Emericella varieformis strain for producing fungal polysaccharide and application thereof

Abstract

The present application relates to a kind of fungus polysaccharide-producing Eurotium cristatum strain and its application.The present application provides Eurotium cristatum BC-43 strain (Eurotium cristatum BC-43), and its preservation number is CCTCC NO:M 20211417.The present application further relates to the application of the Eurotium cristatum BC-43 strain in fermenting fungus polysaccharide and the fermenting product rich in fungus polysaccharide fermented by the Eurotium cristatum BC-43 strain.The present application provides that the fungus polysaccharide content produced by Eurotium cristatum BC-43 strain (Eurotium cristatum BC-43) is higher.

Description

Technical Field

[0001] This invention relates to the field of microbial application technology, specifically to a strain of *Aspergillus cristatus* capable of fermenting to produce fungal polysaccharides and its applications. Background Technology

[0002] Polysaccharides are one of the four basic substances that make up living organisms. They are formed by the condensation and dehydration of multiple monosaccharide molecules and are a class of sugar substances with complex and large molecular structures. Active polysaccharides can produce significant biological effects on normal organisms and have effective therapeutic effects on diseased organisms. Moreover, they are safe to take and have almost no toxicity.

[0003] Polysaccharides are widely found in animals, plants, macrofungi, and microorganisms, possessing a wide range of biological activities and functions. However, the production cycles of plant and animal polysaccharides, as well as macrofungi polysaccharides, are long, subject to numerous limiting factors, resulting in low yields, high resource consumption, and high costs for large-scale industrial production. These factors all influence their application and development to varying degrees.

[0004] Microbial polysaccharides are polysaccharides produced by microorganisms such as bacteria and fungi (excluding macrofungi). Microbial polysaccharides possess advantages that other polysaccharides do not have. They have short production cycles, are not limited by seasons, regions, or pest and disease conditions, have abundant and inexpensive raw material sources, relatively low costs, can be produced on a large scale industrially under controlled conditions, have high yields, are easy to purify, and do not pollute the environment. Therefore, they have strong market competitiveness and broad development prospects.

[0005] *Eurotium cristatum*, also known as *Aspergillus cristatus*, is a natural probiotic produced during the fermentation process of Fu brick tea. It is commonly called "Golden Flower Fungus" because it produces golden-yellow cleistothecia during its growth and reproduction. Toxicological studies in various animals have shown that *Golden Flower Fungus* is a non-toxic microorganism, and its fermentation products possess excellent antioxidant, antibacterial, gut microbiota-regulating, immunity-enhancing, anti-aging, and anti-tumor activities. This is related to the various health-promoting compounds produced by the fermentation metabolism of *Eurotium cristatum*, among which fungal polysaccharides are one of the most important metabolites. Researchers have discovered that various extracellular polysaccharides can be extracted from the fermentation broth of tea-derived *Eurotium cristatum*. These fungal polysaccharides can activate immune cells and regulate cytokine secretion through multiple pathways, thereby enhancing the body's cellular and humoral immune functions.

[0006] CN103999946A discloses a *Aurogonium cristatum* fermented rice milk health beverage and its preparation method, which includes using *Aurogonium cristatum* in the production of fermented rice milk beverage and obtaining a novel rice milk beverage with a unique flavor and rich in health factors such as fungal polysaccharides, wherein the content of fungal polysaccharides reaches 210-260 μg / ml. Summary of the Invention

[0007] To address the issue of low fungal polysaccharide content in existing strains of *Aspergillus cristatus*, this invention provides a novel *Aspergillus cristatus* strain.

[0008] Specifically, the present invention provides the following technical solution.

[0009] In a first aspect, the present invention provides a strain of *Aspergillus cristatus* BC-43 ( Eurotium cristatum BC-43), characterized in that the *Eurotium cristatum* strain BC-43 ( Eurotium cristatum BC-43 is deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: M 20211417.

