A method for constructing long-day early heading and short-day late heading maize and application thereof

By knocking out the SiPRR37 protein in millet using the CRISPR/Cas9 gene editing system, the heading time of millet was regulated to be earlier under long-day conditions and later under short-day conditions, thus solving the problem of regulating the heading time of millet and improving regional adaptability and yield.

CN116355949BActive Publication Date: 2026-07-31INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
Filing Date
2023-04-11
Publication Date
2026-07-31

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively regulate the heading stage of millet, resulting in insufficient utilization of light and heat resources or insufficient grain filling in specific ecological zones, which affects yield and quality and lacks regional adaptability.

Method used

By knocking out or inhibiting the activity or expression of the SiPRR37 protein in millet using the CRISPR/Cas9 gene editing system, the heading of millet can be regulated to be earlier under long-day conditions and later under short-day conditions, thus achieving the characteristics of early heading under long-day conditions and late heading under short-day conditions.

Benefits of technology

Successfully regulating the heading stage of millet improves its regional adaptability under different photoperiod conditions, ensuring food security and yield, and avoiding yield loss under low temperature conditions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0004171856500000011
    Figure HDA0004171856500000011
  • Figure HDA0004171856500000012
    Figure HDA0004171856500000012
  • Figure HDA0004171856500000021
    Figure HDA0004171856500000021
Patent Text Reader

Abstract

This invention discloses a method for constructing long-day, early-heading millet and its application. By knocking out the SiPRR37 gene in millet using CRISPR / Cas9 gene editing technology, this invention found that the SiPRR37 knockout mutant can advance millet heading under long-day conditions and delay heading under short-day conditions, successfully improving the heading period of the target plant. Targeted knockout of the millet heading period gene SiPRR37 using CRISPR / Cas9 gene editing technology can achieve early heading in millet varieties in long-day regions of northern China, avoiding frost and other low-temperature conditions for stable yields, while delaying heading in millet varieties in short-day regions of southern China to achieve high yields.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a method for constructing long-day, early-heading and short-day, late-heading millet and its application. Background Technology

[0002] After being hulled, millet becomes foxtail millet. Its domestication and cultivation history can be traced back 10,000 years. Due to its excellent drought resistance and tolerance to poor soil, it is considered a cereal crop with sustainable development potential and is currently a widely cultivated food crop in arid and semi-arid lands such as China, India, and Africa. The heading period is one of the important agronomic traits of millet, and its length determines its regional adaptability. Elucidating the genetic basis of millet heading period and cloning and functionally verifying key genes regulating millet heading period are of great significance for the genetic improvement of millet and other cereal crops.

[0003] Millet originated in the Yellow River basin of China and is a short-day plant sensitive to photoperiod. Through natural selection, domestication, and genetic improvement, it has developed various ecological types adapted to different photoperiod conditions. Appropriate heading time is crucial for millet reproduction and high yield. If a variety heads too early in a specific ecological zone, it will lead to insufficient utilization of light and heat resources, resulting in decreased yield and quality; if it heads too late, changes in the external light and temperature environment will cause insufficient grain filling, also leading to a decrease in yield. Typically, a single variety can only adapt to a specific ecological zone, achieving high and stable yields by completing heading at the appropriate time. While some progress has been made in the genetic analysis of millet heading time, functional studies of genes related to millet heading time are urgently needed. Based on this, genetic improvement of millet heading time can enhance the regional adaptability of varieties and is of great significance for ensuring food security. Summary of the Invention

[0004] The technical problem this invention aims to solve is how to regulate the heading period of millet in order to improve the regional adaptability of millet varieties and ensure food security.

[0005] In a first aspect, the present invention protects a method for constructing long-day, early-heading millet and short-day, late-heading millet.

