NLR genes for pm55 / suppm55 and its breeding utilization for resistance to wheat powdery mildew

Abstract

The application discloses an NLR gene pair Pm55 / SuPm55 and its breeding utilization for wheat powdery mildew resistance. The DNA sequences of the Pm55 / SuPm5 gene pair are SEQ ID NO. 1 and SEQ ID NO. 3, and the amino acid sequences encoded by the DNA sequences are SEQ ID NO. 2 and SEQ ID NO. 4. The gene is from Dasypyrum villosum. The Pm55 and SuPm5 genes are cloned, and the primer sequences are as shown in SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7 and SEQ ID NO. 8. The Pm55 / SuPm5 gene pair with a growth period and tissue-dependent broad-spectrum resistance to powdery mildew has high breeding utilization value, and can improve the disease resistance of wheat while having good agronomic characters and no negative effect on important characters such as yield. The developed co-dominant molecular marker assisted selection can be used to efficiently breed new wheat varieties with resistance to powdery mildew.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering and discloses a pair of NLR genes Pm55 / SuPm55 and their combined use in wheat powdery mildew resistance breeding methods. Background Technology

[0002] Common wheat is a global food crop and a staple food crop in my country. Its yield and quality are directly related to the food security of all mankind.

[0003] Utilizing host resistance to breed and promote disease-resistant varieties is the most economical, environmentally friendly, and sustainable strategy for controlling wheat powdery mildew. However, the widespread use of single resistance genes (mainly encoding NLR proteins) often results in the rapid loss of resistance due to changes in the physiological races of the pathogen. This forces breeding efforts to passively follow changes in pathogen races, severely restricting further improvements in wheat yield and quality. Therefore, it is necessary to discover new types of resistance sources with broad spectrum and durability, increase the genetic diversity of resistance genes, facilitate the promotion and utilization of resistant varieties, and enhance the commercial value of bred varieties.

[0004] Crop disease resistance often comes at the cost of yield. However, some paired NLR genes with antagonistic effects, under epigenetic regulation, exhibit growth period- and tissue-dependent resistance. This type of resistance is not only more durable than resistance throughout the entire growth period but also has no negative effect on yield, thus making it more valuable for breeding. Currently, numerous disease-resistant NLR genes for various crops have been cloned, but due to limitations such as genomic information, difficulties in phenotypic identification, and the large workload, the cloning of paired NLR genes with antagonistic effects is still relatively limited. Summary of the Invention

[0005] The purpose of this invention is to disclose a pair of NLR genes, Pm55 / SuPm55, and a method for using them together in wheat breeding for resistance to powdery mildew.

[0006] The DNA sequences of the Pm55 and SuPm55 genes described in this invention are located on the 5VS chromosome arm of *Triticum aestivum*. The full-length DNA sequence of the Pm55 gene is 3,896 bp, and its nucleotide sequence is shown in SEQ ID NO.1, encoding 1,267 amino acids, with the amino acid sequence shown in SEQ ID NO.2. The full-length DNA sequence of the SuPm55 gene is 2,651 bp, and its nucleotide sequence is shown in SEQ ID NO.3, encoding 566 amino acids, with the amino acid sequence shown in SEQ ID NO.4.

[0007] The amplification primer sequences for the Pm55 and SuPm5 genes described in this invention are as follows: SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, and SEQ ID NO.8.

[0008] Recombinant expression vectors containing the Pm55 or SuPm5 genes described above.

[0009] The application of the Pm55 / SuPm5 gene pair in the breeding of wheat varieties resistant to powdery mildew.

[0010] As a preferred embodiment of the present invention, a wheat-fleshed wheat T5DL.5VS translocation line carrying the Pm55 / SuPm5 gene pair is crossed with a susceptible common wheat variety, and a new wheat variety carrying the Pm55 / SuPm5 gene is bred through marker-assisted selection to improve the wheat's resistance to powdery mildew; the marker-assisted selection uses the primers shown in SEQ ID NO.13 and SEQ ID NO.14.

[0011] As another preferred embodiment of the present invention, the gene Pm55 is introduced into wheat varieties susceptible to powdery mildew through genetic engineering to improve their resistance to powdery mildew.

[0012] The application of the recombinant expression vector in the breeding of wheat varieties resistant to powdery mildew.

[0013] A codominant molecular marker primer for the Pm55 / SuPm5 gene, consisting of the primers shown in SEQ ID NO.13 and SEQ ID NO.14.