[0010] Preferably, the *Eurotium cristatum* strain BC-43 ( Eurotium cristatum The ITS gene sequence of BC-43 is shown in SEQ ID NO.1.

[0011] Secondly, the present invention provides the application of the *Aspergillus cristatus* BC-43 strain in the fermentation production of fungal polysaccharides.

[0012] Thirdly, the present invention provides a fermentation product rich in fungal polysaccharides, which is produced by fermentation of the aforementioned *Aspergillus cristatus* BC-43 strain.

[0013] Preferably, the cholesterol clearance rate of the fermentation product is 59%-65%.

[0014] Fourthly, the present invention provides a method for preparing the fermentation product rich in fungal polysaccharides, characterized in that the preparation method comprises culturing the *Aspergillus cristatus* BC-43 strain.

[0015] Preferably, the method includes the following steps: (1) The *Aurotriarcha BC-43* strain was seed cultured to obtain *Aurotriarcha BC-43* strain seed culture solution; (2) The seed culture of the *Aspergillus cristatus* strain BC-43 was added to the fermentation medium and fermented. After fermentation for 3-6 days, the fermented product rich in fungal polysaccharides was extracted.

[0016] Preferably, the temperature for seed culture in step (1) is 28-30℃; Preferably, the seed culture is a shaking culture. Preferably, the oscillation frequency is 100-250 rpm; Preferably, the seed culture time is 20-70 hours.

[0017] Preferably, the fermentation in step (2) is solid-state fermentation or liquid fermentation; Preferably, the fermentation temperature in step (2) is 28-30℃.

[0018] Preferably, the liquid fermentation speed is 150-200 rpm; Preferably, the liquid fermentation ventilation rate is 600L / h-3000L / h.

[0019] Preferably, the culture medium used for liquid fermentation contains 15-60 parts of carbon source, 1.5-5 parts of nitrogen source, 0.1-0.5 parts of phosphorus source, 0.03-1 parts of ZnSO4, 0.03-1 parts of FeSO4·7H2O, 0-10 parts of KCl and 1-10 parts of MgSO4·7H2O; Preferably, the carbon source is selected from one or more of glucose, sucrose, maltose, molasses, and starch; Preferably, the nitrogen source includes one or a combination of two or more of yeast extract, peptone, corn steep liquor, soybean meal, ammonium sulfate, ammonia, sodium nitrate, and urea.

[0020] Preferably, the liquid fermentation includes a fed-batch fermentation process; Preferably, the fed-batch fermentation medium comprises 15-30 wt% sucrose; more preferably, the fed-batch fermentation medium comprises 20 wt% sucrose. Preferably, the feed fermentation medium has a flow rate of 50-200 ml / h.

[0021] Preferably, the culture medium used for solid fermentation contains, by mass percentage, 45%-55% water, 0.5%-4% glucose, 2-8% ammonium sulfate, 0.5-1.5% potassium dihydrogen phosphate, 0-0.5% magnesium sulfate, and the balance being wheat bran and corn flour, wherein the mass ratio of wheat bran to corn flour is 2-5:1.

[0022] Preferably, the inoculation amount in step (2) is 1-10% by weight.

[0023] Preferably, in step (2), fungal polysaccharides are extracted by precipitating them with ethanol.

[0024] Fifthly, the present invention provides a fungal polysaccharide, which is produced by fermentation of the *Aspergillus cristatus* BC-43 strain.

[0025] Sixthly, the present invention provides the application of the fermentation product rich in fungal polysaccharides or the fungal polysaccharides in the preparation of lipid-lowering drugs, anti-tumor drugs, pharmaceuticals for lipid-lowering and weight loss, and health products that help control body fat.

[0026] The *Aspergillus cristatus* strain of this invention belongs to the *Aspergillus* species commonly used in fermented tea, posing no food safety risk. This strain can produce large quantities of fungal polysaccharides using ordinary culture media, resulting in high fermentation yields. The *Aspergillus cristatus* strain of this invention grows rapidly, is easy to cultivate, and can shorten the production time of fungal polysaccharides while improving production efficiency. The crude polysaccharide extract obtained from the fermentation of this *Aspergillus cristatus* strain has lipid-lowering and anti-tumor effects, possessing extremely high economic and practical value.