[0006] The method for constructing long-day, early-heading, short-day, late-heading millet protected by this invention includes the following steps: inhibiting the activity of SiPRR37 protein in recipient millet, or inhibiting the expression of the gene encoding SiPRR37 protein in recipient millet, or knocking out the gene encoding SiPRR37 protein in recipient millet, to obtain transgenic millet; under long-day conditions, the transgenic millet heads earlier than the recipient millet; under short-day conditions, the transgenic millet heads later than the recipient millet.

[0007] Furthermore, the gene encoding the SiPRR37 protein in the recipient millet was knocked out using the CRISPR / Cas9 gene editing system.

[0008] Furthermore, the CRISPR / Cas9 gene editing system includes an sgRNA that targets the gene encoding the SiPRR37 protein; the target sequence of the sgRNA is specifically shown in Sequence 4.

[0009] Secondly, the present invention protects another method for constructing long-day early-heading and short-day late-heading millet, comprising the following steps: replacing “CCTGCTACGTCACTGCATGTACG” or “ATGTACG” in the SiPRR37 gene on the millet genomic DNA to obtain long-day early-heading and short-day late-heading millet.

[0010] Thirdly, this invention protects novel uses of the SiPRR37 protein or related biomaterials.

[0011] This invention protects the application of SiPRR37 protein or related biological materials in regulating the heading stage of millet; the regulation is manifested as inhibiting millet heading under long-day conditions and promoting millet heading under short-day conditions.

[0012] The relevant biological materials are genes encoding the SiPRR37 protein or expression cassettes, recombinant vectors, or recombinant microorganisms containing the gene.

[0013] The expression cassette refers to DNA capable of expressing the SiPRR37 protein in host cells. This DNA may include not only a promoter to initiate SiPRR37 transcription but also a terminator to terminate SiPRR37 transcription. Furthermore, the expression cassette may also include an enhancer sequence.

[0014] The vector can be a plasmid, granule, bacteriophage, or viral vector. To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector can be processed, such as by adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color changes (GUS gene, luciferase gene, etc.), antibiotic resistance markers (gentamicin markers, kanamycin markers, etc.), or chemical reagent resistance marker genes (such as herbicide resistance genes).

[0015] The recombinant microorganism may be yeast, bacteria, algae, or fungi containing a gene encoding the SiPRR37 protein, or the aforementioned expression cassette or recombinant vector. Specifically, the bacteria may be Agrobacterium.

[0016] Fourthly, the present invention protects novel uses of substances that inhibit the activity of SiPRR37 protein, substances that inhibit the expression of genes encoding SiPRR37 protein, or substances that knock out genes encoding SiPRR37 protein.

[0017] This invention protects the application of substances that inhibit the activity of SiPRR37 protein, substances that inhibit the expression of genes encoding SiPRR37 protein, or substances that knock out genes encoding SiPRR37 protein in the cultivation of long-day, early-heading, and short-day, late-heading millet.

[0018] The substance that inhibits the activity of SiPRR37 protein can be any substance that can cause the loss of SiPRR37 protein activity in millet, such as proteins, peptides, or small molecule compounds (e.g., protein activity inhibitors) that inhibit SiPRR37 protein synthesis, promote SiPRR37 protein degradation, or inhibit SiPRR37 protein function.

[0019] The substance that inhibits the expression of the gene encoding SiPRR37 protein can be any substance that prevents the gene encoding SiPRR37 protein in millet from being expressed, such as substances that silence the gene encoding SiPRR37 protein in millet (e.g., miRNA, siRNA, dsRNA, shRNA, etc.).

[0020] Knockout means that the host cell carrying the knockout substance does not produce the functional protein product of the gene. The knockout substance can be any substance that prevents the host cell from producing the functional protein product of the gene, such as removing all or part of the coding gene sequence, introducing frameshift mutations to prevent the production of functional proteins, removing or altering regulatory components (e.g., promoter editing) to prevent the coding gene sequence from being transcribed, or blocking translation by binding to mRNA. Typically, knockout is performed at the genomic DNA level, so that the cell's offspring also permanently carry the knockout. The substance that knocks out the gene encoding the SiPRR37 protein can be any substance that can mutate the gene encoding the SiPRR37 protein in millet (the mutation can be a deletion mutation and / or an insertion mutation and / or a base substitution) and thus render it inactive, such as the zinc finger protein ZFN gene editing system, the TALENs gene editing system, or the CRISPR / Cas9 gene editing system.

