Identification of co-segregation molecular marker of single-double petal of tagetes erecta, detection primer and detection kit and application

By developing the molecular marker TeCYC2e1 for co-segregating genes of marigolds and its detection primers, PCR technology was used to rapidly identify marigold petal types at the seedling stage, solving the problem of difficulty in distinguishing between single and double petal types in breeding and achieving efficient breeding.

CN116356071BActive Publication Date: 2026-07-21HUAZHONG AGRI UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
HUAZHONG AGRI UNIV
Filing Date
2023-04-03
Publication Date
2026-07-21

AI Technical Summary

Technical Problem

In current technologies, it is difficult to efficiently distinguish between single-petal and double-petaled flowers in marigold breeding during the seedling stage. Traditional breeding methods consume a lot of time and resources, and the existing molecular marker detection rate is insufficient, which cannot meet the needs of efficient breeding.

Method used

A co-segregating gene molecular marker TeCYC2e1 for identifying single and double petals of marigolds and its detection primers were developed. PCR technology was used to rapidly identify marigold petal types at the seedling stage. PCR amplification was performed using designed specific primers. Single petals showed no bands, while double petals showed a 521 bp band, achieving 100% detection efficiency.

Benefits of technology

It enables rapid and accurate differentiation of single and double petal traits in marigolds during the seedling stage, shortens the breeding cycle, improves breeding efficiency, and achieves a detection efficiency of 100%.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116356071B_ABST
    Figure CN116356071B_ABST
Patent Text Reader

Abstract

The application discloses a co-separation molecular marker for identifying single-petal and multi-petal characters of Tagetes, a detection primer, a detection kit and application. The nucleotide sequence of the gene molecular marker for identifying single-petal and multi-petal characters of Tagetes in single-petal Tagetes is shown in SEQ ID NO. 1, and the nucleotide sequences of the gene molecular marker in multi-petal Tagetes are shown in SEQ ID NO. 1 and SEQ ID NO. 2 respectively. The application further provides a detection primer for detecting the gene molecular marker and application of the detection primer in single-petal and multi-petal detection of Tagetes. The gene molecular marker detection method established by the application can directly utilize PCR products to quickly identify single-petal and multi-petal characters of Tagetes and accurately distinguish single-petal and multi-petal of Tagetes. The detection efficiency of the detection method of the application in single-petal and multi-petal F2 separation groups and 24 Tagetes resources reaches 100%, and the application can be used in molecular marker assisted breeding of Tagetes seedlings at the seedling stage, thereby significantly improving breeding efficiency.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to molecular markers for quality traits of marigolds, and more particularly to molecular markers for identifying co-segregating genes in single and double petals of marigolds, as well as their detection primers, detection kits, and applications, belonging to the field of gene molecular markers and detection primers for marigold petal types and their applications. Background Technology

[0002] marigold( Tagetes erecta L. Marigolds (Cercis) are plants belonging to the genus Marigold in the family Asteraceae. They are prized for their vibrant colors, full blooms, and long flowering period, making them important bedding plants with high ornamental and economic value. Asteraceae flowers have a distinctive capitulum (flower head), with bilaterally symmetrical ray florets on the outer edge and radially symmetrical tubular florets in the center. For example, in the case of marigolds, a single whorl of ray florets on the outer edge indicates a single petal, while multiple whorls of ray florets indicate a double petal.

[0003] The ornamental value of flowers mainly lies in their blooms. Compared to single-petaled flowers, double-petaled flowers have a fuller shape and are therefore more visually appealing. Marigold petals are easily distinguishable and can be used as a morphological marker in traditional breeding, but they can only be effectively distinguished after flowering, which greatly occupies breeding space.

[0004] Genetic molecular markers are effective gene markers developed based on sequence differences in a gene and closely linked to a specific trait. Developing gene molecular markers closely linked to marigold petal type can, on the one hand, be used for marker-assisted breeding to overcome the shortcomings of traditional breeding and effectively improve breeding efficiency; on the other hand, it also lays the foundation for the genetic mapping of target genes.

