Digital crisper-based bacterial detection method and system

Abstract

The application discloses a kind of bacterial detection method and system based on digital CRISPR, the method is: the bacterial sample to be measured, for the cell of bacterial sample to be measured is lysed cell lysate system, for the constant-temperature amplification of target gene Amplification sub-system and the Cas12a detection sub-system of CRISPR-Cas12a detection to target gene are integrated in the same reaction system;The reaction system is formed into microdroplet unit by microdroplet generation method, at most contains 1 cell in each microdroplet unit;With the fluorescence signal of system is measured, the absolute content of cell containing target gene is determined by CRISPR-Cas12a detection, the detection of bacterial sample to be measured is realized.The application does not need to extract nucleic acid to sample to be measured, carries out nucleic acid extraction, nucleic acid amplification and nucleic acid detection in the same tube simultaneously, avoids the tedious and time-consuming nucleic acid extraction process, saves a lot of manpower and material resources.

Description

Technical Field

[0001] This invention relates to the field of biological detection technology, and in particular to a bacterial detection method and system based on digital CRISPR. Background Technology

[0002] Currently, the main clinical molecular diagnostic techniques include quantitative real-time PCR (qPCR), digital PCR, whole-genome sequencing, and gene chip technology. qPCR is the most commonly used molecular diagnostic technique in clinical practice, but it requires expensive specialized equipment, has high sample requirements, and is costly. While digital PCR can achieve absolute quantification of nucleic acid molecules such as DNA or RNA, it is essentially still a PCR technique and suffers from the same drawbacks as qPCR: whole-genome sequencing and gene chip technologies are time-consuming, require sophisticated equipment and samples, and are expensive, limiting their adoption in most regions. Currently, there is a lack of molecular diagnostic techniques that offer high detection sensitivity, low cost, and short detection time.

[0003] CRISPR-Cas (Clustered Regularly Interspaced Short Palindromic Repeats, CRISPRs) is an adaptive immune system in bacteria. Cas proteins, guided by guide RNA complementary to the foreign nucleic acid, specifically bind to it and then utilize their nuclease activity to specifically cleave it. CRISPR-Cas12a (Cpf1) belongs to the second family of Cas enzymes and can specifically cleave double-stranded DNA under the guidance of guide RNA. The Cpf1 enzyme recognizes adjacent motifs (PAMs) rich in thymine (T) nucleotides and, guided by CRISPR RNA (crRNA), cleaves double-stranded DNA (dsDNA) complementary to the crRNA. When the Cas12a protein specifically recognizes and cleaves the target double-stranded DNA, it induces strong trans-cleavage activity of non-specific single-stranded DNA (ssDNA), randomly cleaving surrounding non-specific single-stranded DNA. This property can be used for the molecular detection of nucleic acids.

[0004] Currently, there are some relevant documents and patents regarding the use of the CRISPR-Cas12 system for bacterial detection. For example, patent CN111778318B discloses a method and system for detecting nucleic acid molecules based on the CRISPR / Cas system. However, existing methods of this kind require the extraction of genomic DNA first, and then the genomic DNA is used as the detection target. This method requires the extraction of genomic DNA, which is prone to aerosol contamination, leading to false positives and resulting in low reliability of the detection results. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a bacterial detection method and system based on digital CRISPR, which addresses the shortcomings of the prior art.

[0006] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is: a bacterial detection method based on digital CRISPR, the method being as follows: The bacterial sample to be tested, the cell lysis subsystem for lysing the cells of the bacterial sample to be tested, the isothermal amplification subsystem for amplifying the target gene, and the Cas12a detection subsystem for CRISPR-Cas12a detection of the target gene are integrated into the same reaction system. The reaction system was divided into several microdroplet units using a microdroplet generation method, with each microdroplet unit containing at most one cell; By measuring the fluorescence signal of the system, the absolute content of cells containing the target gene can be determined by CRISPR-Cas12a detection, thus enabling the detection of bacterial samples to be tested.

[0007] Preferably, the cell lysis subsystem includes a lysin.

[0008] Preferably, the isothermal amplicon system includes amplification primers PF and PR.