[0021] Furthermore, the substance used to knock out the gene encoding the SiPRR37 protein is the CRISPR / Cas9 gene editing system.

[0022] Furthermore, the CRISPR / Cas9 gene editing system includes an sgRNA that targets the gene encoding the SiPRR37 protein; the target sequence of the sgRNA is specifically shown in Sequence 4.

[0023] Fifthly, the present invention protects any of the following substances:

[0024] (1) An sgRNA, the target sequence of which is shown in Sequence 4;

[0025] (2) A CRISPR / Cas9 system for editing the SiPRR37 gene, the CRISPR / Cas9 system comprising the sgRNA and Cas9 nuclease described in (1).

[0026] The application of any of the above-mentioned substances in the construction of long-day, early-heading and short-day, late-heading millet is also within the scope of protection of this invention.

[0027] In any of the methods or applications described above, the SiPRR37 protein is any one of the proteins described in (a1)-(a4) below:

[0028] (a1) The protein shown in sequence 1 of the sequence listing;

[0029] (a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein described in (a1);

[0030] (a3) A protein related to millet heading obtained by substituting and / or deleting and / or adding one or more amino acid residues of (a1);

[0031] (a4) is a protein that shares more than 98% identity with (a1) and is associated with millet heading.

[0032] In the protein described in (a2) above, the tag refers to a polypeptide or protein fused with the target protein using in vitro DNA recombination technology for expression, detection, tracing, and / or purification of the target protein. The tag may be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.

[0033] In the protein described in (a3) ​​above, the substitution and / or deletion and / or addition of one or more amino acid residues is as follows: substitution and / or deletion and / or addition of no more than 10 amino acid residues, or substitution and / or deletion and / or addition of no more than 9 amino acid residues, or substitution and / or deletion and / or addition of no more than 8 amino acid residues, or substitution and / or deletion and / or addition of no more than 7 amino acid residues, or substitution and / or deletion and / or addition of no more than 6 amino acid residues, or substitution and / or deletion and / or addition of no more than 5 amino acid residues, or substitution and / or deletion and / or addition of no more than 4 amino acid residues, or substitution and / or deletion and / or addition of no more than 3 amino acid residues, or substitution and / or deletion and / or addition of no more than 2 amino acid residues, or substitution and / or deletion and / or addition of no more than 1 amino acid residue.

[0034] In the protein described in (a4) above, the identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, by using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambdaratio to 11, 1, and 0.85 (default values) respectively, and performing a search for the identity of a pair of amino acid sequences to calculate the identity value (%), the result can be obtained.

[0035] The proteins described in (a1)-(a4) above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0036] In any of the methods or applications described above, the SiPRR37 gene or the gene encoding the SiPRR37 protein is a DNA molecule as described in either (b1) or (b2) below:

[0037] (b1) The DNA molecule shown in sequence 2 or sequence 3 in the sequence listing;

[0038] (b2) is a DNA molecule that has more than 75% identity with (b1) and encodes the protein.

[0039] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or higher, 80% or higher, 85% or higher, 90% or higher, or 95% or higher identity with the nucleotide sequence of a protein constituting the amino acid sequence shown in Sequence 1 of this invention. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0040] In any of the methods or applications described above, long daylight hours refer to an average daylight duration from emergence to heading that is greater than 14.3 hours; short daylight hours refer to an average daylight duration from emergence to heading that is less than 14.3 hours.

[0041] In any of the methods or applications described above, the specific variety of millet may be wild-type millet Ci846.

