Diplopterygium cernuum dnip1 protein, encoding gene and application thereof

Abstract

The application discloses a Dicranopteris linearis DNIP1 protein, a coding gene thereof and application. The application identifies a protein DNIP1 with complex state rare earth element absorption and transport capacity from a rare earth super-enrichment plant Dicranopteris linearis, and cloning obtains a gene sequence coding the protein. The application finds that the protein can improve the enrichment capacity of fungi or plants to complex state rare earth elements by overexpressing the protein in the fungi or plants, and the protein can be used for rare earth contaminated soil remediation and rare earth element recovery, such as cultivating recombinant fungi or transgenic plants with rare earth remediation function by using the DNIP1 protein, and then used for enriching rare earth elements. The application enriches molecular biological resources for rare earth pollution remediation, and is helpful to the treatment and resource recovery of rare earth contaminated soil.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology. More specifically, it relates to a DNIP1 protein from *Mangifera spp.*, its encoding gene, and its applications. Background Technology

[0002] Rare earth elements (REEs) are essential raw materials in high-tech and new energy industries, including scandium, yttrium, and 15 lanthanide elements. Over the past few decades, rare earth deposits worldwide have been extensively mined, leading to the rapid depletion of rich deposits and leaving behind vast areas of exposed tailings and contaminated soil. The high concentrations of rare earth elements in this contaminated soil severely restrict vegetation growth and threaten the health of local residents.

[0003] Phytomining technology offers a solution for the ecological restoration of contaminated soils and the recovery of rare earth resources in mining areas. This technology involves planting hyperaccumulating plants in rare earth-contaminated sites, removing contaminating metals from the soil while harvesting their aboveground biomass to recover the target metals. *Dicranopteris linearis* is currently the plant with the strongest reported rare earth enrichment capacity, with its aboveground parts containing up to 0.7% of the plant's dry weight, making it a potential material for developing rare earth phytomining technology. However, *Dicranopteris linearis* has a small biomass and is difficult to propagate artificially, greatly limiting the feasibility of directly utilizing it for rare earth phytomining. Exploring the molecular mechanisms by which *Dicranopteris linearis* roots absorb rare earth elements and uncovering molecular resources related to its hyperaccumulation of rare earth elements can lay a solid foundation for cultivating phytomining materials with large biomass and strong rare earth enrichment capabilities.

[0004] Numerous studies have shown that the long-distance transport of rare earth elements (REEs) from plants to the aboveground environment depends on organic or inorganic ligands, i.e., chelated REEs. While Chinese patent CN202210826448.3 discloses a NREET1 protein from *Dictamnus dasycarpus* capable of transporting REEs, this protein cannot transport chelated REEs. Therefore, it is necessary to explore proteins capable of transporting chelated REEs and utilize genetic engineering to recreate hyperaccumulating plants. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to overcome the lack of existing molecular biological resources that can transport complexed rare earth elements, and to provide a DNIP1 protein of *Dictamnus dasycarpus* with the ability to transport complexed rare earth elements, its encoding gene and its applications.

[0006] The first objective of this invention is to provide a dung beetle DNIP1 protein.

[0007] A second objective of this invention is to provide the gene encoding the DNIP1 protein of the scutellaria baicalensis.

[0008] A third objective of this invention is to provide a recombinant expression vector.

[0009] The fourth objective of this invention is to provide a recombinant engineered bacterium.

[0010] A fifth objective of this invention is to provide the application of the *Dictamnus dasycarpus* DNIP1 protein, the encoding gene, or the recombinant expression vector in enhancing the rare earth element enrichment capacity of fungi.

[0011] The sixth objective of this invention is to provide the application of the DNIP1 protein of *Dictamnus dasycarpus*, the encoding gene, the recombinant expression vector, or the recombinant engineered bacteria in improving the enrichment capacity of rare earth elements in plants.

[0012] A seventh objective of this invention is to provide the application of the DNIP1 protein of *Dictamnus dasycarpus*, the encoding gene, the recombinant expression vector, or the recombinant engineered bacteria in the preparation of transgenic plants that are hyperenriched with rare earth elements.

