anti-KLHL34 polyclonal antibody and mouse anti-β-Actin polyclonal antibody were purchased from Proteintech; horseradish peroxidase (HRP)-labeled goat anti-rabbit IgG antibody and HRP-labeled goat anti-mouse IgG antibody were purchased from Sigma-Aldrich (USA); type O FMDV The VP1 monoclonal antibody was prepared and preserved in our laboratory.

[0028] The following embodiments are described KLHL34 The gene CDS sequence is shown in SEQ ID NO.2, and the amino acid sequence is shown in SEQ ID NO.1.

[0029] Example 1 KLHL34 Construction of gene knockout BHK-21 cell line 1. KLHL34Construction of sgRNA recombinant plasmid Design of sgRNA targets: Searching for mouse sources in NCBI KLHL3 Four gene sequences were used, and sgRAN was designed based on the Zhang Feng lab website http: / / crispr.mit.edu / . KLHL34 Two sgRNA sequences, sgRNA1 and sgRNA2, were designed at positions 1995 and 2361 of the first exon region, respectively: The target sequence of the sgRNA1 is: TGGTCACGCGGGTGCCGTTG (shown in SEQ ID NO.3); the sgRNA1 is a double-stranded fragment formed by annealing sgRNA1-F (5'-CACCGTGGTCACGCGGGTGCCGTTG-3', shown in SEQ ID NO.4) and sgRNA1-R (5'-AAACCAACGGCACCCGCGTGACCAC-3', shown in SEQ ID NO.5); The target sequence of the sgRNA2 is: GGTGCCAACCCGTAACGTAG (SEQ ID NO. 6); the sgRNA2 is a double-stranded fragment formed by annealing sgRNA2-F (5'-CACCGGGTGCCAACCCGTAACGTAG-3', SEQ ID NO. 7) and sgRNA2-R (5'-AAACCTACGTTACGGGTTGGCACCC-3', SEQ ID NO. 8).

[0030] Annealing hybridization of sgRNA: After diluting the upstream and downstream sequence synthesis products of sgRNA to 100 μmol / L, take 22.5 μL of each upstream and downstream primer and add 10×PCR buffer, and anneal the total system of 50 μL at 99℃ for 5 min to form double strands of upstream and downstream primers. Enzymatic digestion of PX459 vector: PX459 vector was digested with restriction endonuclease BbsI. The reaction system consisted of 20 μL of 10×buffer, 5 μL of PX459 vector, 1 μL of BbsI, and 12 μL of ddH2O. The digestion was carried out at 37℃ for 4 h, and the digestion product was recovered by gel extraction. Ligation of the digested vector with sgRNA: Prepare a 10 μL ligation reaction system, which contains 1 μL of 10×T4 ligase buffer, 2 μL of PX459 digested fragment, 6 μL of annealed sgRNA, and 1 μL of T4 ligase. Incubate at 16℃ for 2 h. PX459-sgRNA ligation product transformation: The ligation product was transformed into Trans5α competent cells, plated on LB solid culture dishes containing Amp, and incubated overnight at 37°C. After colonies were picked and shaken, plasmids were extracted and sequenced. The sequencing results were compared with the target gene sequence using MegAlign software, successfully constructing a targeted plasmid. KLHL34 Recombinant plasmids containing sgRNAs from different exons of the gene, including their location and sequence information, are as follows: Figure 1 The recombinant plasmids were named PX459- KLHL34 -sgRNA-1, PX459- KLHL34 -sgRNA-2.

[0031] 2. Cell transfection and selection Following the procedures of the jetPRIME transfection reagent, 2 μg of PX459-KLHL34-sgRNA recombinant plasmid was transfected into BHK-21 cells cultured in 6-well plates, and the cell culture plates were placed in a 37°C, 5% CO2 incubator for 24 h.

[0032] To eliminate a large number of sgRNA-negative cells, 24 hours after transfection, cells were digested and passaged with puromycin at a final concentration of 3 μg / mL. The cells were then cultured and selected under pressure at 37°C with 5% CO2 for 3 days, after which the culture medium was replaced to allow positive cells to grow normally. Cells selected under pressure were digested and counted, then diluted to 10 cells / mL with MEM complete medium. The diluted cell suspension was added to 96-well plates at 0.1 mL / well (1 cell per well). The cell culture plates were incubated at 37°C with 5% CO2 for 5-7 days. Wells with binary or polyclonal cells were discarded, and wells with single clones and healthy cells were marked and passaged to 48-well plates for further culture. Once the cells reached confluence, they were subsequently passaged to 12-well and 6-well plates for expansion culture.