[0042] This invention utilizes CRISPR / Cas9 gene editing technology to knock out the SiPRR37 gene in millet. The results show that the SiPRR37 knockout mutant can advance millet heading under long-day conditions and delay heading under short-day conditions, successfully improving the heading period of the target plant. Targeted knockout of the millet heading period gene SiPRR37 using CRISPR / Cas9 gene editing technology can achieve early heading in millet varieties in long-day regions of northern China, avoiding frost and other low-temperature conditions for stable yields, while delaying heading in millet varieties in short-day regions of southern China to achieve high yields. Attached Figure Description

[0043] Figure 1 Expression analysis of SiPRR37 at different time points and in different tissues. SiCULLIN was used as an internal reference gene; the final expression level was the mean ± standard deviation of three biological replicates.

[0044] Figure 2 For the rhythmic expression analysis of SiPRR37, SiCULLIN was used as an internal reference gene; the final expression level was the mean ± standard deviation of three biological replicates.

[0045] Figure 3 This is a CRISPR / Cas9-mediated homozygous site-directed mutant of SiPRR37. (a) SiPRR37 gene structure and the CRISPR / Cas9 target site in exon 1. Gray boxes indicate untranslated regions, black lines represent introns, and black boxes represent exons. Underlined nucleotide sequences indicate the target sequence (named SiPRR37-CP). Red highlighted nucleotide sequences indicate PAM sequences. (b) Sequences of wild-type millet variety Ci846 and its mutant at the SiPRR37-CP target site. Underlines indicate insertions, and dashes indicate deletions. (c) Sequencing peaks at the SiPRR37-CP target sequence location in wild-type millet variety Ci846 and its mutant. Red arrows indicate mutation locations.

[0046] Figure 4 The heading phenotype and heading date of the CRISPR / Cas9-mediated Siprr37 mutant under staggered sowing conditions in Beijing. (a) and (b) show the heading phenotype and heading date of the wild-type and homozygous Siprr37 mutants under May 20th sowing conditions. (c) and (d) show the heading phenotype and heading date of the wild-type and homozygous Siprr37 mutants under July 20th sowing conditions.

[0047] Figure 5The heading dates of CRISPR / Cas9-mediated Siprr37 mutants at different latitudes are shown in the following figures: (a) Heading date of wild-type and homozygous Siprr37 mutants in Heihe (emergence date: May 31). (b) Heading date of wild-type and homozygous Siprr37 mutants in Beijing (emergence date: June 25). (c) Heading date of wild-type and homozygous Siprr37 mutants in Anyang (emergence date: June 30). (d) Heading date of wild-type and homozygous Siprr37 mutants in Sanya (emergence date: December 28). Detailed Implementation

[0048] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0049] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0050] The pYLsgRNA-OSU6a and PYLCRISPR / Cas9Pubi-H in the following examples are both described in the literature “A Robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants, Ma et al., 2015, Molecular Plant”.

[0051] Example 1: Expression Analysis of SiPRR37

[0052] I. Expression analysis of SiPRR37 in different tissues at different time points

[0053] Using wild-type millet Ci846 as material, the expression of SiPRR37 in roots, stems, leaves and ears was analyzed at the jointing stage, booting stage and heading stage.

[0054] The results are as follows Figure 1 As shown in the figure. The results indicate that SiPRR37 is expressed in different parts of the plant, with the highest expression level in leaves at different stages. The expression level of SiPRR37 in leaves gradually decreases, suggesting that this gene may play a major role in the early heading stage.

[0055] II. Analysis of SiPRR37 rhythmic expression

[0056] SiPRR37 is mainly expressed in leaves. To further investigate the diurnal expression pattern of this gene in leaves, the specific steps are as follows: Using millet Ci846 as material, long-day treatment of 14 hours of light / 10 hours of darkness and short-day treatment of 10 hours of light / 14 hours of darkness were carried out respectively. The material was collected on the 4th day after treatment, and the 24-hour diurnal expression rhythm of SiPRR37 under different photoperiod treatments was analyzed.