[0005] The inventors previously developed the CAPS marker Marker 67 (CN 112921112 A) which is closely linked to the marigold petal type using BSR-seq technology. However, the detection rate of this molecular marker is only 85%. Therefore, further development of molecular markers with higher detection efficiency is needed to truly achieve efficient selection in the seedling stage. Summary of the Invention

[0006] One objective of this invention is to provide a molecular marker for identifying cosegregating genes in marigolds with single or double petals; A second objective of this invention is to provide detection primers for amplifying the molecular markers of the co-segregated genes; The third objective of this invention is to apply the aforementioned co-segregating gene molecular markers or detection primers to the identification of single and double petals of marigolds.

[0007] The above-mentioned objective of the present invention is achieved through the following technical solution: This invention first provides a cosegregating gene molecular marker for identifying single and double-petaled marigolds, named TeCYC2e1. The cosegregating gene molecular marker TeCYC2e1 has only one gene sequence in single-petaled marigolds, and its nucleotide sequence is shown in SEQ ID No. 1. The cosegregating gene molecular marker TeCYC2e1 has two gene sequences in double-petaled marigolds, and their nucleotide sequences are shown in SEQ ID No. 1 and SEQ ID No. 2, respectively.

[0008] The cosegregating gene molecular marker TeCYC2e1 provided by this invention has only one gene sequence in single-petaled marigolds and two gene sequences in double-petaled marigolds. This invention compares the gene molecular marker TeCYC2e1 of a large number of marigold varieties and the results show that it cosegregates with single and double petal traits, indicating that the cosegregating gene molecular marker TeCYC2e1 provided by this invention can be used to identify whether the petal type of marigold is single or double.

[0009] The present invention further provides detection primers for detecting the co-segregating gene molecular marker TeCYC2e1.

[0010] The detection primers for the cosegregating gene molecular marker TeCYC2e1 are detection primers designed with the cosegregating gene molecular marker TeCYC2e1 as the detection target gene. As a preferred embodiment of the present invention, the detection primers for the cosegregating gene molecular marker TeCYC2e1 consist of the upstream detection primer shown in SEQ ID No. 3 and the downstream detection primer shown in SEQ ID No. 4.

[0011] The detection primers provided by this invention can be used as a primer set for amplifying the co-segregating gene molecular marker TeCYC2e1, and then used to identify the single and double petal traits of marigolds. Therefore, the application of the primer set in identifying marigold petal types falls within the scope of protection of this invention.

[0012] This invention further provides a PCR detection kit for identifying single and double petals of marigolds, comprising: 2×Hieff ® PCR Master Mix (including Taq enzyme, dNTPs, Mg) 2+ The test kit contains deionized water and detection primers; wherein the detection primers are designed using the co-segregated gene molecular marker TeCYC2e1 as the target gene; as a preferred embodiment, the detection primers consist of an upstream primer with the nucleotide sequence shown in SEQ ID No. 3 and a downstream primer with the nucleotide sequence shown in SEQ ID No. 4.

[0013] The present invention further provides the application of the cosegregating gene molecular marker TeCYC2e1 in the identification of single and double petals of marigolds, including the following steps: (1) extracting DNA from the marigold sample to be tested; (2) designing upstream and downstream primers using the cosegregating gene molecular marker TeCYC2e1 as the detection target for PCR amplification; (3) if no product is produced by PCR amplification, the marigold sample is a single-petal variety; if a 521 bp electrophoretic band is obtained by amplification, the marigold sample is a double-petal variety.

[0014] As a preferred embodiment of the present invention, the PCR amplification reaction system is: 2×Hieff ® PCRMaster Mix 12.5 μL (including Taq enzyme, dNTPs and Mg) 2+ ), DNA template 1 μL, upstream primer 1 μL, downstream primer 1 μL, deionized water 9.5 μL.

[0015] As a preferred embodiment of the present invention, the PCR amplification reaction program is as follows: 94℃ for 4 min; 94℃ for 30 sec, 58℃ for 30 sec, 72℃ for 1 min, for a total of 35 cycles; 72℃ for 10 min; and 4℃ for 5 min.

[0016] This invention utilizes the cloning of marigolds CYC2 Based on the sequence differences of the TeCYC2e1 gene, a co-segregating gene molecular marker, TeCYC2e1, was developed to co-segregate with the single and double petal traits of marigolds. Results showed that the co-segregating gene molecular marker TeCYC2e1 could effectively distinguish the petal types of marigolds; single-petaled marigolds failed to amplify a band, while double-petaled marigolds amplified a 521 bp band. The molecular marker achieved a detection efficiency of 100% in the F2 segregating population of single and double-petaled marigolds.