[0033] 3. Sequencing and identification of monoclonal cell lines Wild-type cells and individual cell lines to be identified were collected, and DNA was extracted separately according to the instructions of the microDNA extraction kit. Fragments containing sgRNA target sites were amplified using KLHL34 identification primers (check-F: 5'-CCAGACCCGCATCTTGCTGATT-3' (SEQ ID NO. 9), check-R: 5'-CCCACCTTCCTCCAGCTGCAGC-3' (SEQ ID NO. 10)). After 1% agarose gel electrophoresis, the amplified products were recovered and sequenced. Sequence analysis of the sequencing results of the amplified products from the individual cell lines to be identified and the wild-type cell lines revealed the cell lines with frameshift mutations due to base insertions or deletions, as well as the cell lines with no base changes during sequence alignment. These were labeled as BHK-21- KLHL34 -KO and BHK-21- KLHL34 -WT.

[0034] The sequencing results were compared and analyzed with the target gene sequence, and the results are as follows: Figure 2 and 3 As shown, BHK-21- KLHL34 -KO1 has a one-base deletion at the 1995 predetermined cleavage site in exon 1 of Cas9 (between the 4th and 5th bases of the PAM motif (GGG)); BHK-21- KLHL34 -KO2 has a 7-base deletion at the predetermined cleavage site 2361 of exon 1 (between the 4th and 5th bases of the PAM motif (TGG)).

[0035] 4. Western blot analysis Protein level identification is used KLHL34 The protein expression level of KLHL34 was detected by Western blot using an antibody (Cat No. 21981-1-AP). The results are as follows: Figure 4 As shown, BHK-21- KLHL34 -KO1 and BHK-21- KLHL34 - KO2 cell lines were not detected. KLHL34 The above results indicate that the protein expression... KLHL34 The gene knockout BHK-21 cell line was successfully constructed and named BHK-21- KLHL34 -KO1 and BHK-21- KLHL34 -KO2.

[0036] Example 2 KLHL34 Viability assay of gene knockout BHK-21 cell lines Wild type and KLHL34Gene knockout cells were digested, and the cell suspension density was adjusted to 1-2 × 10⁻⁶. 5 Cells / mL were seeded into 96-well cell culture plates at 100 μL / well and incubated at 37°C in a 5% CO2 cell culture incubator for 5 h. 10 μL of CCK-8 solution was added to each well and the culture plate was incubated for another 3 h. The absorbance at 450 nm was measured using a microplate reader, and the data were analyzed.

[0037] The results are as follows Figure 5 As shown, KLHL34 BHK-21 gene knockout cell line BHK-21- KLHL34 -KO1 and BHK-21- KLHL34 -KO2 cells showed the same cell viability as normal BHK-21 cells, indicating that... KLHL34 Gene knockout does not affect the normal growth of the host cell.

[0038] Example 3 FMDV in BHK-21- KLHL34 Replication in KOs cell lines 1. Cellular infection Retrieve successfully constructed KLHL34 Knockout BHK-21 cell line (BHK-21- KLHL34 -KO1、BHK-21- KLHL34 -KO2) and control cell lines (BHK-21 cell line transfected with PX459 empty vector, BHK-21- KLHL34 -WT) When the cells reached approximately 80% confluence in 35 mm cell culture dishes, the culture medium was discarded, and the cells were washed twice with 1 mL of PBS. The cells were then incubated for 1 hour with foot-and-mouth disease virus O / BY / CHA / 2010 at an MOI of 0.1. The virus solution was then aspirated, and the cells were washed twice with 1 mL of PBS. 2 mL of MEM culture medium was added. The cells were then cultured in a cell culture incubator, and samples were collected at different time points post-infection. RT-qPCR, Western blot, and TCID assays were performed. 50 Different methods were used to comprehensively evaluate the replication status of foot-and-mouth disease virus.

[0039] 2. Real-time quantitative PCR detection of viral replication level Cells were collected at different time points after FMDV infection. Total RNA was extracted according to the Trizol lysis method instructions. After the concentration was determined, cDNA was obtained by reverse transcription using a reverse transcription kit. A 20 μL premixed reaction system was prepared using an Mx3005P-QPCR system (Agilent Technologies, USA) and 10 μL of TB Green II Premix Ex Taq, 0.5 μL each of forward and reverse primers (FMDV-3D-F: CACTGGTGACAGGCTAAGG, SEQ ID NO. 11; FMDV-3D-R: CCCTTCTCAGATTCCGAGT, SEQ ID NO. 12), 1 μL of cDNA, and 8 μL of ddH2O. The reaction was performed using a 40-cycle incubation period: 95℃ for 2 min, 95℃ for 10 s, and 60℃ for 30 s (fluorescence collection). GAPDH was used as an internal reference gene to quantify the mRNA level of FMDV. All experiments were performed in triplicate. -△△CT Methods for analyzing data.

[0040] The results are as follows Figure 6 As shown, at different time points after FMDV infection, BHK-21- KLHL34 The mRNA levels of FMDV in KO cells were significantly higher than those in control cells BHK-21. KLHL34 -WT, Explanation KLHL34 BHK-21-, a gene loss-of-function monoclonal cell line KLHL34 -KOs can significantly promote the replication of FMDV.