[0009] Preferably, the Cas12a detection subsystem includes Cas12a, crRNA, and ssDNA, wherein: crRNA is a guide RNA that is complementary to the target gene, and ssDNA is a non-specific single-stranded DNA with a fluorescent group and a fluorescence quencher group attached to each end. When the target gene is present, Cas12a, guided by crRNA, randomly cleaves the surrounding ssDNA, causing the fluorescence quenching group on the ssDNA to separate from the fluorescent group, and the fluorescence signal of the fluorescent group to be restored.

[0010] Preferably, the steps of the bacterial detection method based on digital CRISPR are as follows: S1. Prepare a reaction system containing the bacterial sample to be tested; S2. The reaction system is divided into several microdroplet units by a microdroplet generation method, and each microdroplet unit contains at most one cell; S3. Allow the microdroplet units to react at 37℃ for 30-90 minutes, then obtain the fluorescence intensity of each microdroplet unit using a fluorescence detection device, and statistically analyze the fluorescence intensity detection results of all microdroplet units to calculate the concentration of target bacteria in the bacterial sample to be tested.

[0011] Preferably, the ssDNA is modified with 6-carboxyfluorescein and a fluorescence quencher group BHQ1 at both ends, and the sequence of the ssDNA is: 5'-6FAM-TTATT-BHQ1-3'.

[0012] Preferably, the bacterial sample to be tested is methicillin-resistant Staphylococcus aureus; The crRNA was designed to target the mecA gene, and its sequence is shown in SEQ NO.1.

[0013] Preferably, the isothermal amplicon system is an ERA isothermal amplification system, which includes the following primer sequences: The sequence of the PF primer is shown in SEQ NO.2, and the sequence of the PR primer is shown in SEQ NO.3.

[0014] Preferably, the bacterial detection method based on digital CRISPR for detecting methicillin-resistant Staphylococcus aureus includes the following steps: S1. Preparation of the reaction system: The bacterial sample to be tested, staphylococcal lysin ClyH, amplification primers PF and PR, Cas12a, crRNA, ssDNA, dissolving agent, activator, and RNase-free water were mixed to obtain the reaction system. S2. The reaction system is formed into several microdroplet units using a microdroplet generation device, and each microdroplet unit contains at most one cell; S3. Allow the microdroplet units to react at 37℃ for 45 minutes, then obtain the fluorescence intensity of each microdroplet unit using a fluorescence detection device, and statistically analyze the fluorescence intensity detection results of all microdroplet units to calculate the concentration of target bacteria in the bacterial sample to be tested.

[0015] The present invention also provides a bacterial detection system based on digital CRISPR, which uses the method described above to detect bacteria. The system includes a droplet generation subsystem, a fluorescence detection subsystem, and the reaction system described above. The droplet generation subsystem is used to form the reaction system into droplet units, each droplet unit containing at most one cell; The fluorescence detection subsystem is used to perform fluorescence detection and analysis on the microdroplet units, thereby enabling quantitative detection of the bacterial samples to be tested.

[0016] The beneficial effects of this invention are: The bacterial detection method based on digital CRISPR provided by this invention integrates cell lysis, isothermal amplification of specific genes, and CRISPR-Cas12a detection of specific genes into the same reaction system. Furthermore, a droplet generation system divides the reaction system into tens of thousands of portions, ensuring that each droplet unit contains at most one cell. The absolute initial cell count can then be calculated by statistically analyzing the CRISPR-Cas12a shearing signal. Compared to traditional CRISPR methods, the digital CRISPR method provided by this invention, which calculates the initial cell count by statistically analyzing the presence or absence of CRISPR-Cas12a shearing signals within each droplet unit, offers higher sensitivity, allows for absolute quantification of the initial sample cell count, and eliminates the need for prior extraction of genomic DNA for detection, simplifying the detection process and improving efficiency. The bacterial detection method based on digital CRISPR provided by this invention, compared with PCR reaction-based methods such as real-time PCR and digital PCR, does not require expensive gene amplification instruments, resulting in lower detection costs; compared with standalone isothermal amplification detection methods such as ERA and LAMP, it has higher sensitivity and can absolutely quantify the initial cell count in the sample; it also has stronger specificity and can effectively avoid false positives. This invention eliminates the need for nucleic acid extraction from the sample. Instead, it leverages the high environmental tolerance of ERA isothermal amplification and CRISPR-Cas12a nucleic acid detection to perform nucleic acid extraction, amplification, and detection simultaneously within the same tube. This avoids the cumbersome and time-consuming nucleic acid extraction process, saving significant manpower and resources. Attached Figure Description