[0017] This invention utilizes detection primers designed with the co-segregating gene marker TeCYC2e1 as the detection gene target to validate the results in a F2 segregating population of single and double petals and 24 marigold resources. The results show that the TeCYC2e1 gene marker can accurately distinguish the petal type of the F2 segregating population; that is, no band was detected in the PCR product of single-petaled plants, while a 521 bp amplified band was detected in the PCR product of double-petaled plants. The TeCYC2e1 gene marker was validated in 674 individual plants of the F2 population; 503 double-petaled plants showed a 521 bp band, while 171 single-petaled plants did not amplify any product. Simultaneously, the TeCYC2e1 gene marker was validated in 24 marigold resources; 16 double-petaled resources amplified a 521 bp band, while 8 single-petaled resources did not amplify any band. The detection results indicate that the plant phenotype and the gene marker are completely consistent, with no exchange occurring, and the detection efficiency reaches 100%.

[0018] The detection method established by using the detection primers designed with the co-segregating gene molecular marker TeCYC2e1 of this invention as the detection gene target can directly and rapidly screen the petal type of marigolds using PCR products. It can assist in the selection of single and double petal types at the seedling stage, which greatly shortens the breeding cycle and improves the breeding efficiency. It has significant theoretical and practical significance for the breeding of new marigold varieties.

[0019] This invention relates to the definition of key terms and abbreviations. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. While any methods, apparatus, and materials similar to or equivalent to those described herein may be used in the practice or testing of this invention, preferred methods, apparatus, and materials are now described.

[0020] The terms "polynucleotide" or "nucleotide" mean deoxyribonucleotides, deoxyribonucleosides, ribonucleosides, or ribonucleotides and their polymers, either in single-stranded or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides, which have similar binding properties to a reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise specifically limited, the term also means oligonucleotide analogs, including PNAs (peptide nucleic acids), DNA analogs (phosphate thioesters, phosphoramidites, etc.) used in antisense techniques. Unless otherwise specified, specific nucleic acid sequences implicitly encompass variants of their conserved modifications (including, but not limited to, degenerate codon substitutions) and complementary sequences, as well as explicitly specified sequences. Specifically, degenerate codon substitution can be achieved by generating a sequence in which the third position of one or more of the selected (or all) codons is substituted with a mixed base and / or deoxyinosine residue (Batzer et al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al., J. Biol. Chem.260:2605-2608 (1985); and Cassol et al., (1992); Rossolini et al., Mol Cell. Probes 8:91-98 (1994)).

[0021] Gene molecular markers: Effective gene markers developed based on sequence differences of a gene and closely linked to a certain trait. Attached Figure Description

[0022] Figure 1 Phylogenetic tree of CYC-like proteins; Te: Tagetes erecta Tp: Tagetes patula ;Bp: Bidens pilosa Ha: Helianthus annuus Cbi: Cosmos bipinnatus Dv: Dahlia pinnata Cm: Chrysanthemum x morifolium Oe: Osteospermum ecklonis Ai: Aster indicus ; Cl: Chrysanthemum lavandulifolium Co: Calendula officinalis Dp: Dahlia pinnata .

[0023] Figure 2 It includes both double-petaled and single-petaled marigolds; the double-petaled variety is Marigold 9906, and the single-petaled variety is Marigold F8.

[0024] Figure 3The results show the amino acid sequence alignment of TeCYC2e1 in marigold F8 and 9906.

[0025] Figure 4 Figure showing the validation results of the specific co-segregating gene molecular marker TeCYC2e1 in marigold single and double petal combination parents, F1 generation, and F2 population.

[0026] Figure 5 The results of validation of the specific co-segregating gene molecular marker TeCYC2e1 in 24 marigold resources. Detailed Implementation

[0027] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer as a result. However, these embodiments are merely exemplary and do not constitute any limitation on the scope of the present invention. Those skilled in the art should understand that modifications or substitutions to the details and form of the present invention can be made without departing from the spirit and scope of the invention, but all such modifications and substitutions fall within the protection scope of the present invention.