[0041] 3. Western blot analysis of viral protein expression BHK-21-KLHL34-KO and BHK-21-KLHL34-WT cells were cultured in 35 mm cell culture dishes and infected with the virus as described above. Cell samples were collected after cytopathic effects, and 200 μL of cell lysis buffer (Pierce) was added to the collected cell samples. After complete cell lysis, the cells were centrifuged to remove cell debris, and the supernatant was collected. Total protein was quantified using a BCA protein quantification kit (Thermo). The remaining fraction was mixed with one-quarter volume of 4× loading buffer, boiled for 5 min, and then allowed to cool at room temperature. The loading volume was determined based on the quantification results, and the loading amount was generally 20-40 μg. After SDS-PAGE electrophoresis, the protein samples were transferred to an NC membrane and transferred at a constant voltage of 100V for 1.5 h in an ice bath. The membrane was blocked with 5% skim milk powder for 1 h. Rabbit anti-KLHL34 antibody, FMDV VP1 monoclonal antibody, and mouse anti-β-Actin antibody were used as primary antibodies and incubated overnight at 4°C. The corresponding HRP-labeled secondary antibodies were incubated at room temperature for 1 h. Protein detection was performed using a colorimetric kit from Thermo Fisher Scientific (Pierce). TM ECL Western Blotting Substrate), images were scanned using ImageLab 4.1 (BIO-RAD).

[0042] The results are as follows Figure 7 The results showed that after FMDV infection, the abundance of the foot-and-mouth disease virus structural protein VP1 in BHK-21-KLHL34-KO cells was significantly higher than that in control BHK-21-KLHL34-WT cells. KLHL34 BHK-21-, a gene loss-of-function monoclonal cell line KLHL34 -KOs can significantly promote the replication of FMDV.

[0043] 4. Virus titer TCID 50 Measurement FMDV was used to infect BHK-21- KLHL34 -KO and BHK-21- KLHL34 -WT cells were collected with viral fluid at different time points. After three freeze-thaw cycles, the supernatant was collected by centrifugation. The test samples were serially diluted 10-fold with serum-free MEM medium. Each dilution of viral fluid was seeded into 96-well plates containing a monolayer of BHK-21 cells, with 8 wells per dilution (100 μL / well). The plates were incubated at 37°C in a 5% CO2 cell culture incubator for 3 days. Cytopathic effect (CPE) was observed and recorded during this period. TCID was calculated using the Reed-Muench method. 50 And analyze.

[0044] The results are as follows Figure 8 As shown, BHK-21- KLHL34-KO cells infected at different time points all showed significantly higher viral titers than control wild-type cells, indicating that knockout cells... KLHL34 This can then significantly promote FMDV replication.

[0045] The above results indicate that KLHL34 Gene knockout BHK-21 cell lines can significantly promote the replication of micronvirus FMDV, and can be used for the production of micronvirus vaccines.

Claims

1. KLHL34 Application of gene knockout BHK-21 cell line in the preparation of cell lines for foot-and-mouth disease virus vaccine production.

2. The application as described in claim 1, characterized in that, The KLHL34 The method for constructing the gene knockout BHK-21 cell line is as follows: using the CRISPR / Cas9 system, sgRNA is used to knock out the gene knockout gene in the BHK-21 cell line. KLHL34 Gene; the sgRNA includes sgRNA1 and / or sgRNA2; The target sequence of the sgRNA1 is: TGGTCACGCGGGTGCCGTTG; The target sequence of the sgRNA2 is: GGTGCCAACCCGTAACGTAG.

3. The application as described in claim 2, characterized in that, The sgRNA1 is a double-stranded fragment formed by annealing sgRNA1-F and sgRNA1-R; the sgRNA2 is a double-stranded fragment formed by annealing sgRNA2-F and sgRNA2-R. sgRNA1-F: 5'-CACCGTGGTCACGCGGGTGCCGTTG-3'; sgRNA1-R: 5'-AAACCAACGGCACCCGCGTGACCAC-3'; sgRNA2-F: 5'-CACCGGGTGCCAACCCGTAACGTAG-3'; sgRNA2-R: 5'-AAACCTACGTTACGGGTGGCACCC-3'.

4. The application as described in claim 3, characterized in that, The method comprises the following steps: (1) Preparation of specific targets KLHL34 sgRNA of a gene; (2) Anneal the sgRNA prepared in step (1) and ligate it into the PX459 plasmid to obtain a recombinant plasmid that simultaneously expresses the Cas9 protein gene and the targeting sgRNA sequence. (3) Transfect the recombinant plasmid prepared in step (2) into BHK-21 cells, and obtain the desired plasmids by screening with puromycin antibiotic and using the cell limiting dilution method. KLHL34 BHK-21 cell line with gene function loss.

Images