Application of eggplant glycosyltransferase smugt89b2 in increasing rutin content of plants

Abstract

The application belongs to the technical field of plant genetic engineering, and specifically discloses application of eggplant glycosyltransferase SmUGT89B2 in improving rutin content of plants. The research result of the application shows that the eggplant glycosyltransferase SmUGT89B2 can participate in regulating the content of rutin synthesized in plants, the amino acid sequence of the eggplant glycosyltransferase SmUGT89B2 is shown as SEQ ID NO. 1, and the nucleotide sequence for coding the amino acid is shown as SEQ ID NO. 2. The expression level of the eggplant glycosyltransferase SmUGT89B2 is positively correlated with accumulation of the rutin content in a very significant manner. The eggplant glycosyltransferase SmUGT89B2 is introduced into tomatoes to perform heterologous overexpression, and the rutin content of the obtained transgenic plants is significantly improved. Through high expression of the eggplant glycosyltransferase SmUGT89B2, plants with higher rutin content can be obtained, which has important significance for creating plants with high rutin content.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, and specifically discloses the application of eggplant glycosyltransferase (SmUGT89B2) in increasing the rutin content of plants. Background Technology

[0002] Eggplant (Solanum melongena L.) is one of the important solanaceous vegetables in my country, widely cultivated throughout the country with abundant germplasm resources. As a popular vegetable, eggplant is rich in dietary fiber, protein, and various vitamins, with vitamin P content significantly higher than most other vegetables.

[0003] Vitamin P, also known as rutin, is a natural flavonoid compound that benefits both plant growth and development and human health. Rutin possesses antioxidant, insect-resistant, and pathogen-resistant properties. Besides its important role in plants, it also exhibits various pharmacological activities, such as free radical scavenging activity, antioxidant capacity, UV protection, and antihypertensive activity, making it widely applicable. The rutin biosynthesis pathway is now relatively clear, with the final enzymatic step involving glycosyltransferases catalyzing the formation of rutin from quercetin. Glycosylation is an important modification reaction, typically the final step in the biosynthesis of natural compounds. It coordinates with various other modifications, contributing to the diversity and complexity of plant secondary metabolites. Glycosylation, ubiquitous in plants, is catalyzed by glycosyltransferases (GTs) (EC2.4.xy). With the development of genomics, more and more UGT genes in plants have been identified, but research on the involvement of glycosyltransferases in eggplant rutin biosynthesis is currently scarce. Summary of the Invention

[0004] In view of the shortcomings of the existing technology, the first objective of the present invention is to provide an eggplant glycosyltransferase SmUGT89B2, the amino acid sequence of which is shown in SEQ ID NO.1.

[0005] The present invention also provides a nucleotide sequence encoding the above-mentioned solanaceous glycosyltransferase SmUGT89B2, the nucleotide sequence of which is shown in SEQ ID NO.2.

[0006] Another object of the present invention is to provide a recombinant containing the above-described nucleotide sequence.

[0007] Preferably, the recombinant is a recombinant vector, a recombinant plasmid, a transformant, or a host.

[0008] A third objective of this invention is to provide the application of the above-mentioned eggplant glycosyltransferase SmUGT89B2 or the nucleotide sequence thereof in increasing the rutin content of plants.

[0009] This invention clones a glycosyltransferase gene, SmUGT89B2, from eggplant and silences it using virus-induced gene silencing (VIGS), resulting in a significant reduction in rutin content in the silenced plants. When SmUGT89B2 is transferred into tomato and heterologously overexpressed, the resulting transgenic plants show a significant increase in rutin content, providing theoretical support and broad application prospects for creating eggplants with high rutin content.

[0010] Preferably, the application includes at least the following aspects:

[0011] (1) Construct a recombinant overexpressing the eggplant glycosyltransferase SmUGT89B2, transform the constructed recombinant into plants, and screen to obtain positive transgenic plants; wherein, compared with wild plants, the positive transgenic plants have increased rutin content;

[0012] (2) Screening reagents that can induce the expression of solanine glycosyltransferase SmUGT89B2 in plants.