[0014] The application of the aforementioned molecular marker primers in wheat powdery mildew resistance breeding. By screening for homozygous materials containing the T5DL.5VS translocation chromosome through the aforementioned molecular markers, combined with agronomic trait selection, new lines carrying both the Pm55 and SuPm5 genes can be obtained.

[0015] Beneficial effects

[0016] This invention relates to the antagonistic NLR gene pair Pm55 / SuPm55, a novel powdery mildew resistance gene discovered from the wild wheat species *Dasypyrum villosum* (2n=2x=14, VV), which infiltrated into the wheat genome via the wheat-*Dasypyrum villosum* T5DL.5VS translocation line. Genetic segregating populations were constructed using T5DL.5VS translocation lines from different sources. *Dasypyrum villosum* 5VS genome sorting and sequencing and *Dasypyrum villosum* BAC library screening were performed to achieve map-based cloning of the Pm55 and SuPm55 genes. Gene function was verified using mutant, transgenic, and expression analysis techniques. The Pm55 / SuPm55 gene pair was found to confer broad-spectrum growth period and tissue-dependent resistance to wheat, without negative effects on important traits such as yield, demonstrating high breeding value. Furthermore, a co-dominant molecular marker for easily identifying the Pm55 / SuPm55 genes was developed, which will accelerate the breeding utilization of this gene pair. Wheat plants possessing the Pm55 / SuPm55 gene pair exhibit tissue-specific resistance to powdery mildew in the adult stage. This means that seedlings are not resistant, while in the adult stage, only the basal leaf sheaths show some susceptibility, while other parts exhibit high resistance. Because winter wheat seedlings are rarely affected by powdery mildew due to low temperatures, the later growth stage (spring) is the peak period for the disease. At this time, the basal leaf sheaths are no longer the primary photosynthetic organs and contribute less to yield. Therefore, susceptibility in the seedling stage and some susceptibility in the basal leaf sheaths in the adult stage helps the plant conserve energy consumed by resistance expression, allowing more photosynthetic products to be used for tillering and grain transport, thus promoting higher yields. Therefore, the Pm55 / SuPm55 gene pair represents a novel type of resistance gene. Breeding with this gene pair can effectively prevent yield losses caused by wheat powdery mildew in spring and reduce excessive energy consumption caused by the expression of resistance genes.

[0017] This invention, through map-based cloning and functional analysis, identified the Pm55 / SuPm5 gene pair, representing powdery mildew resistance in wheat that controls growth period and tissue dependence. This gene pair confers broad-spectrum and durable resistance in mature wheat plants. When used in disease resistance breeding, the Pm55 / SuPm5 gene pair significantly improves powdery mildew resistance in wheat varieties without negatively impacting yield traits. The T5DL.5VS translocation chromosome carrying the Pm55 / SuPm5 gene pair does not recombine with 5DS in the wheat background. Using the developed co-dominant molecular marker-assisted selection, new powdery mildew-resistant wheat varieties can be efficiently bred. Attached Figure Description

[0018] Figure 1The wheat-Triticum aestivum T5DL.5VS translocation line TF5V-1 carrying the Pm55 / SuPm5 gene exhibited tissue-differential resistance at the mature stage, meaning that the basal leaf sheath showed some susceptibility to disease, while other parts of the plant showed high resistance. Since the basal leaf sheath is not a primary photosynthetic organ in the later stages of wheat growth and contributes less to yield, some susceptibility in this area helps conserve energy, allowing more photosynthetic products to be transported to the grains. Therefore, the Pm55 / SuPm5 gene pair represents a novel type of disease-resistant gene. Figure 2 Precise localization of Pm55 and SuPm55 on 5VS (a), gene annotation of localization region (b), and candidate gene structures of both (c and d).

[0019] Figure 3 Functional analysis of the Pm55 gene. a. Pm55 and its promoter were used to construct transgenic expression vectors. b. Pm55 gene susceptible mutant site. c. Fielder transgenic T0 generation transgenic resistant plants of the Pm55 gene. d. Leaves of mature plants of the Pm55 susceptible mutant. The transgenic positive plants exhibited good disease resistance, indicating that Pm55 conferred powdery mildew resistance. The mutant results showed that after the Pm55 gene mutation, the plants were completely susceptible to disease, indicating that this gene is a key disease resistance gene.