[0027] Strain Preservation Information The *Eurotium cristatum* BC-43 strain of the present invention ( Eurotium cristatum BC-43 was deposited on November 15, 2021, at the China Center for Type Culture Collection (CCTCC), accession number CCTCC NO: M 20211417, address: Wuhan University, Wuhan, China, postcode: 430072; telephone: (027)-68754052. Detailed Implementation

[0028] As described above, the present invention provides a strain of *Aspergillus cristatus* BC-43 capable of fermenting to produce fungal polysaccharides. Eurotium cristatum BC-43 was deposited on November 15, 2021, at the China Center for Type Culture Collection (CCTCC) of Wuhan University, China, with accession number CCTCC NO: M 20211417.

[0029] In this embodiment of the invention, the phenol-sulfuric acid method was used to determine the content of fungal polysaccharides. Determination principle: Polysaccharides are hydrolyzed into monosaccharides under the action of concentrated sulfuric acid, and then rapidly dehydrated to generate furfural derivatives, which then combine with phenol to generate colored compounds. The absorbance is then measured using a spectrophotometer, and the polysaccharide content in the sample is quantitatively determined using a standard curve.

[0030] (1) Draw the standard curve: Phenol (pure phenol is a needle-like colorless crystal) is dissolved by heating in a water bath at 100°C. The solution is poured into a distillation flask and heated on an electric furnace to distill to its boiling point of 182°C for 2-3 minutes. The fraction distilled at 182°C is collected. 80g of the collected phenol fraction is dissolved in 20g of water to prepare an 80% phenol aqueous solution. This solution can be stored in a refrigerator away from light for a long time. Before use, the 80% phenol aqueous solution can be diluted to a 5% phenol aqueous solution.

[0031] An appropriate amount of glucose (analytical grade) was dried in an oven (105℃) to constant weight. 20.0 g was then accurately weighed, dissolved in distilled water, and diluted to 100 mL to obtain a glucose standard solution with a concentration of 0.2 g / mL. Glucose standard solutions of 40 mg / L, 80 mg / L, 120 mg / L, 160 mg / L, and 200 mg / L were prepared from this solution. Then, 1 mL of each glucose standard solution was taken, and 1 mL of freshly prepared 5% phenol aqueous solution was added, followed by 5 mL of 98% concentrated sulfuric acid, and the mixture was thoroughly mixed. After 10 min, the resulting mixture was placed in a 25℃ water bath for 20 min. Distilled water was then used as a blank control group, and the absorbance of the blank control group and the treated glucose standard solutions was measured at 490 nm. A standard curve was plotted with absorbance A on the ordinate and glucose concentration on the abscissa, and regression analysis was performed.

[0032] (2) Take 1 mL of the test solution, add 1 mL of 5% phenol aqueous solution, then add 5 mL of 98% concentrated sulfuric acid and mix well. After 10 min, place the resulting mixture in a 25℃ water bath for 20 min. Subsequently, use distilled water as a blank control group and measure the absorbance of the blank control group and the treated test solution at 490 nm. Calculate the polysaccharide content in the test solution using a standard curve.

[0033] To make the content of this invention easier to understand, the technical solutions of this invention will be further described below with reference to specific embodiments, but this invention is not limited thereto.

[0034] The manufacturers of the raw materials and equipment used in the examples, as well as the equipment and analytical methods used in the product analysis, are described below. Reagents, instruments, or operating procedures not described herein are all readily available to those skilled in the art.

[0035] Table 1 Information on raw materials and instruments used in this invention Example 1: Obtaining the *Aspergillus cristatus* BC-43 strain Xiangyi Fuzhuan tea was purchased from the Xiangyi Tea Flagship Store on Tmall (https: / / xiangyicy.tmall.com / ?spm=a1z10.1-bs.w5001-16603928635.2.2177391dHiq65q&scene=taobao_shop), and *Aspergillus cristatus* was isolated from it.