[0017] Figure 1 This is a schematic diagram illustrating the principle of the bacterial detection method based on digital CRISPR of the present invention; Figure 2 The results of detecting 43,300 bacteria using the method of Example 1 of the present invention; Figure 3 The results of detecting 43300 genomic DNA using the method of Verification Example 1 of the present invention; Figure 4 The results of detecting 43300 genomic DNA using the method of Verification Example 2 of the present invention; Figure 5 The results of the pyrolysis efficiency test of 43300 with different concentrations of lysin ClyH in the method of verification example 3 of the present invention; Figure 6 The results of detecting 43300 bacteria are shown in Example 3 of the present invention. Detailed Implementation

[0018] The present invention will be further described in detail below with reference to embodiments, so that those skilled in the art can implement it based on the description.

[0019] It should be understood that terms such as “having,” “comprising,” and “including” as used herein do not exclude the presence or addition of one or more other elements or combinations thereof.

[0020] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available. For examples where specific conditions are not specified, conventional conditions or conditions recommended by the manufacturer are followed. For reagents or instruments whose manufacturers are not specified, they are all commercially available products.

[0021] In this invention, the Gram-positive bacterial genomic DNA extraction kit was purchased from Beijing Solarbio Science & Technology Co., Ltd., the staphylococcal lysin (lysin ClyH) was purchased from Wuhan Saisrui Microbial Technology Co., Ltd., the basic nucleic acid amplification kit (ERA method) was purchased from Suzhou Xianda Gene Technology Co., Ltd., and the amplification primers were synthesized by Suzhou Hongxun Biotechnology Co., Ltd.; crRNA and ssDNA-FQ were synthesized by Suzhou Genewise Biotechnology Co., Ltd.; LbCas12a protein and reaction buffer were purchased from Tulugang Biotechnology Co., Ltd., and RNase-free water (DEPC water) was purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0022] This invention provides a bacterial detection method based on digital CRISPR, the method being as follows: The bacterial sample to be tested, the cell lysis subsystem for lysing the cells of the bacterial sample to be tested, the isothermal amplification subsystem for amplifying the target gene, and the Cas12a detection subsystem for CRISPR-Cas12a detection of the target gene are integrated into the same reaction system. The reaction system was divided into several microdroplet units using a microdroplet generation method, with each microdroplet unit containing at most one cell; By measuring the fluorescence signal of the system, the absolute content of cells containing the target gene can be determined by CRISPR-Cas12a detection, thus enabling the detection of bacterial samples to be tested.

[0023] The cell lysis subsystem includes a lysin, and the isothermal amplification subsystem includes amplification primers PF and PR.

[0024] The Cas12a detection subsystem includes Cas12a, crRNA, and ssDNA, among which: crRNA is a guide RNA that is complementary to the target gene, and ssDNA is a non-specific single-stranded DNA with a fluorescent group and a fluorescence quencher group attached to each end. When the target gene is present, Cas12a, guided by crRNA, randomly cleaves the surrounding ssDNA, causing the fluorescence quenching group on the ssDNA to separate from the fluorescent group, and the fluorescence signal of the fluorescent group to be restored.

[0025] The reaction system also includes RNase-free water.

[0026] Reference Figure 1 This is a schematic diagram of the principle of the bacterial detection method based on digital CRISPR of the present invention, wherein DNA polymerase is DNA polymerase, DNA recombinase is DNA recombinase, SSB is single-stranded DNA binding protein, Forward primer is primer PF, Reverse primer is primer PR, and MRSA bacteria is methicillin-resistant Staphylococcus aureus.

[0027] In this invention, the steps of the bacterial detection method based on digital CRISPR are as follows: S1. Prepare a reaction system containing the bacterial sample to be tested; S2. The reaction system is divided into several microdroplet units by a microdroplet generation method, and each microdroplet unit contains at most one cell; S3. Allow the microdroplet units to react at 37℃ for 30-90 minutes, then obtain the fluorescence intensity of each microdroplet unit using a fluorescence detection device, and statistically analyze the fluorescence intensity detection results of all microdroplet units to calculate the concentration of target bacteria in the bacterial sample to be tested.