[0057] The results are as follows Figure 2 As shown in the figure. The results indicate that regardless of the long or short day treatment, the expression of this gene has only one peak per day, which occurs 8 hours after exposure to light, suggesting that SiPRR37 expression may be regulated by the biological clock.

[0058] Example 2: Construction and phenotypic analysis of SiPRR37 knockout millet

[0059] I. Construction of SiPRR37 knockout millet

[0060] To further explore the function of SiPRR37, SiPRR37 was knocked out at specific sites using the CRISPR / Cas9 gene editing system.

[0061] 1. Design of SiPRR37 knockout target

[0062] For the first exon of SiPRR37, suitable sgRNA target sequences were designed and screened using the online design software CRISPR-P 2.0 (http: / / crispr.hzau.edu.cn / CRISPR2 / ) (Lei et al.2014; Liu et al.2017). The final target sequence SiPRR37-CP obtained by screening is as follows: CCTGCTACGTCACTGCATGTACG (Sequence 4).

[0063] 2. Construction of SiPRR37 knockout vector

[0064] The plasmids used for constructing the knockout vector were pYLsgRNA-OSU6a and PYLCRISPR / Cas9Pubi-H. The specific steps are as follows:

[0065] 1) Obtain the target fragment containing the target sequence for infusion ligation.

[0066] First round of PCR: Using 2-5 ng pYLsgRNA-OSU6a plasmid as a template, PCR amplification was performed with primers 5'-CTCCGTTTTACCTGTGGAATCG-3' and 5'-CGGAGGAAAATTCCATCCAC-3' (0.2 μM each), and 5'-CGTACATGCAGTGACGTAGCgttttagagctagaaat-3' and 5'-GCTACGTCACTGCATGTACGcggcagccaagccagca-3' (0.1 μM each) to obtain PCR products containing the target site. The PCR program was: 94℃ for 2 min; 98℃ for 10 s, 60℃ for 30 s, 68℃ for 20 s, 25-28 cycles; 68℃ for 5 min.

[0067] Second round PCR: Dilute the first round PCR product 10-fold, take 1 μL as a template, and use 5'-ACCGGTAAGGCGCGCCGTAGTGCTCGACTAGTATGGAATCGGCAGCAAAGG-3' and

[0068] Using 5'-TAGCTCGAGAGGCGCGCCAATGATACCGACGCGTATCCATCCACTCCAAGCTC TTG-3' as primers, PCR amplification was performed. The PCR program was: 94℃ for 2 min; 98℃ for 10 s, 60℃ for 30 s, 68℃ for 20 s, 25-28 cycles; 68℃ for 5 min. Electrophoresis detection after amplification showed the target band to be approximately 700 bp in size. The target fragment was then purified by gel extraction.

[0069] 2) Construction of SiPRR37 knockout vector

[0070] The PYLCRISPR / Cas9Pubi-H vector was digested with Bsa I-HF at 37°C for 4 hours. Following digestion, agarose gel electrophoresis was performed, and the excised vector bands were recovered and purified. The purified digested vector was ligated with the second-round PCR product using infusion ligase at 37°C for 15 minutes followed by 50°C for 15 minutes. The ligation product was transformed into competent *E. coli* cells, plated on solid LB medium containing kanamycin (Kan), and cultured overnight. Single colonies were picked and identified by sequencing using primers 5'-GTGGTGATAAGCGTCCTG-3' and 5'-AAGGCGATTAAGTTGGGT-3', ultimately yielding the SiPRR37 knockout vector.