[0013] Compared with the prior art, the beneficial effects of the present invention are:

[0014] This invention demonstrates for the first time that the eggplant glycosyltransferase SmUGT89B2 can participate in regulating the rutin content synthesized in plants, and its expression level is significantly positively correlated with rutin accumulation. Silencing the UGT gene using virus-induced gene silencing (VIGS) significantly reduced rutin content in the silenced plants. Transforming SmUGT89B2 into tomatoes for heterologous overexpression resulted in transgenic plants with significantly increased rutin content. Besides its important role in plants, rutin also possesses various pharmacological activities. The implementation of this invention will provide theoretical reference for the research on breeding plant varieties with high rutin content. Attached Figure Description

[0015] Figure 1 The illustration shows the accumulation analysis of rutin content in eggplant according to the present invention. A: Rutin content in different tissue parts of eggplant; B: Rutin content in different developmental stages of eggplant fruit.

[0016] Figure 2This diagram illustrates the cloning, sequence analysis, and phylogenetic analysis of the eggplant SmUGT89B2 gene of this invention. A: Cloning of SmUGT89B2; B: Base and amino acid sequences of SmUGT89B2; C: Sequence structure analysis of the SmUGT89B2 gene; D: Evolutionary analysis of SmUGT89B2. The phylogenetic tree was constructed using MEGA-11 software with the maximum likelihood method, a bootstrap value of 1000, and other parameters set to default. The phylogenetic trees are SvUGT89B2-like (XP_049367299.1) and SsUGT89B2-like (XP_049396404). 1) StUGT89B(XP_006345089.1), SlUGT89B2(XP_004236081.1), NtUGT89B2(XP_009610812.1), CaUGT89B2(XP_016563395.1), AtUGT89B1, SmUGT89B2(SMEL4_03g006600.1.01), NtUGT(UHH90515.1), CaUGT89B1(KAF3668267.1); E: Conserved motif analysis of SmUGT89B2 and homologous genes.

[0017] Figure 3 Tissue specificity and correlation analysis of SmUGT89B2 of the present invention.

[0018] Figure 4 To illustrate the expression of SmUGT89B2 and rutin content in silenced plants of this invention, A: Eggplant seedlings and fruits with silenced SmUGT89B2 gene, scale bar: 1cm; B: Detection of TRV virus CP gene in silenced plants, M: DL2000; 1-8: pTRV2-SmUGT89B2; 9-10: pTRV2-empty vector; 11-12: CK; C: Expression of SmUGT89B2 in silenced plants and rutin content in corresponding plant leaves and fruits.

[0019] Figure 5 For the identification of transgenic plants of this invention, A: DNA identification of transgenic plants; B: Comparison of transgenic plants with wild-type plants (WT), scale bar: 5cm; C: Relative expression level of SmUGT89B2 in transgenic plants and WT, ** indicates P<0.01; D: Determination of rutin content in leaves, stems and fruits of transgenic plants. Detailed Implementation

[0020] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0021] Unless otherwise specified, the experimental methods used in the embodiments of this invention are conventional methods; unless otherwise specified, the materials and reagents used are commercially available.

[0022] Example 1: Tissue-specific expression analysis of the eggplant glycosyltransferase gene SmUGT89B2

[0023] 1. Materials and Methods

[0024] 1.1 Materials

[0025] The eggplant materials “Huayan 5” and “E636” inbred lines were provided by Professor Cao Bihao of the College of Horticulture, South China Agricultural University, and the tomato material “Money-Maker” was provided by Teacher Qiu Zhengkun of the College of Horticulture, South China Agricultural University. The Escherichia coli strain DH5α and Agrobacterium tumefaciens strain GV3101 were purchased from Shanghai Weidi Biotechnology Co., Ltd.

[0026] 1.2 RNA extraction, cDNA synthesis and qRT-PCR analysis

[0027] Eggplant roots, stems, leaves, flowers, and fruits were used as samples, with each sample taken in triplicate. Total RNA was extracted from each plant tissue according to the PromegaTotal RNA Extraction Kit instructions. Reverse transcription was performed using the III 1st Strand cDNA Synthesis SuperMix for qPCR (gDNA Digester Plus) kit according to the instructions. The reaction mixture consisted of 3 μL of 5×gDNA Digester Mix, 1 μg of total RNA, and 15 μL of RNase-free H2O. After incubation at 42°C for 2 min, 2 μL of 10×Hifair III SuperBuffer was added to the above reaction mixture. IIIRTEnzymeMix-1μL, RandomPrimersN6orOligo(dT) 18-1 μL; the reaction program was: 25℃-5 min, 55℃-15 min, 85℃-5 min. For qRT-PCR, follow the instructions for the ChamQ Universal SYBR qPCR MasterMix kit. The reaction system was as follows: qPCR was performed using SYBR GreenMaster Mix (5 μL), Forward Primer (0.5 μL), Reverse Primer (0.5 μL), Template DNA (1 μL), and RNase-free ddH2O (3 μL). The reaction program was: 95℃ for 5 min; 5℃ for 10 s, 55℃ for 20 s, 72℃ for 20 s, for 40 cycles. Each sample underwent three biological replicates and three technical replicates, using eggplant 18S rRNA as an internal reference gene. -ΔCt and 2 -ΔΔCt The method is used for data analysis.