[0036] (1) Weigh 25 g of Fu tea sample, soak it in 225 mL of 0.85% sterile saline solution and add an appropriate amount of sterilized glass beads, and place it on a constant temperature shaker and shake at 120 r / min for 20 min.

[0037] (2) Dilute 10 and 10 using the serial dilution method respectively. 2 10 3 10 4 times.

[0038] (3) Take 1 mL of 10 4 The diluted solution was spread onto PDA plates and incubated at 28 °C for 3 days. Colonies grew, with a diameter of 11-16 mm, round shape, and dense structure. The newly formed hyphae at the colony edge grew vigorously, ranging from milky white to light yellow, while the center was golden yellow to dark brown, with a small amount of brown exudate. The reverse side of the colony was dark brown. This is consistent with the colony characteristics of *Eurotium cristatum*.

[0039] (4) Under sterile conditions, scrape the dominant and well-growing golden yellow colonies with the inoculation needle and spot-inoculate them on PDA medium plates. Incubate at 28℃ for 3 days and repeat the inoculation 3 times to obtain purified Coronavirus.

[0040] (5) The obtained *Eurotium cristatum* was inoculated into PDB culture at 28℃ and 150 rpm for 2 days to obtain mycelial balls; (6) Total DNA was extracted from the strain using liquid nitrogen grinding. The conserved sequence was amplified by PCR using universal ITS primers (ITS1: TCCGTAGGTGAACCTGCGG, ITS4: TCCTCGCTTATTGATATGC). The obtained product was sequenced by Aoke Dingsheng Biotechnology (Wuhan) Co., Ltd. The sequenced ITS region is shown in SEQ ID NO.1.

[0041] The sequence of SEQ ID NO.1 is as follows: gctacgagtgcgggtctctgggtcaacctcccatccgtgtctatctgtaccctgttgctt cggcgtggccacggcccgccggagactaacatttgaacgctgtctgaagtttgcagtctg agtttttagttaaacaatcgttaaaactttcaacaacggatctcttggttccggcatcga tgaagaacgcagcgaaatgcgataattaatgtgaattgcagaattcagtgaatcatcgag tctttgaacgcacattgcgccccctggtattccggggggcatgcctgtccgagcgtcatt gctgccctcaagcacggcttgtgtgttgggcttccgtccctggcaacggggacgggccca aaaggcagtggcggcaccatgtctggtcctcgagcgtatggggctttgtcacccgctccc gtaggtccagctggcagctagcctcgcaaccaatctttttaaccaggttgacctcggatc aggtagggatacccgctgaacttaagcatatcaaaggcggggaggaa The sequencing results were compared with those from NCBI to determine the species. It was ultimately confirmed that this strain was indeed *Aureobasidium cristatum*, specifically the *Aureobasidium cristatum* BC-43 strain of this invention. This *Aureobasidium cristatum* BC-43 strain ( Eurotium cristatum BC-43 was deposited at the China Center for Type Culture Collection (CCTCC) on November 15, 2021, with accession number CCTCC NO: M20211417.

[0042] Example 2: Preparation of a fermentation extract rich in fungal polysaccharides by shake-flask fermentation (1) Activation of strain: streaks of frozen Eurotium cristatum BC-43 strain spore liquid were used to form PDA slants and cultured at 28℃ for 3 days.

[0043] (2) Preparation of spore suspension: Sterile water was added to the slant of activated *Aspergillus cristatus* strain BC-43, and spores were scraped off with a scraper to prepare spore suspension.

[0044] (3) Seed culture: The spore suspension was inoculated into a 250ml Erlenmeyer flask at an inoculation rate of 5%, and the Erlenmeyer flask contained 100ml of PDA liquid culture medium. Then, the inoculated liquid culture medium was cultured at 28℃ and 150rpm for 5 days to obtain a fermentation broth containing fungal polysaccharides.