[0013] The eighth objective of this invention is to provide a method for improving the rare earth enrichment capacity of plants.

[0014] The above-mentioned objective of this invention is achieved through the following technical solution:

[0015] This invention screened and identified a protein with rare earth element transport capabilities from the plant *Dicranopteris linearis*, named DNIP1 (Dicranopteris linearis NRAMP Rare Earth Element Transporter 1), whose amino acid sequence is shown in SEQ ID NO.2. This invention also obtained the gene encoding the *Dicranopteris linearis* DNIP1 protein, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0016] This invention, through overexpression of the *Dictamnus dasycarpus* DNIP1 protein in fungi and plants, has found that it can enhance the transport capacity of fungi and plants for organic acid-bound light rare earth elements. The *Dictamnus dasycarpus* DNIP1 protein can be used to improve the enrichment capacity of fungi or plants for rare earth elements, or to prepare transgenic plants with hyperenriched rare earth elements. Therefore, this invention seeks protection for the *Dictamnus dasycarpus* protein and its applications.

[0017] This invention provides a DNIP1 protein from *Mangifera spp.*, the amino acid sequence of which is shown in SEQ ID NO.2.

[0018] The present invention also provides the encoding gene of the DNIP1 protein of the scutellaria baicalensis.

[0019] Specifically, the nucleotide sequence of the encoding gene is shown in SEQ ID NO.1.

[0020] The present invention also provides a recombinant expression vector containing the gene encoding the DNIP1 protein of *Dictyophora indica*.

[0021] The present invention also provides a recombinant engineered bacterium containing the above-mentioned recombinant expression vector.

[0022] This invention utilizes yeast and the model plant Arabidopsis thaliana to demonstrate that overexpression of the *Dictyophora indicum* DNIP1 protein can enhance the ability of yeast or Arabidopsis thaliana to accumulate rare earth elements. Therefore, this invention seeks protection for the application of the *Dictyophora indicum* DNIP1 protein, the encoding gene, and the recombinant expression vector in enhancing the rare earth element accumulation capacity of fungi.

[0023] Specifically, the fungus is yeast.

[0024] More specifically, the fungus is *Saccharomyces cerevisiae*.

[0025] The present invention also seeks protection for the application of the DNIP1 protein of *Dictamnus dasycarpus*, the encoding gene, the recombinant expression vector, or the recombinant engineered bacteria in improving the enrichment capacity of rare earth elements in plants.

[0026] Specifically, the improvement in the rare earth element enrichment capacity of plants is achieved by expressing the DNIP1 protein of *Dictamnus dasycarpus* in plants.

[0027] The present invention also seeks protection for the use of the DNIP1 protein of *Dictyophora indica*, the encoding gene, the recombinant expression vector, or the recombinant engineered bacteria in the preparation of transgenic plants that are hyperenriched with rare earth elements.

[0028] The present invention also provides a method for improving the rare earth enrichment capacity of plants, the method being: overexpressing the DNIP1 protein of *Dictamnus dasycarpus* in plants.

[0029] As an alternative implementation, the plant is Arabidopsis thaliana.

[0030] Specifically, in the above-described applications or methods of the present invention, the rare earth element is a light rare earth element and / or a complexed light rare earth element.

[0031] More specifically, the complexed light rare earth element is a citric acid-bound light rare earth element.

[0032] More specifically, the light rare earth element is neodymium (Nd).

[0033] The present invention has the following beneficial effects:

[0034] This invention screened and identified a protein, DNIP1, from the rare earth hyperaccumulator *Dicranopteris linearis*, possessing the ability to absorb and transport complexed rare earth elements. The gene sequence encoding this protein was also cloned. By overexpressing this protein in fungi or plants, this invention demonstrated that it can enhance the accumulation capacity of fungi or plants for complexed rare earth elements. This protein can be used for the remediation of rare earth contaminated soils and the recovery of rare earth elements. For example, recombinant fungi or transgenic plants with rare earth remediation functions can be cultivated using the DNIP1 protein for the enrichment of rare earth elements. This invention enriches the molecular biological resources for rare earth pollution remediation and is of great significance for the treatment and resource recovery of rare earth contaminated soils. Attached Figure Description

[0035] Figure 1 The results show the determination of rare earth element content in Saccharomyces cerevisiae containing and without the DNIP1 gene; where pYES2 represents Saccharomyces cerevisiae without the DNIP1 gene, and DNIP1 represents Saccharomyces cerevisiae containing the DNIP1 gene; Nd represents neodymium in ionic form, Nd-Cit represents citric acid-neodymium (citric acid-bound neodymium), and Nd-Mal represents malic acid-neodymium (malic acid-bound neodymium); * in the figure indicates significant difference, P < 0.05.