[0028] The present invention also provides a bacterial detection system based on digital CRISPR, which uses the above method to detect bacteria. The system includes a droplet generation subsystem, a fluorescence detection subsystem, and the above reaction system. The droplet generation subsystem is used to form the reaction system into droplet units, each of which contains at most one cell; The fluorescence detection subsystem is used to perform fluorescence detection and analysis on the microdroplet units, thereby enabling quantitative detection of the bacterial samples to be tested.

[0029] The following detailed embodiments and verification examples further illustrate the present invention. These embodiments use the detection of methicillin-resistant Staphylococcus aureus (MRSA) as an example; however, it should be understood that the detection targets of the present invention are not limited to MRSA. The MRSA used is the standard strain ATCC=43300.

[0030] S1. Preparation of the reaction system: The bacterial sample to be tested, staphylococcal lysin ClyH, amplification primers PF and PR, Cas12a, crRNA, ssDNA, lysin, activator, and RNase-free water were mixed to obtain the reaction system; the specific proportions are shown in Table 1 below: Table 1 PF (10μM) 1 PR (10μM) 1 solvent 8 Activator 0.8 lysin ClyH 1.6 Cas12a (1μM) 1 crRNA (1 μM) 1 ssDNA-FQ (5μM) 1 43300 bacteria 4 <![CDATA[H2O (RNase-free water)]]> 0.6 The concentration of lysin ClyH was 40 μg / mL.

[0031] The ssDNA is modified with 6-carboxyfluorescein and a fluorescence quencher group BHQ1 at both ends, and the sequence of the ssDNA is: 5'-6FAM-TTATT-BHQ1-3' (SEQ NO.4); it was synthesized by Suzhou Genewiz Biotechnology Co., Ltd.

[0032] The crRNA was designed to target the mecA gene, and its sequence is shown in SEQ NO.1 (see Table 2 below). It was synthesized by Suzhou Genewiz Biotechnology Co., Ltd. The isothermal amplicon system is an ERA isothermal amplification system, which includes the following primer sequences: the PF primer (mecA-ERA-PF) sequence is shown in SEQ NO.2, and the PR primer (mecA-ERA-PR) sequence is shown in SEQ NO.3 (see Table 3 below). It was synthesized by Suzhou Hongxun Biotechnology Co., Ltd.

[0033] Table 2 SEQ NO.1 mecA-crRNA UAAUUUCUACUAAGUGUAGAUCCAAUAACUGCAUCAUCUUU Table 3 SEQ NO.2 mecA-ERA-PF ACTTCACATCTATTAGGTTATGTTGGTCCC SEQ NO.3 mecA-ERA-PR CGATTGTATTGCTATTATCGTCAACGATTGTG S2. The reaction system is formed into about 30,000 microdroplet units through a microdroplet generation chip, and each microdroplet unit contains at most one cell; S3. Incubate the microdroplet units at 37℃ for 45 min, then scan the microdroplet generation chip using a fluorescence microscope to obtain the fluorescence intensity of each microdroplet unit. Statistically analyze the fluorescence intensity results of all microdroplet units to calculate the concentration of target bacteria in the bacterial sample. The proportion of fluorescent microdroplets (i.e., positive microdroplets) among all microdroplets obtained at different bacterial concentrations is shown below. Figure 2As shown. The results indicate that the bacterial digital CRISPR method of the present invention can detect bacteria as low as 1 CFU / reaction of 43,300, i.e., 0.05 CFU / μL.

[0034] 1. Genomic DNA was extracted from 43300 bacteria cultured overnight at 37°C using a Gram-positive bacteria genomic DNA extraction kit.

[0035] 2. Synthesize crRNA (SEQ NO.1).

[0036] 3. Synthesize ssDNA (SEQ NO.4).