[0045] (4) Determination of fungal polysaccharide content in fermentation broth: The content of fungal polysaccharide in fermentation broth was determined to be 10 g / L using the phenol-sulfuric acid method described above.

[0046] (5) Separation of fermentation product rich in fungal polysaccharides: Evaporate and concentrate the fermentation broth to 1 / 4 of its original volume, add 4 times the volume of 95% ethanol, place it in a refrigerator at 4℃ for 10 h to allow the polysaccharides to precipitate, centrifuge at 8000 r / min, and the precipitate obtained is the fermentation product rich in fungal polysaccharides.

[0047] Example 3: Preparation of Fermentation Extract Rich in Fungal Polysaccharides via Liquid Submerged Fermentation (1) Activation of strain: streaks of frozen Eurotium cristatum BC-43 strain spore liquid were used to form PDA slants and cultured at 28℃ for 3 days.

[0048] (2) Preparation of spore suspension: Sterile water was added to the slant of activated *Aspergillus cristatus* strain BC-43, and spores were scraped off with a scraper to prepare spore suspension.

[0049] (3) Seed culture: The spore suspension was inoculated into 1L of sterilized PDB liquid medium at 2%, and then cultured at 30℃ and 120rpm for 5 days to obtain the seed culture solution.

[0050] (4) Inoculation and fermentation: 2L of seed culture was inoculated into a 50L fermenter containing a fermentation substrate with the following components: 18L water, 400g yeast extract, 30g ammonium dihydrogen phosphate, 5g ZnSO4, 3g FeSO4·7H2O, 50g KCl, and 80g MgSO4·7H2O. Fermentation was then carried out at 30℃ for 6 days to obtain a fermentation broth containing fungal polysaccharides. During fermentation, 10L of 20wt% sucrose aqueous solution was added at a rate of 100ml / h.

[0051] (5) Determination of fungal polysaccharide content in fermentation broth: The content of fungal polysaccharide in fermentation broth was determined to be 18 g / L using the phenol-sulfuric acid method described above.

[0052] (6) Separation of fermentation product rich in fungal polysaccharides: Evaporate and concentrate the fermentation broth to 1 / 4 of its original volume, add 4 times the volume of 95% ethanol, place it in a refrigerator at 4℃ for 10 h to allow the polysaccharides to precipitate, centrifuge at 8000 r / min, and the precipitate obtained is the fermentation product rich in fungal polysaccharides.

[0053] Example 4: Solid-state fermentation for the production of crude polysaccharide from *Aspergillus cristatus* (1) Activation of strains: streak frozen spores of *Eurotium cristatum* on PDA slant and incubate at 28°C for 3 days.

[0054] (2) Preparation of spore suspension: Sterile water was added to the activated slant of *Eurotium cristatum*, and spores were scraped off with a scraper to prepare a spore suspension.

[0055] (3) Seed culture: The spore suspension was inoculated into 0.5L of the prepared seed culture medium and cultured at 28℃ and 160rpm for 3 days.

[0056] (4) Fermentation: The solid culture medium includes 700g of a mixture of wheat bran and corn flour in a mass ratio of 5:1, 700g of water, 47g of glucose, 78g of ammonium sulfate, 24g of potassium dihydrogen phosphate, and 8g of magnesium sulfate; ferment at 30℃-35℃ for 5 days.

[0057] (5) Preparation of broken-cell wall Ascospores of *Ascomycota cristatum*: After drying 125g of solid fermentation material, the spores were gently rubbed to separate them from the substrate and passed through a 200-mesh sieve to obtain 25g of *Ascomycota cristatum* spores. The spores were broken by repeated freeze-thaw grinding. 25g of *Ascomycota cristatum* spores were weighed and placed into five 50 mL centrifuge tubes. 20 mL of 70% ethanol was added and shaken to mix. The centrifuge tubes were cooled in liquid nitrogen for 5 min, then removed and placed in a water bath at 95 ℃ for 5 min. This process was repeated 3 times. The spore suspension was then transferred to a mortar and ground for 10 min. The mixture was dried under reduced pressure to obtain 20g of broken-cell wall Ascomycota cristatum spores.