[0036] Figure 2 The results of rare earth element (REE) content determination in the aboveground parts and roots of Arabidopsis thaliana (Ex1 and Ex6) overexpressing DNIP1 and wild-type Arabidopsis thaliana are shown in Figure A, which shows the content determination of the light rare earth element neodymium, and Figure B shows the content determination of the heavy rare earth element ytterbium. Different letters in the figures indicate significant differences in REE content between Arabidopsis thaliana overexpressing DNIP1 and wild-type Arabidopsis thaliana. Uppercase and lowercase letters are used to distinguish the data of roots and aboveground parts, P < 0.05. Detailed Implementation

[0037] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.

[0038] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.

[0039] Example 1: Cloning of the DNIP1 gene from *Dictyophora indica*

[0040] This invention screened and identified a protein with rare earth element transport capabilities from a three-generation full-length transcriptome database of the plant *Dicranopteris linearis*, named DNIP1 (*Dicranopteris linearis* NRAMPRare Earth Element Transporter 1), whose amino acid sequence is shown below (SEQ ID NO.2):

[0041]

[0042] Based on this sequence, the present invention cloned the gene encoding the DNIP1 protein of *Dictyophora indica*, namely the *Dictyophora indica* DNIP1 gene, and the cloning process is as follows:

[0043] 1. RNA extraction and reverse transcription:

[0044] Fresh root tissues of *Dictamnus dasycarpus* cultured in hydroponics were collected. Total RNA was extracted from the root tissues using an RNA extraction kit (Sigma-Aldrich). cDNA was obtained by reverse transcription using the HiScriptII OneStep RT-PCR kit (Vazyme Biotech). The specific steps were performed according to the kit instructions.

[0045] 2. Cloning primer design:

[0046] The cloning primers for the *Dictamnus dasycarpus* DNIP1 gene designed in this invention are shown below:

[0047] Front primer F: TGTGGATGAATACTCAGGGA

[0048] Terminal primer R: TTAGAATCAAAGGTCACCCC

[0049] 3. PCR amplification:

[0050] Using the reverse-transcribed *Dictamnus dasycarpus* cDNA as a template, high-fidelity enzyme I-5 was employed. TM PCR amplification was performed using 2× High-Fidelity MasterMix (MCLAB, I5HM-200). The total volume of the PCR amplification reaction system was 50 μL, including 25 μL of I5 mix, 1 μL of cDNA template, 2 μL of 10 μM front primer F, 2 μL of 10 μM end primer R, and the remainder was made up with ddH2O. The PCR amplification reaction program was as follows: 98℃ pre-denaturation for 2 min; 98℃ denaturation for 10 s; 58℃ annealing for 15 s; 72℃ extension for 30 s; 35 cycles; 72℃ extension for 5 min; and incubation at 4℃.

[0051] 4. PCR product verification:

[0052] After electrophoresis, the PCR products were purified using a gel extraction kit and then ligated into the TOPO cloning vector to obtain a recombinant cloning vector. The ligation product was then transformed back into *E. coli* DH5α competent cells. Positive transformants were screened on a medium containing ampicillin, and the positive single-clone strains were sent to a biotechnology company for sequencing. The sequencing results showed that the nucleotide sequence of the *Dictyophora indica* DNIP1 gene is as follows (SEQ ID NO.1):

[0053]

[0054]

[0055] Example 2: Expression of DNIP1 in Saccharomyces cerevisiae

[0056] This invention utilizes *Saccharomyces cerevisiae* BY4741 to verify the function of the *Dictamnus dasycarpus* DNIP1 protein described in Example 1, as follows:

[0057] 1. Construction of recombinant expression vectors:

[0058] Primers for cloning the DNIP1 gene, containing homologous arm sequences from the pYES2 expression vector, were designed using Novizan's CE Design software. The primers are shown below:

[0059] Front primer F: gggaatattaagcttggtaccATGGATCCATCAGCGGAAACG

[0060] Terminal primer R: gcggccgttactagtggatccTCATGCAATGAAGAAAACTTTGTG

[0061] The lowercase part of the primer sequence is the homologous arm sequence, and the uppercase part is the target gene sequence.