[0071] Sequencing results show that the SiPRR37 knockout vector is obtained by ligating the fusion sequence of pYLsgRNA-OsU6a and SiPRR37-CP shown in sequence 5 to the Bsa I-HF restriction site of the PYLCRISPR / Cas9Pubi-H vector, while keeping the other sequences of the PYLCRISPR / Cas9Pubi-H vector unchanged.

[0072] 3. Obtaining and identifying SiPRR37 knockout millet

[0073] The correctly sequenced SiPRR37 knockout vector was introduced into Agrobacterium EHA105 to obtain recombinant bacteria; wild-type millet Ci846 embryo callus without transposon insertion in the SiPRR37 gene was transformed using Agrobacterium-mediated genetic transformation to obtain T0 generation transgenic plants.

[0074] DNA analysis of T0 generation transgenic plants was performed using primers 5'-TGTTTGCGTGCAGAGGTTTC-3' and 5'-GACCAGGCATACGGTAGACA-3' to determine the editing method. T1 generation seeds were obtained and sown in a greenhouse. The T1 generation transgenic plants were amplified and sequenced again to detect whether the editing method was stably inherited and whether the editing sites in the plants were homozygous. Finally, two homozygous edited lines of millet with SiPRR37 knockout (i.e., the mutations on both chromosomes were the same) were obtained and named Siprr37+A and Siprr37-16bp, respectively.

[0075] Compared to wild-type millet Ci846, the only difference in Siprr37+A is the insertion of a single base A in the gene encoding the SiPRR37 protein. This A insertion is located between positions 1258 and 1259 of sequence 2 (corresponding to positions 303 and 304 of sequence 3). This A insertion results in a frameshift mutation, causing premature termination of SiPRR37 protein translation.

[0076] Compared to wild-type millet Ci846, the only difference in SiPRR37-16bp is the deletion of a 16bp segment in the gene encoding the SiPRR37 protein. This 16bp deletion is located at positions 1252-1267 of sequence 2 (corresponding to positions 297-312 of sequence 3). This 16bp deletion leads to a frameshift mutation, which causes premature termination of SiPRR37 protein translation.

[0077] The sequence alignment diagram of wild-type millet Ci846 and SiPRR37 knockout homozygous edited lines Siprr37+A and Siprr37-16bp is shown below. Figure 3 As shown in (b).

[0078] II. Phenotypic Analysis of SiPRR37 Knockout Millet

[0079] 1. To investigate the function of SiPRR37, wild-type millet Ci846, SiPRR37 knockout homozygous edited lines Siprr37+A and Siprr37-16bp were sown in Beijing (116°18′N, 39°57′E) in two phases (May 20 and July 20), and the time from emergence to heading was recorded.

[0080] The results showed that, under the condition of sowing on May 20, the mutants Siprr37-16bp and Siprr37+A significantly advanced the heading date by 1.3 days and 4.4 days, respectively, compared with the WT mutant. Figure 4 (a) and (b)); Under the condition of sowing on July 20, the mutants Siprr37-16bp and Siprr37+A were significantly delayed in heading by 5.7 days and 5.4 days, respectively, compared with the WT. Figure 4 (c) and (d)). These results demonstrate that SiPRR37 inhibits millet heading under relatively long-day conditions while promoting it under short-day conditions. The mean day length from emergence to heading was 14.9 h (sown on May 20) and 13.9 h (sown on July 20) for the two sowing conditions, respectively, suggesting that the critical day length for SiPRR37 functional reversal may be between 13.9 h and 14.9 h.

[0081] 2. To further investigate the critical day length for SiPRR37 functional reversal, during the natural growing season, wild-type millet Ci846, SiPRR37 knockout homozygous edited lines Siprr37+A and Siprr37-16bp were sown in Heihe City (127°30′N, 50°15′E), Beijing (116°18′N, 39°57′E), Anyang City (114°21′N, 36°7′E), and Sanya City (109°45′N, 18°24′E), respectively, and the time from emergence to heading was recorded.