[0058] (6) Isolation of fermentation product rich in fungal polysaccharides: Take 20 g of broken spores, add 300 mL of distilled water, reflux extract at 55℃ for 4 h, filter to remove precipitate, add 60 mL of Sevage reagent (chloroform: n-butanol = 5:1 (V / V)) to the filtrate and mix and shake for 30 min, centrifuge and take the supernatant, concentrate to 100 mL, add 400 mL of 95% ethanol, place in a refrigerator at 4 ℃ for 24 h to precipitate polysaccharides, centrifuge at 8000 r / min to collect the precipitate, and the obtained 4 g of precipitate is the fermentation product rich in fungal polysaccharides.

[0059] (7) Determination of polysaccharide content in the original fermentation product: Dissolve 1g of the precipitate obtained in (6) in 100ml of water and determine the polysaccharide content by phenol-sulfuric acid method. The polysaccharide content in the precipitate was 781g / kg, which is equivalent to 156.2g / kg of fungal polysaccharide in the broken spores, 125g / kg of fungal polysaccharide in the Aspergillus cristatus spores, and 25g / kg of fungal polysaccharide in the solid fermentation material.

[0060] Example 5: Determination of cholesterol clearance rate of fermentation extract rich in fungal polysaccharides. Accurately weigh 1g of the fungal polysaccharide-rich fermentation products prepared in Examples 2, 3, and 4 and place them in 50mL centrifuge tubes. Add 10mL of cholesterol standard solution (6.0mmol / L). Incubate at 37℃ with shaking for 16h, centrifuge at 10000rpm for 6 minutes, and obtain the supernatant as the test solution. Use 10mL of cholesterol standard solution without the addition of fungal polysaccharide-rich fermentation extract as a blank control group. Determine the cholesterol content in the supernatant using the phthalaldehyde method described below, and calculate the cholesterol scavenging rate of the fungal polysaccharide-rich fermentation extract using the following formula.

[0061] The calculation formula is as follows: Cholesterol clearance rate (%) = 100% * (cholesterol content in blank control group - cholesterol content in sample group) / cholesterol content in blank control group Cholesterol content determination method: o-phthalaldehyde method (1) Draw the standard curve: Samples 1-7 were prepared as shown in Table 2 below. Concentrated sulfuric acid should be added slowly and mixed thoroughly. After standing at room temperature for 10 minutes, the OD values ​​of samples 1-7 were measured using a spectrophotometer. 550 value.

[0062] Table 2 (2) Cholesterol content determination: The prepared test solution and blank control group were diluted 5 times, and 400 μL were pipetted into 15 mL centrifuge tubes, and three parallel aliquots were taken. 2 mL of phthalaldehyde reagent and 1 mL of 95% sulfuric acid solution were added to each aliquot, and mixed thoroughly. After standing at room temperature for 10 min, the OD values ​​of the three treated test solutions and the blank control group were measured using a spectrophotometer. 550 The cholesterol content of the test solution was calculated based on the standard curve, and the cholesterol clearance rates of the ferments rich in fungal polysaccharides prepared in Examples 2, 3, and 4 were calculated to be 59%, 65%, and 63%, respectively, according to the formula described above.

[0063] Example 6: Determination of the inhibitory effect of a fermentation extract rich in fungal polysaccharides on tumors. (1) Preparation of aqueous solution of fermentation extract rich in fungal polysaccharides: Dissolve the fermentation products rich in fungal polysaccharides from Examples 2, 3 and 4 in distilled water, with a crude polysaccharide concentration of 0.5 g / ml. Dispense 10 ml of the resulting aqueous solution of fermentation extract rich in fungal polysaccharides into sterile test tubes of 18 mm * 180 mm and store at 4 °C for later use.