[0062] Using the recombinant cloning vector of the DNIP1 gene constructed in Example 1 as a template, PCR amplification was performed using high-fidelity enzyme I-5TM2×High-Fidelity Master Mix (MCLAB, I5HM-200) to obtain the DNIP1 gene with the pYES2 homologous arm sequence. The total volume of the PCR amplification reaction system was 50 μL, including 25 μL of I5 mix, 1 μL of cDNA template, 2 μL of 10 pmol / μL front primer F, 2 μL of 10 pmol / μL end primer R, and ddH2O to make up the remainder. The PCR amplification reaction program was as follows: 98℃ pre-denaturation for 2 min; 98℃ denaturation for 10 s; 58℃ annealing for 15 s; 72℃ extension for 30 s; 35 cycles; 72℃ extension for 5 min; and incubation at 4℃.

[0063] The PCR products obtained by gel electrophoresis were purified by gel recovery. Homologous recombination was then used to homologously recombine the DNIP1 gene into the Kpn I and BamHI restriction sites of the pYES2 expression vector using a one-step rapid cloning kit, resulting in the recombinant expression vector pYES2::DNIP1 containing the DNIP1 gene. This recombinant expression vector was then retransformed into *E. coli* DH5α competent cells. Positive transformants were screened, and the positive single-clone strains were sent to a biotechnology company for sequencing to ensure that DNIP1 was correctly ligated into the recombinant expression vector pYES2::DNIP1. Subsequent experiments were conducted using the sequenced-verified recombinant expression vector pYES2::DNIP1.

[0064] 2. Transformation and identification of yeast competent cells:

[0065] Using a rapid yeast transformation kit (SK2400, Beijing Cooler Master Technology Co., Ltd.), the validated pYES2::DNIP1 recombinant yeast expression vector and the empty vector pYES2 were transformed into Saccharomyces cerevisiae BY4741 strain, respectively. The transformed yeast was cultured on SD-U selective medium (containing 0.67 g / 100 mL of amino acid-free yeast nitrogen source, catalog number Y0626, Sigma; 0.192 g / 100 mL of yeast auxotrophic medium supplement, catalog number Y1501, Sigma; and 2 g / 100 mL of galactose, catalog number G0750, Sigma) to screen for positive colonies. Plasmids were extracted from the positive monoclonal yeast strains and transformed into Escherichia coli DH5α for secondary sequencing verification.

[0066] 3. Yeast rare earth enrichment experiment:

[0067] To further verify the function of the DNIP1 gene, *Saccharomyces cerevisiae* expressing the DNIP1 gene and *Saccharomyces cerevisiae* containing the empty vector pYES2 were transferred to SD-U liquid selective medium and cultured until the *Saccharomyces cerevisiae* reached the OD level. 600 When the concentration was 1.0, the yeast cells were centrifuged and resuspended, and then transferred to yeast culture media containing neodymium (10 μM NdCl3), citric acid-bound neodymium (10 μM NdCl3 and 30 μM Cit), and malic acid-bound neodymium (10 μM NdCl3 and 30 μM Mal) (the main components of the culture medium were the same as above, but without P, ​​and the pH was 4.2). After enriching rare earth elements by culturing in a shaker at 30°C for 2 hours, the yeast cells were collected. The collected yeast cells were first cleaned three times with 20 mM MES-10 mM EDTA to remove the rare earth elements adsorbed on the surface of the yeast cells, and then washed three times with sterile water. The yeast cells were then dried in an oven at 60°C for 3 days. The dried yeast cells were weighed, digested, and the rare earth content in the cells was determined by ICP-MS.