[0037] 4. Detection of 43300 genomic DNA using the CRISPR-Cas12a system: A 20 μL system was used, and the components are shown in Table 4 below: Table 4 DNA 10μL 10 × TOLO Buffer 3 2μL LbCas12a (1μM) 1μL crRNA (1 μM) 1μL ssDNA-FQ (5μM) 1μL <![CDATA[H20(RNase free)]]> 5μL 5. Full-wavelength ELISA reader fluorescence detection In the ELISA reader fluorescence detection, the CRISPR-Cas12a assay system was prepared by sequentially adding 2 μL of 10 × TOLO Buffer 3, 1 μL of LbCas12a (1 μM), 1 μL of mecA-crRNA (1 μM), 1 μL of ssDNA-FQ (5 μM), 10 μL of 43300 genomic DNA, and 5 μL of H2O (RNase-free). After thorough mixing, the mixture was incubated at 37°C for 30 min. The fluorescence of the reaction was measured using a Synergy H1 full-wavelength ELISA reader, with an excitation wavelength of 485 nm and an emission wavelength of 520 nm. The fluorescence value at 30 min was recorded as the reaction value. The reaction detection results for different concentrations of 43300 genomic DNA are shown below. Figure 3 As shown in the figure. The results indicate that the CRISPR-Cas12a system can achieve a detection sensitivity of 10 for 43,300 genomic DNA molecules. -11 M level.

[0038] 1. Synthesize ERA nucleic acid isothermal amplification primers: mecA-ERA-PF (SEQ NO.2) and mecA-ERA-PR (SEQ NO.3).

[0039] 2. One-step detection of 43,300 genomic DNA units using ERA amplification and CRISPR-Cas12a system. A 20 μL reaction system was used, and the specific components and amounts are shown in Table 5 below. After all components were mixed thoroughly, the reaction was carried out at 37℃ for 45 min.

[0040] Table 5 PF (10μM) 1 PR (10μM) 1 solvent 8 Activator 0.8 Cas12a (1μM) 1 crRNA (1 μM) 1 ssDNA-FQ (5μM) 1 43300 DNA 4 <![CDATA[H20(RNase free)]]> 2.2 The Synergy H1 full-wavelength microplate reader was used to measure the fluorescence of the detection reaction, with an excitation wavelength of 485 nm and an emission wavelength of 520 nm. The fluorescence value was read after 45 minutes of reaction. The reaction detection results for different concentrations of 43,300 genomic DNA are as follows: Figure 4 As shown in the figure. The results indicate that the detection sensitivity of the one-step method using ERA amplification and CRISPR-Cas12a detection can both reach 10. -17 M level.

[0041] 1. Determination of the lytic effect of staphylococcal lysin (lysin ClyH) on 43,300 bacteria in a one-step reaction system for ERA amplification and CRISPR-Cas12a detection. Dilute the fresh 43300 bacterial culture that has been cultured overnight to a concentration of approximately 1 x 10⁻⁶. 6 The reaction system was prepared according to the reaction ratio shown in Table 6 below, with a CFU / mL concentration.

[0042] Table 6 PF (10μM) 1 PR (10μM) 1 solvent 8 Activator 0.8 lysin ClyH 1.6 Cas12a (1μM) 1 crRNA (1 μM) 1 ssDNA-FQ (5μM) 1 43300 bacteria 4 <![CDATA[H20(RNase free)]]> 0.6 The concentrations of lysin ClyH were 0, 20 μg / mL, and 40 μg / mL. The reaction was carried out at 37℃ for 45 minutes. 5 μL of the reaction product was added to 495 μL of sterile water, mixed well, and 100 μL was plated onto antibiotic-free LB agar plates. The plates were incubated at 37℃ for 15 hours. The number of colonies on each plate was counted, and the total bacterial count and lysin ClyH lysis efficiency were calculated after the reaction. The total bacterial count and lysis efficiency after the reaction for different concentrations of lysin ClyH are shown below. Figure 5 As shown in the figure. The results indicate that 40 μg / mL Lysin ClyH has the best lysis effect on 43300, with a lysis efficiency of over 95%.

[0043] 2. Testing the sensitivity of a one-step method for detecting 43,300 bacteria using ERA amplification and the CRISPR-Cas12a system. Different concentrations of 43300 bacteria were used as the detection target, and reaction systems were prepared according to a reaction ratio of 3.1 (lysinClyH concentration was 40 μg / mL). The reaction was carried out at 37℃ for 45 min, and the fluorescence of the detection reaction was measured using a Synergy H1 full-wavelength microplate reader. The relative fluorescence intensities of different concentrations of 43300 bacteria are shown below. Figure 6 As shown in the figure. The results indicate that the one-step method of ERA amplification and CRISPR-Cas12a detection can achieve a sensitivity of 40 CFU / reaction, or 2 CFU / μL, for the direct detection of 43300 bacteria.