[0064] (2) Experimental animals: 43 Kunming mice, half male and half female, weighing 18-22g, 5-6 weeks old, provided by the Medical College of Three Gorges University.

[0065] (3) Experimental cells: HepG2 liver cancer cell line, purchased from Southern Medical University and stored in liquid nitrogen.

[0066] (4) Culture and inoculation of HepG2 liver cancer cell line: Three mice were randomly selected, and the HepG2 liver cancer cell line was subcutaneously injected into the right axilla of the mice. Ascites fluid was collected from the mice 7 days after inoculation. The fluid was milky white, centrifuged, washed three times with sterile water, and the cell concentration was adjusted to 1*10. 7 The cell solution was diluted to cfu / g and inoculated into the next generation of mice. This process was repeated twice. Seven days after inoculation, ascites fluid was collected from the mice; the fluid was milky white, centrifuged, and washed three times with sterile water. The resulting cell solution was then inoculated subcutaneously into the right axilla of the remaining 40 Kunming mice, 0.2 ml per mouse. Strict aseptic technique was maintained throughout the entire process.

[0067] (5) Experimental grouping: Forty mice were randomly divided into four groups and housed in separate cages with free access to food and water. Group 1 was the control group, which was given physiological saline; the other three groups were the experimental groups, which were given aqueous solutions of the fermented extracts rich in fungal polysaccharides prepared in steps (1) of Examples 2, 3, and 4, respectively. All four groups of mice were administered the drugs orally by gavage twice daily for three consecutive weeks, and their external characteristics and mortality were observed. After the administration was completed, the mice were sacrificed the next day, the tumor tissue was completely removed, the tumor weight was measured, and the tumor inhibition rate was calculated using the following formula: Tumor inhibition rate (%) = 100% * (1 - average tumor weight in experimental group / average tumor weight in control group) (6) Test results: The aqueous solutions of the fermented extracts rich in fungal polysaccharides in Examples 2, 3 and 4 showed tumor inhibition rates of 37.85%, 39.62% and 38.03% against mouse liver cancer, respectively.

[0068] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention shall be included within the protection scope of the present invention. sequence list <110> Hubei Angel Biotechnology Group Co., Ltd. <120> A strain of *Aspergillus cristatus* producing fungal polysaccharides and its application <160> 1 <170> SIPOSequenceListing 1.0 <210> 1 <211> 526 <212> DNA <213> Eurotium cristatum <400> 1 gctacgagtg cgggtctctg ggtcaacctc ccatccgtgt ctatctgtac cctgttgctt 60 cggcgtggcc acggcccgcc ggagaactaac atttgaacgc tgtctgaagt ttgcagtctg 120 agtttttagt taaacaatcg ttaaaacttt caacaacgga tctcttggtt ccggcatcga 180 tgaagaacgc agcgaaatgc gataattaat gtgaattgca gaattcagtg aatcatcgag 240 tctttgaacg cacattgcgc cccctggtat tccggggggc atgcctgtcc gagcgtcatt 300 gctgccctca agcacggctt gtgtgttggg cttccgtccc tggcaacggg gacgggccca 360 aaaggcagtg gcggcaccat gtctggtcct cgagcgtatg gggctttgtc acccgctccc 420 gtaggtccag ctggcagcta gcctcgcaac caatcttttt aaccaggttg acctcggatc 480 aggtagggat acccgctgaa cttaagcata tcaaaggcgg gaggaa 526

Claims

1. A species of *Eurotium cristatum* ( Eurotium cristatum BC-43 strain, characterized in that, The Coronavirus ( Eurotium cristatum The BC-43 strain is deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: M 20211417.

2. The *Eurotium cristatum* as described in claim 1 (… Eurotium cristatum BC-43 strain, characterized in that, The Coronavirus ( Eurotium cristatum The ITS gene sequence of strain BC-43 is shown in SEQ ID NO.

1.

3. The application of the *Aspergillus cristatus* BC-43 strain according to claim 1 or 2 in the fermentation production of fungal polysaccharides.