[0068] The results of rare earth element content determination in yeast containing and without the DNIP1 gene are as follows: Figure 1 As shown in the figure, * indicates a significant difference (P < 0.05). Figure 1 It was found that expression of the *Dictamnus dasycarpus* DNIP1 gene significantly improved the yeast's ability to enrich citric acid-bound rare earth elements, but there was no significant difference in the enrichment ability for ionic or malic acid-bound rare earth elements. The results indicate that the *Dictamnus dasycarpus* DNIP1 protein can transport citric acid-bound rare earth elements.

[0069] Example 3: Expression of DNIP1 in Arabidopsis thaliana

[0070] This invention utilizes the model plant Arabidopsis thaliana to verify the function of the DNIP1 protein from *Dictamnus dasycarpus* described in Example 1, as follows:

[0071] 1. Construction of recombinant expression vectors:

[0072] Primers for cloning the DNIP1 gene, containing homologous arm sequences from the plant overexpression vector pSN1305 (pCAMBIA1305), were designed using Novizan's CE Design software. The primers are shown below:

[0073] Front primer F: gaacgataggagctcggtaccATGGATCCATCAGCGGAAACG

[0074] Terminal primer R: caggtcgactctagaggatccTCATGCAATGAAGAAAACTTTGTG

[0075] The lowercase part of the primer sequence is the homologous arm sequence, and the uppercase part is the target gene sequence.

[0076] Using the recombinant cloning vector of the DNIP1 gene constructed in Example 1 as a template, the DNIP1 gene with the pSN1305 homologous arm sequence was obtained by PCR amplification. The total volume of the PCR amplification reaction system was 50 μL, including 25 μL of I5 mix, 1 μL of cDNA template, 2 μL of 10 pmol / μL front primer F, 2 μL of 10 pmol / μL end primer R, and ddH2O to make up the remainder. The PCR amplification reaction program was as follows: 98℃ pre-denaturation for 2 min; 98℃ denaturation for 10 s; 58℃ annealing for 15 s; 72℃ extension for 30 s; 35 cycles; 72℃ extension for 5 min; and incubation at 4℃.

[0077] The PCR products obtained by gel electrophoresis were purified by gel recovery and then homologously recombinated using a one-step rapid cloning kit to insert the DNIP1 gene into the plant overexpression vector pSN1305 (pCAMBIA1305) (which carries a strong CaMV 35S promoter, enabling high-level expression of the target gene in plants), resulting in the recombinant expression vector pSN1305::DNIP1 containing the DNIP1 gene. The constructed recombinant expression vector was then retransformed into *E. coli* DH5α competent cells, and positive transformants were screened. Positive single-clone strains were sent to a biotechnology company for sequencing to ensure that DNIP1 was correctly ligated into the recombinant expression vector pSN1305::DNIP1. Subsequent experiments were conducted using the sequenced-verified recombinant expression vector pSN1305::DNIP1.

[0078] 2. Agrobacterium infection and transformation of Arabidopsis thaliana:

[0079] The recombinant expression vector pSN1305::DNIP1 containing the DNIP1 gene was transformed into Agrobacterium GV3101, and plasmids were extracted and transduced into E. coli for secondary sequence verification. The verified Agrobacterium containing the recombinant expression vector pSN1305::DNIP1 was cultured in LB broth containing rifampicin and kanamycin resistance medium until optimal viability (OD500). 600 =1.0), centrifuge to retain Agrobacterium cells and resuspend Agrobacterium in infection solution (5% sucrose solution, 0.05% Silwet L-77); immerse the stamens of healthy Arabidopsis thaliana flowers in infection solution containing Agrobacterium for 45 seconds; each Arabidopsis thaliana flower needs to be infected for three consecutive weeks, once a week; after infection, harvest Arabidopsis thaliana seeds (T0 generation), select positive seedlings from T0 generation seeds and cultivate them in soil to T1 generation; after harvesting T1 generation seeds, continue to select positive seedlings and cultivate to T2 generation, screen and identify T2 generation homozygous positive seedlings, and conduct rare earth enrichment experiments.