[0028] The primer sequences involved are as follows:

[0029] 18SrRNA-F:CGCGCGCTACACTGATGTATTCAA,

[0030] 18SrRNA-R:TACAAAGGGCAGGGACGTAGTCAA,

[0031] SmUGT89B2-F: CTCATCTTCCTTATCCAGCAC,

[0032] SmUGT89B2-R:GAACGGAACCCATTAGCG.

[0033] 1.3 Extraction and determination of rutin from eggplant

[0034] Rutin was extracted and its content determined from five different tissue parts of eggplant: roots, stems, leaves, flowers, and fruits, as well as the pericarp and pulp at different developmental stages of the fruit. The method followed (Dong Riyue et al., 2017), with the following specific steps: Fresh eggplant tissue was ground into powder in liquid nitrogen, and 0.10 g was weighed and mixed with 2 mL of 60% ethanol by inverting. The mixture was centrifuged at 12000 rpm for 10 min, and the supernatant was transferred to a new 2 mL centrifuge tube and heated in a metal bath at 80℃ for 2 h. After heating, 0.4 mL of the extract was taken, and 0.4 mL of 0.1 mol / L aluminum trichloride (AlCl3) solution and 0.6 mL of 1 mol / L potassium acetate (CH3COOK) solution were added. Finally, the volume was adjusted to 2 mL with 60% ethanol (CH3CH2OH) solution, gently inverted, and allowed to stand for 30 min. The reaction solution was then added to an ELISA plate, with each sample containing three technical replicates. The absorbance was measured using a microplate reader with a wavelength of 420 nm. Finally, the rutin content was calculated based on the rutin standard curve and its content formula.

[0035] 2. Results Analysis

[0036] 2.1 Cumulative Analysis of Rutin Content in Eggplant

[0037] Using "Huayan No. 5" as material, the rutin content in its roots, stems, leaves, flowers, and fruits during the flowering and fruiting period was determined. The results showed that ( Figure 1 A) The accumulation of rutin in eggplant is not tissue-specific. Rutin can be detected in all five tissue parts mentioned above. The highest rutin content is found in the leaves (9.696 mg / g), followed by the fruit (4.676 mg / g), flower (3.239 mg / g), stem (2.676 mg / g), and root (2.337 mg / g).

[0038] Eggplant fruits at different developmental stages (5d, 7d, 9d, 11d, 13d, 15d, 17d, 21d, 30d, and 40d after flowering) were collected, and the rutin content in their peel and pulp was determined. Figure 1 B. The rutin content of young eggplant fruits is highest 5 days after flowering. The rutin content in the eggplant peel is significantly higher than that in the flesh, with the most significant difference occurring during the commercial maturity period (13 to 17 days after flowering). As the fruit develops, the rutin content in the peel generally shows a trend of first decreasing, then increasing, and then decreasing again. The rutin content in eggplant gradually increases 7 days after flowering and reaches its peak at 15 days after flowering. In contrast, the rutin content in the flesh begins to decrease 5 days after flowering, then levels off at 7 days, until 21 days after flowering, when the fruit gradually ages, and the rutin content in both the peel and flesh gradually decreases.