[0044] The feasibility of the method of the present invention can be verified by verification examples 1-3. The present invention can provide a new solution for the rapid and accurate detection of clinical pathogens.

[0045] Although the embodiments of the present invention have been disclosed above, they are not limited to the applications listed in the specification and embodiments. They can be applied to various fields suitable for the present invention. For those skilled in the art, other modifications can be easily made. Therefore, without departing from the general concept defined by the claims and their equivalents, the present invention is not limited to the specific details.

Claims

1. A bacterial detection method based on digital CRISPR, characterized in that, This method, intended for non-disease diagnosis, is used to detect methicillin-resistant Staphylococcus aureus (MRSA). Specifically: The bacterial sample to be tested, the cell lysis subsystem for lysing the cells of the bacterial sample to be tested, the ERA isothermal amplification subsystem for amplifying the target gene, and the Cas12a detection subsystem for CRISPR-Cas12a detection of the target gene are integrated into the same reaction system. The reaction system was divided into several microdroplet units using a microdroplet generation method, with each microdroplet unit containing at most one cell; By measuring the fluorescence signal of the system, the absolute content of cells containing the target gene can be determined by CRISPR-Cas12a detection, thus enabling the detection of bacterial samples to be tested. The cell lysis subsystem includes the staphylococcal lysin ClyH, the isothermal amplification subsystem includes amplification primers PF and PR, and the Cas12a detection subsystem includes Cas12a, crRNA, and ssDNA, wherein the Cas12a is LbCas12a.

2. The bacterial detection method based on digital CRISPR according to claim 1, characterized in that, In the Cas12a detection subsystem: crRNA is a guide RNA that is complementary to the target gene, and ssDNA is a non-specific single-stranded DNA with a fluorescent group and a fluorescence quencher group attached to each end. When the target gene is present, Cas12a, guided by crRNA, randomly cleaves the surrounding ssDNA, causing the fluorescence quenching group on the ssDNA to separate from the fluorescent group, and the fluorescence signal of the fluorescent group to be restored.

3. The bacterial detection method based on digital CRISPR according to claim 2, characterized in that, The steps of this method are as follows: S1. Prepare a reaction system containing the bacterial sample to be tested; S2. The reaction system is divided into several microdroplet units by a microdroplet generation method, and each microdroplet unit contains at most one cell; S3. Allow the microdroplet units to react at 37℃ for 30-90 minutes, then obtain the fluorescence intensity of each microdroplet unit using a fluorescence detection device, and statistically analyze the fluorescence intensity detection results of all microdroplet units to calculate the concentration of target bacteria in the bacterial sample to be tested.

4. The bacterial detection method based on digital CRISPR according to claim 3, characterized in that, The ssDNA is modified at both ends with 6-carboxyfluorescein and a fluorescence quencher group BHQ1, respectively, and the sequence of the ssDNA is: 5'-6FAM-TTATT-BHQ1-3'.

5. The bacterial detection method based on digital CRISPR according to claim 4, characterized in that, The bacterial sample to be tested was methicillin-resistant Staphylococcus aureus; The crRNA was designed to target the mecA gene, and its sequence is shown in SEQ NO.

1.

6. The bacterial detection method based on digital CRISPR according to claim 5, characterized in that, The primer sequences included in the ERA isothermal amplicon system are: The sequence of the PF primer is shown in SEQ NO.2, and the sequence of the PR primer is shown in SEQ NO.

3.

7. A bacterial detection system based on digital CRISPR, characterized in that, It uses the method described in any one of claims 1-6 for bacterial detection, the system comprising a droplet generation subsystem, a fluorescence detection subsystem, and the reaction system described in any one of claims 1-6; The droplet generation subsystem is used to form the reaction system into droplet units, each droplet unit containing at most one cell; The fluorescence detection subsystem is used to perform fluorescence detection and analysis on the microdroplet units, thereby enabling quantitative detection of the bacterial samples to be tested.

Images