[0082] The results showed that in Heihe and Beijing, the heading dates of the mutants Siprr37-16bp and Siprr37+A were significantly earlier than those of the WT mutants by 5.9 days and 7.1 days (Heihe, Fig. 5a) and 3.1 days (Beijing, Fig. 5b) respectively. In Anyang, there were no significant differences among the three mutants, with the heading dates of WT, Siprr37-16bp, and Siprr37+A being 31.6±0.6, 32.2±0.9, and 30.8±1.2 days respectively (Fig. 5c). In Hainan, the heading dates of the mutants Siprr37-16bp and Siprr37+A were significantly delayed by 7.4 days and 8.0 days respectively (Fig. 5d). The average sunshine duration from emergence to heading in Heihe, Beijing, Anyang, and Sanya was 16.1 h, 14.6 h, 14.3 h, and 11.2 h, respectively. Therefore, the critical day length for SiPRR37 functional reversal is approximately 14.3 hours.

[0083] In summary, the study results indicate that SiPRR37 function is bidirectional, inhibiting millet heading under relatively long-day conditions and promoting millet heading under relatively short-day conditions. The critical day length for SiPRR37 function reversal is approximately 14.3 hours.

[0084] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. A method for constructing a long-day, early-heading, short-day, late-heading millet, comprising the following steps: inhibiting the expression of the gene encoding SiPRR37 protein in the recipient millet, or knocking out the gene encoding SiPRR37 protein in the recipient millet, to obtain transgenic millet; under long-day conditions, the transgenic millet heads earlier than the recipient millet; under short-day conditions, the transgenic millet heads later than the recipient millet; The SiPRR37 protein is the protein shown in sequence 1; The gene encoding the SiPRR37 protein is a DNA molecule of either (b1) or (b2) below: (b1) The DNA molecule shown in sequence 2 or sequence 3; (b2) is a DNA molecule that has more than 75% identity with (b1) and encodes the SiPRR37 protein.

2. The method according to claim 1, characterized in that: The gene encoding the SiPRR37 protein in the recipient millet was knocked out using the CRISPR / Cas9 gene editing system.

3. The method according to claim 2, characterized in that: The CRISPR / Cas9 gene editing system includes an sgRNA that targets the gene encoding the SiPRR37 protein; the target sequence of the sgRNA is shown in Sequence 4.

4. A method for constructing long-day early-heading and short-day late-heading millet, comprising the following steps: replacing "CCTGCTACGTCACTGCATGTACG" in the SiPRR37 gene on the millet genomic DNA with "CCTGCTAACGTCACTGCATGTACG" or "ATGTACG" to obtain long-day early-heading and short-day late-heading millet; the nucleotide sequence of the SiPRR37 gene is shown in Sequence 2.

5. Application of inhibiting or knocking out gene expression encoding SiPRR37 protein in breeding long-day, early-heading and short-day, late-heading millet. The SiPRR37 protein is any one of the following proteins (a1)-(a2): (a1) The protein shown in sequence 1 of the sequence listing; (a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein described in (a1); The gene encoding the SiPRR37 protein is a DNA molecule of either (b1) or (b2) below: (b1) The DNA molecule shown in sequence 2 or sequence 3 in the sequence listing; (b2) is a DNA molecule that has more than 75% identity with (b1) and encodes the SiPRR37 protein.

6. The application according to claim 5, characterized in that: The gene encoding the SiPRR37 protein was knocked out using the CRISPR / Cas9 gene editing system.

7. The application according to claim 6, characterized in that: The CRISPR / Cas9 gene editing system includes an sgRNA that targets the gene encoding the SiPRR37 protein; the target sequence of the sgRNA is shown in Sequence 4.

8. Used for editing SiPRR37 The application of the CRISPR / Cas9 system for constructing long-day, early-heading, short-day, late-heading millet; the CRISPR / Cas9 system includes sgRNA and Cas9 nuclease; the target sequence of the sgRNA is shown in Sequence 4.