[0028] Example 1: Preliminary identification of gene molecular markers co-segregating with marigold petal type 1. Marigold double-petaled and single-petaled CYC2 Cloning and sequence structure difference analysis of gene-like organisms Based on the full-length transcriptome data of marigold, and according to functional annotation, six genes were selected. CYCLOIDEA2 ( CYC2 The unigenes, numbered T01.PB13867, T01.PB58806, T01.PB26464, T01.PB22595, T01.PB5505, and T01.PB6702, were named according to multiple sequence alignment and phylogenetic analysis. TeCYC2a , TeCYC2b , TeCYC2c , TeCYC2d , TeCYC2e1 and TeCYC2e2 ( Figure 1 ). The marigold double-petaled inbred line 9906 and single-petaled inbred line F8 were used respectively. Figure 2 Using DNA as a template, six clones were created. TeCYC2 Gene-like structures were found to contain only... TeCYC2e1 The gene sequences differ between double-petaled and single-petaled marigold plants. Single-petaled marigold F8 contains only one gene sequence (its nucleotide sequence is shown in SEQ ID No. 1), while double-petaled marigold 9906 contains two gene sequences (their nucleotide sequences are shown in SEQ ID No. 1 and SEQ ID No. 2, respectively): the first gene sequence is completely identical to that of single-petaled F8. Figure 3TeCYC2e1[9906-1]), the second gene sequence has 4 extra amino acids at the 5' end and 3' end, and some base deletions and mutations ( Figure 3 TeCYC2e1[9906-2]). The sequence of Unigene T01.PB5505 that is consistent in '9906' and 'F8' is named TeCYC2e1 The unique sequence in '9906' is named [9906-2]. TeMtCYC2e1-1 .according to TeCYC2e1 The sequence differences of the gene in the single-petaled marigold variety F8 and the double-petaled variety 9906 were investigated. Gene marker primers (TeCYC2e1-F and TeCYC2e1-R) were designed using Primer Premier 5.0 software. The nucleotide sequences of the gene marker primers are shown in SEQ ID No. 3 and SEQ ID No. 4, respectively.

[0029] 2. Construction of single and double petal populations of marigolds In this embodiment, double-petaled marigold 9906 is used as the female parent and single-petaled marigold F8 is used as the male parent. Figure 2 The F1 generation was obtained by hybridization, and the F2 segregating population was obtained by self-pollination of individual F1 plants.

[0030] 3. Analysis of the inheritance patterns of single and double petal traits in marigolds The F2 segregating population was analyzed for single and double petal types. There were 501 double-petaled plants and 161 single-petaled plants. According to the chi-square test, the ratio of double-petaled plants to single-petaled plants was approximately 3:1, which is consistent with Mendel's laws of inheritance. This indicates that a single gene controls the petal type of marigold, with double petaling being the dominant trait and single petaling being the recessive trait.

[0031] 4. Validation of the gene molecular marker TeCYC2e1 in the F2 population The detection of the TeCYC2e1 gene molecular marker in the above-mentioned F2 segregating population showed that the TeCYC2e1 gene molecular marker co-segregated with the single and double petal traits. No band was found in the PCR amplification products of single-petaled marigolds, while a 521 bp band was present in the PCR amplification products of double-petaled marigolds.

[0032] 5. Gene molecular marker TeCYC2e1 and PCR amplification system and procedure The total PCR reaction volume was 25 μL, containing 1 μL of 100 ng / μL template DNA and 2× Hieff. ® PCR Master Mix 12.5 μL (containing Taq enzyme, dNTPs, Mg) 2+ ), 1 μL each of 10 μmol / L upstream and downstream primers, and 9.5 μL of ddH2O.

[0033] The PCR reaction program was as follows: 94℃ pre-denaturation for 4 min; 94℃ denaturation for 30 sec, 58℃ annealing for 30 sec, 72℃ extension for 1 min, 35 cycles; final extension at 72℃ for 10 min; incubation at 4℃ for 5 min; and detection of amplification products by 1% agarose gel electrophoresis.