[0080] 3. Functional validation of Arabidopsis thaliana DNIP1 overexpression lines:

[0081] To verify whether the rare earth element transport gene DNIP1 in *Arabidopsis thaliana* can function in other plants, this invention selected the identified T2 generation homozygous Arabidopsis thaliana lines Ex1 and Ex6, and aseptically incubated them together with wild-type Arabidopsis thaliana WT on 1 / 2 MS medium. Neodymium (Nd) was selected to represent light rare earth elements, and ytterbium (Yb) was selected to represent heavy rare earth elements. Arabidopsis thaliana plants with uniform growth were transferred to media containing 30 μM Nd and 30 μM Yb, respectively, and cultured under the same conditions for 7 days before harvesting. The plants were divided into aboveground parts and roots. The roots were analyzed with 5 mM CaCl2 for 15 min and then washed three times with ultrapure water. The aboveground parts were washed three times with ultrapure water, weighed, and digested to measure the rare earth element content in different plant tissues.

[0082] The results of rare earth element content determination in the aboveground parts and roots of Arabidopsis thaliana lines overexpressing DNIP1 and wild-type Arabidopsis thaliana are as follows: Figure 2 As shown, Figure 2 In the figure, A represents the content determination result of the light rare earth element neodymium. Figure 2 In the figure, B represents the content of the heavy rare earth element ytterbium; different letters in the figure indicate significant differences in rare earth element content between Arabidopsis thaliana overexpressing DNIP1 and wild-type Arabidopsis thaliana. Uppercase and lowercase letters are used to distinguish data from root and aboveground parts, with P < 0.05. Figure 2 The results showed that the concentrations of light rare earth element (Nd) in the roots and shoots of Arabidopsis lines Ex1 and Ex6, which overexpressed the DNIP1 gene, were significantly higher than those in wild-type Arabidopsis thaliana (WT); the Nd concentration in the shoots increased by 150%, and the Nd concentration in the roots increased by approximately 47%. However, the concentrations of heavy rare earth element (Yb) in the roots and shoots of the Arabidopsis lines overexpressing the DNIP1 gene were not significantly different from those in wild-type Arabidopsis thaliana. These results indicate that the DlNIP1 protein plays a role in the absorption and transport of light rare earth elements in plants.

[0083] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A DNIP1 protein from *Dictamnus dasycarpus*, characterized in that, The amino acid sequence of the protein is shown in SEQ ID NO.

2.

2. The gene encoding the DNIP1 protein of *Dictyophora indica* as described in claim 1.

3. The encoding gene according to claim 2, characterized in that, The nucleotide sequence of the encoding gene is shown in SEQ ID NO.

1.

4. A recombinant expression vector, characterized in that, It contains the gene encoding the DNIP1 protein of the dung beetle as described in claim 2 or 3.

5. A recombinant engineered bacterium, characterized in that, It contains the recombinant expression vector as described in claim 4.

6. The recombinant engineered bacteria according to claim 5, characterized in that, The recombinant engineered bacteria is yeast.

7. The application of the *Dictamnus dasycarpus* DNIP1 protein of claim 1, the encoding gene of claim 2 or 3, or the recombinant expression vector of claim 4 in improving the rare earth element enrichment capacity of fungi, characterized in that... The fungus is yeast; the rare earth element is neodymium, a light rare earth element bound to citric acid.

8. The application of the *Dictamnus dasycarpus* DNIP1 protein of claim 1, the encoding gene of claim 2 or 3, the recombinant expression vector of claim 4, or the recombinant engineered bacteria of claim 5 in improving the enrichment capacity of rare earth elements in plants, characterized in that... The plant is Arabidopsis thaliana; the rare earth element is neodymium.

9. The application of the *Dictamnus dasycarpus* DNIP1 protein of claim 1, the encoding gene of claim 2 or 3, the recombinant expression vector of claim 4, or the recombinant engineered bacteria of claim 5 in the preparation of transgenic plants hyperenriched with rare earth elements, characterized in that, The plant is Arabidopsis thaliana; the rare earth element is neodymium.

10. A method for improving the rare earth element enrichment capacity of plants, characterized in that, The method involves overexpressing the DNIP1 protein of claim 1 in a plant; the plant is Arabidopsis thaliana; and the rare earth element is neodymium.

Images