[0039] 2.2 SmUGT89B2 Sequence Analysis

[0040] Using cDNA from "Huayan No. 5" and "E636" materials as templates, primers were designed based on existing sequences in the eggplant reference genome to amplify and recover the full-length CDS of SmUGT89B2. Figure 2 A), ligated to T, then sent for sequencing, the sequence obtained ( Figure 2 B) The sequence is completely identical to the sequence in the genome. Analysis of this gene sequence shows that the CDS length of the SmUGT89B2 gene is 1452 bp, encoding 483 amino acids, and it contains no introns or UTR regions. Figure 2 C). To understand the evolutionary relationships of the SmUGT89B2 gene, it was BLASTed in NCBI, the Arabidopsis database (https: / / www.arabidopsis.org / ), and the Solanaceae database (http: / / solgenomics.net / ) to obtain highly similar UGT genes, and a phylogenetic tree was constructed. The results are as follows: Figure 2 The D,SmUGT89B2 gene is highly homologous to the UGT89B2 gene in tomato and potato, with a similarity exceeding 90%. Conserved motifs of these genes were predicted using MEME (https: / / meme-suite.org / meme / ), such as... Figure 2 E. These genes all have similar conserved motifs. Among them, Motif2 is a conserved domain common to the glycosyltransferase family. The conserved sequence includes 44 amino acids and is named PSPG-box (Plant Secondary Product Glycosyltransferase). It is a typical feature of plant UGT. However, none of the above genes have been reported yet, and the functions of the related genes need to be further verified through experiments.

[0041] 2.3 Tissue-specific analysis of SmUGT89B2

[0042] Using "Huayan No. 5" as material, the expression pattern of SmUGT89B2 in different tissues of eggplant was analyzed by qRT-PCR. Figure 3 SmUGT89B2 was expressed in eggplant roots, stems, leaves, flowers, and fruits, with the highest expression in leaves, followed by fruits > roots > stems > flowers. Further analysis of the correlation between the expression level of SmUGT89B2 in each tissue and the content of rutin in each tissue of eggplant showed that the expression level of SmUGT89B2 was significantly positively correlated with the accumulation of rutin in eggplant.

[0043] Example 2: Effect of Virus-Induced Gene Silencing (VIGS) on Rutin Synthesis

[0044] This experiment used a system composed of tobacco brittle virus pTRV1 and pTRV2 to infect eggplant leaves and fruits. By silencing SmUGT89B2 in eggplant, its effect on rutin biosynthesis was investigated. The CDS sequence of SmUGT89B2 was submitted to the Solanaceae database (https: / / solgenomics.net) using VIGSTool to select a 300bp silencing fragment. Specific primers were designed, and SmUGT89B2 was ligated into the pTRV2 vector using double enzyme digestion. The primer sequences used were pTRV2-SmUGT89B2: Forward sequence (5'-3' containing EcoRI restriction site): CGGAATTCCTCATCTTTCCTTATCCAGCAC; Reverse sequence (5'-3' containing KpnI restriction site): GGGGTACCGAACGGAACCCATTAGCG. After vector construction, the *Agrobacterium* strain GV3101 was introduced. Eggplant seedlings with uniform growth and 1-2 true leaves were selected for infection. Seedlings injected with a 1:1 volume ratio of pTRV1 and pTRV2 empty vectors, along with uninjected seedlings, served as the control group. Seedlings injected with an equal volume mixture of pTRV1 empty vector and pTRV2-SmUGT89B2 bacterial solution served as the treatment group. After injection, seedlings were treated at 18°C ​​in the dark for 24 hours, followed by normal culture for 1-2 weeks (21°C, 16 hours light, 8 hours dark). Samples were taken at least 12 biological replicates for each treatment. For VIGS silencing in eggplant fruits, young eggplant fruits 10 days after flowering were selected for infection. The bacterial solution was injected into the eggplant pulp tissue using a 1 mL sterile syringe through the pericarp. The bacterial solution preparation and culture conditions were the same as above, with at least 10 biological replicates for each treatment. Two weeks later, samples were taken, RNA was extracted and analyzed by qPCR, and the rutin content in the leaves and fruits of the control group and the treatment group was measured.

[0045] Results Analysis

[0046] Using "Huayan No. 5" as material, the SmUGT89B2 gene was silenced in eggplant using VIGS technology to verify whether it affects the rutin content in eggplant. Eggplant seedlings (1-2 true leaves) and fruiting plants (10 days after flowering) were injected with Agrobacterium tumefaciens containing pTRV2-SmUGT89B2. RNA was extracted from new leaves and fruits 14 days after injection, and cDNA was obtained by reverse engineering. Using cDNA as a template, the CP protein (coat protein) of the TRV virus was detected. A total of 8 positive plants were identified. qRT-PCR analysis showed that compared with plants injected without the vector, the expression level of the SmUGT89B2 gene in three of the positive plants decreased by more than 50%. Figure 4C) Further analysis of rutin content revealed that the rutin content in the leaves and fruits of the three plants was significantly lower than that of the untreated plant. These results indicate that silencing SmUGT89B2 can significantly reduce the rutin content in eggplant.