4. A fermentation product rich in fungal polysaccharides, prepared by a method comprising the following steps: (1) The *Aurotriarcha BC-43* strain described in claim 1 or 2 is subjected to seed culture to obtain *Aurotriarcha BC-43* strain seed culture solution; (2) The seed culture broth of *Aspergillus cristatus* strain BC-43 was added to the fermentation medium for fermentation. After fermentation for 3-6 days, the fermentation product rich in fungal polysaccharides was extracted. During extraction, fungal polysaccharides are extracted by precipitating them with ethanol.

5. The fermented product according to claim 4, characterized in that, The fermentation product has a cholesterol clearance rate of 59%-65%.

6. The method for preparing the fermentation product rich in fungal polysaccharides according to claim 4 or 5, characterized in that, Includes the following steps: (1) The *Aurotriarcha BC-43* strain described in claim 1 or 2 is seed cultured to obtain *Aurotriarcha BC-43* strain seed culture solution; (2) The seed culture of the *Aspergillus cristatus* strain BC-43 was added to the fermentation medium and fermented. After fermentation for 3-6 days, the fermentation product rich in fungal polysaccharides was obtained by extraction. During extraction, the fungal polysaccharides were extracted by precipitating them with ethanol.

7. The method according to claim 6, characterized in that, The temperature for seed culture in step (1) is 28-30℃.

8. The method according to claim 6, characterized in that, The seed culture was performed using an oscillation culture method.

9. The method according to claim 8, characterized in that, The oscillation frequency is 100-250 rpm.

10. The method according to claim 8, characterized in that, The seed culture time is 20-70 hours.

11. The method according to claim 6, characterized in that, The fermentation described in step (2) is either solid-state fermentation or liquid fermentation.

12. The method according to claim 6, characterized in that, The fermentation temperature in step (2) is 28-30℃.

13. The method according to claim 11, characterized in that, The liquid fermentation speed is 150-200 rpm.

14. The method according to claim 11, characterized in that, The liquid fermentation ventilation rate is 600L / h-3000L / h.

15. The method according to claim 11, characterized in that, The culture medium used for the liquid fermentation contains 15-60 parts of carbon source, 1.5-5 parts of nitrogen source, 0.1-0.5 parts of phosphorus source, 0.03-1 parts of ZnSO4, 0.03-1 parts of FeSO4·7H2O, 0-10 parts of KCl and 1-10 parts of MgSO4·7H2O.

16. The method according to claim 15, characterized in that, The carbon source is selected from one or more of glucose, sucrose, maltose, molasses, and starch.

17. The method according to claim 15, characterized in that, The nitrogen source includes one or more of the following: yeast extract, peptone, corn steep liquor, soybean meal, ammonium sulfate, ammonia, sodium nitrate, and urea.

18. The method according to claim 11, characterized in that, The liquid fermentation includes a fed-batch fermentation process.

19. The method according to claim 18, characterized in that, The fed-batch fermentation medium contains 15-30 wt% sucrose.

20. The method according to claim 19, characterized in that, The fed-batch fermentation medium contains 20 wt% sucrose.

21. The method according to claim 18, characterized in that, The feed rate of the fed fermentation medium is 50-200 ml / h.

22. The method according to claim 11, characterized in that, The culture medium used for solid-state fermentation contains, by mass percentage, 45%-55% water, 0.5%-4% glucose, 2-8% ammonium sulfate, 0.5-1.5% potassium dihydrogen phosphate and 0-0.5% magnesium sulfate, with the remainder being wheat bran and corn flour, wherein the mass ratio of wheat bran to corn flour is 2-5:

1.

23. The method according to claim 6, characterized in that, In step (2), the inoculation amount is 1-10% by weight.

24. The use of the fermentation product rich in fungal polysaccharides as described in claim 4 or 5 in the preparation of lipid-lowering drugs, anti-liver cancer drugs, pharmaceuticals for lipid-lowering and weight loss, and health products that help control body fat.

Images