[0034] Experiment Example 1: Identification of single and double petals of marigold using detection primers designed with the gene molecular marker TeCYC2e1 as the target gene. 1. Experimental Methods (1) Take 4-5 fresh marigold leaves and extract their genomic DNA using the 2×CTAB method. Detect the DNA quality using 1% agarose gel electrophoresis and the DNA concentration using a UV spectrophotometer. Then dilute the extracted DNA to 100 ng / ul for later use.

[0035] (2) Using the DNA of the marigold genome to be tested as a template, upstream and downstream primers were designed with the TeCYC2e1 gene as the target. The base sequences of the upstream and downstream primers are as follows: TeCYC2e1-F (upstream primer): CCAAGAGATAGGAGAGTTAGATTGTCC; TeCYC2e1-R (downstream primer): GAATCATTCGACACATGACCAACATTG.

[0036] (3) The PCR reaction system was as follows: 1 μL of 100 ng / μL DNA template, 12.5 μL of 2×Taq PCR Mix (containing Taq enzyme, dNTPs, and Mg). 2+ ), upstream primer 1 μL, downstream primer 1 μL, deionized water 9.5 μL.

[0037] The PCR reaction program was as follows: 94℃ pre-denaturation for 4 min; 94℃ denaturation for 30 sec, 58℃ annealing for 30 sec, 72℃ extension for 1 min, 35 cycles; final extension at 72℃ for 10 min; and incubation at 20℃ for 5 min.

[0038] (4) The amplification products were detected by 1% agarose gel electrophoresis. If no band was amplified in the PCR product, it was a single-petaled marigold; if a 521 bp band was amplified in the PCR product, it was a double-petaled marigold.

[0039] 2. Experimental Results Detection primers designed using the gene molecular marker TeCYC2e1 as the detection target were used to validate the F2 single-petal and double-petal segregating population and 24 marigold resources (Table 1) cultivated by our research group. The results showed that the detection primers designed using the gene molecular marker TeCYC2e1 as the detection target could accurately distinguish the petal type of F2 segregating population plants and marigold resources. That is, no band could be detected in the PCR product of single-petal plants, while a 521 bp amplified band could be detected in the PCR product of double-petal plants. Figure 4 and Figure 5 Primers designed using the molecular marker TeCYC2e1 as the detection target were validated in a single- and double-petaled F2 population. The PCR products from 501 double-petaled plants showed a 521 bp amplified band, while the PCR products from 161 single-petaled plants showed no band. The same primers were also validated in 24 marigold resources. The PCR products from 16 double-petaled plants showed a 521 bp amplified band, while the PCR products from 8 single-petaled plants showed no band. The results indicate that the marigold plant phenotype is completely consistent with the molecular marker TeCYC2e1, with no exchange occurring, and the detection efficiency reached 100%.

[0040] Table 1. Information on 24 marigold resources and their petal types .

Claims

1. A molecular marker for identifying the co-segregating gene TeCYC2e1 in marigolds with single and double petals, characterized in that, The molecular marker TeCYC2e1 has only one gene sequence in single-petaled marigolds, and its nucleotide sequence is shown in SEQ ID No. 1; the molecular marker TeCYC2e1 has two gene sequences in double-petaled marigolds, and their nucleotide sequences are shown in SEQ ID No. 1 and SEQ ID No. 2, respectively.

2. The application of the reagent for detecting the co-segregating gene molecular marker TeCYC2e1 of marigold single and double petals as described in claim 1 in the identification of marigold single or double petals.

3. The application according to claim 2, characterized in that, include: (1) Extract DNA from the marigold sample to be tested as an amplification template, establish a PCR amplification system using the designed upstream and downstream primers, perform PCR amplification on the sample to be tested, and detect the amplification product using agarose gel; (2) If no product is amplified by PCR, the marigold sample to be tested is a single-petaled marigold. If a 521 bp electrophoretic band is amplified by PCR, then the marigold sample to be tested is a double-petaled marigold; the nucleotide sequence of the upstream primer is shown in SEQ ID No. 3, and the nucleotide sequence of the downstream primer is shown in SEQ ID No.

4.

4. The application according to claim 3, characterized in that, The PCR amplification reaction program was as follows: 94℃ for 4 min; 94℃ for 30 sec, 58℃ for 30 sec, 72℃ for 1 min, for a total of 35 cycles; 72℃ for 10 min; and 4℃ for 5 min.