[0047] Example 3: Cloning, overexpression, and construction of transgenic lines of the eggplant glycosyltransferase gene SmUGT89B2

[0048] 1. Gene cloning and isolation

[0049] Using the cDNA of the eggplant inbred line “E636” as a template, and based on the sequence alignment results from the Solanaceae database, and referring to high-fidelity enzymes… Green Taq Mix and pMD TM The instructions for the 19-T Vector Cloning Kit are as follows: clone SmUGT89B2 and ligate it into the pMD19-T vector. The primer sequence is SmUGT89B2.

[0050] Forwardsequence(5'-3'):ATGTCTGAAAATCGCCCTCATG,

[0051] Reversesequence(5'-3'):CAGTTTGATTTTTGTAGCTCCTCC.

[0052] 2. Genetic transformation of SmUGT89B2 in tomato

[0053] Specific primers were designed based on the CDS region of SmUGT89B2 to amplify the target fragment with homologous arms (5' restriction site: BamHI, primer: gcgccgaattcccggggatccATGTCTGAAAATCGCCCTCATG; 3' restriction site: PstI, primer: cctcttaaagcttggctgcagTTACAGTTTGATTTTTGTAGCCTCCT), which was then ligated into the pCAMBIA-1380 vector. The recombinant vector was then transformed into Agrobacterium strain GV3101. Tomato genetic transformation was performed using Agrobacterium-mediated transformation. The steps and culture medium formulations are shown in Table 1, and the preparation and storage of hormones and antibiotics used are shown in Table 2. Transgenic strains were obtained.

[0054] Table 1

[0055]

[0056]

[0057] Table 2

[0058]

[0059] This experiment constructed the pCAMBIA-1380-SmUGT89B2 vector and performed heterologous overexpression experiments using tomato (MoneyMaker) as material via Agrobacterium infection. Approximately 3000 explants were infected. The genetic transformation process included pre-culture, co-culture, selective regeneration culture, and rooting culture. After rooting, the regenerated plants were identified at the DNA level. DNA was extracted from the regenerated plants and wild-type plants, and the target fragment SmUGT89B2 was amplified. Four positive plants were identified, as shown below. Figure 5 As shown in Figure A, they were named OE-SmUGT89B2#1, OE-SmUGT89B2#2, OE-SmUGT89B2#3, and OE-SmUGT89B2#4, respectively. To further confirm whether SmUGT89B2 was successfully overexpressed in tomato, RNA was extracted from the four transgenic plants and the control plants, reverse transcribed into cDNA, and then subjected to qRT-PCR to analyze the relative expression level of the SmUGT89B2 gene. The results are shown in Figure A. Figure 5 C. The expression levels of SmUGT89B2 in the leaves of transgenic plants were significantly higher than those in wild-type plants. OE-SmUGT89B2#1-4 were overexpressed by 14.75 times, 8.68 times, 9.56 times, and 4.8 times, respectively, compared with WT.

[0060] To further identify whether overexpression of the SmUGT89B2 gene affects rutin biosynthesis in transgenic plants, the rutin content in the leaves, stems, and fruits of transgenic plants was measured. The results showed that ( Figure 5 (D) The rutin content in the leaves, stems, and fruits of transgenic plants was significantly higher than that in WT plants, with the increase being more pronounced in the stems and leaves. Among the four transgenic lines, OE-SmUGT89B2#1 showed the greatest increase in rutin content, with rutin content in its leaves being 49.82% higher than that in WT, in its stems 40.49% higher, and in its fruits 10.35% higher. These results indicate that overexpression of SmUGT89B2 can increase the rutin content in plants to a certain extent, and this increase varies in different tissues.

[0061] Obviously, the specific implementation schemes described above are merely a further detailed explanation of the purpose, technical solution and beneficial effects of the present invention. It should be understood that the above descriptions are only specific examples of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. Overexpression of eggplant glycosyltransferase gene SmUGT89B2 Its application in increasing the rutin content of plants is characterized by... The eggplant glycosyltransferase gene SmUGT89B2 The nucleotide sequence is shown in SEQ ID NO. 2, and the plant is an eggplant or tomato.

2. The application according to claim 1, characterized in that, The application includes: constructing a gene that overexpresses the eggplant glycosyltransferase. SmUGT89B2 The recombinant was constructed and transformed into plants, and positive transgenic plants were obtained by screening. The positive transgenic plants had higher rutin content than wild-type plants.

Images