[0020] Figure 4 Functional analysis of the SuPm55 gene. a) Verification of SuPm55 gene silencing using barley stripe virus (VIGS): Powdery mildew identification was performed on the fourth phenotypically shaped leaf. It was found that reduced SuPm55 gene expression led to leaf resistance, indicating that the SuPm55 gene inhibited the resistance of the Pm55 gene. b) Silencer efficiency test: Silencing significantly reduced SuPm55 expression. c) Four CRISPR / Cas9 transgenic mutants of the SuPm55 gene knocked out. d) The four CRISPR / Cas9 mutants of the SuPm55 gene showed seedling resistance to powdery mildew. e) The four CRISPR / Cas9 mutants of the SuPm55 gene showed adult leaf sheath resistance to powdery mildew.

[0021] Figure 5 Effects of four CRISPR / Cas9 mutants of the SuPm55 gene on agronomic traits. Compared with TF5V-1, all four mutants of the SuPm55 gene showed reduced tiller number (a), reduced panicles per plant (c), and reduced yield per plant (f). Plant height (b), number of grains per panicle (d), and thousand-grain weight (e) showed no significant differences.

[0022] Figure 6A flowchart illustrating the efficient utilization of the wheat-wheat T5DL.5VS translocation line carrying the Pm55 / SuPm5 gene. This mainly involves using a high-yielding, disease-susceptible variety as a recurrent parent, crossing it with the T5DL.5VS translocation line 1-2 times, backcrossing, identifying agronomic traits and powdery mildew resistance in the field after the segregating generations, and further identifying superior individual plants using codominant molecular markers to obtain excellent new lines.

[0023] Figure 7 The codominant molecular marker NAU7240 was used to identify materials carrying the Pm55 / SuPm5 gene. Leaf DNA from the selected materials was amplified by PCR using the codominant molecular markers P11 / P12, and the amplification products were subjected to 1.0% agarose gel electrophoresis. TF5V-1 carrying the Pm55 / SuPm5 gene amplified a specific band on 5VS but lacked a band on 5DS.

[0024] Figure 8 New backcross lines carrying the Pm55 / SuPm5 gene and their recurrent parents were developed. Through backcrossing and marker-assisted selection, new lines with the same agronomic traits as the recurrent parents but with high resistance to wheat powdery mildew were obtained. Detailed Implementation

[0025] Example 1: Map-based cloning of the powdery mildew resistance gene Pm55 / SuPm5

[0026] To identify the growth period and tissue-dependent powdery mildew resistance genes carried by *Triticum aestivum* 5VS, the T5DL.5VS chromosome from the resistant wheat-*Triticum aestivum* translocation line TF5V-1 (Zhang et al., 2016) was sorted, sequenced, and assembled at the scaffolds level. Bioinformatics methods were used to screen sequences on 5VS and perform gene annotation to obtain NLR genes. Through fine mapping, combined with genotype and phenotypic data, it was found that two loci, Pm55 and SuPm55, simultaneously control growth period and tissue-dependent powdery mildew resistance. Based on BAC cloning and gene annotation of the mapped regions, it was preliminarily determined that both Pm55 and SuPm55 genes are NLR genes. Figure 2 a and b). The published genome sequence of Triticum aestivum 91C43... DHUsing the sequence as a template (Zhang et al., 2022), specific primers P1 (GATCCTGACCATGGAAATTTC, SEQ ID NO.5) and P2 (TTCTATGCGCCAAACCTTGTTC, SEQ ID NO.6) were designed to clone the full-length Pm55 DNA sequence. Specific primers P3 (TTAGGTACACGCAATTTCAA, SEQ ID NO.7) and P4 (CCTCAAATTAAGCTAGTGAG, SEQ ID NO.8) were designed to clone the SuPm55 gene DNA sequence. Simultaneously, the full-length cDNA of TF5V-1 seedlings induced by powdery mildew race E09 was sequenced to obtain the coding regions of Pm55 and SuPm55, clarifying the gene structures of Pm55 and SuPm55. Figure 2 c and d).

[0027] Example 2 uses transgenic technology and susceptible mutants to verify the function of the Pm55 gene.

[0028] The full-length sequence was amplified from the plasmid DNA of Pm55 using specific primers P1 (GATCCTGACCATGGAAATTTC, SEQ ID NO.5) and P2 (TTCTATGCGCCAAACCTTGTTC, SEQ ID NO.6). Homologous recombination was used to ligate the target fragment into a vector. For the ligation reaction, the plGy-OE3 vector (Nanjing Novizan Biotechnology Co., Ltd.) was digested and purified with restriction endonucleases StuⅠ and BamHI. A homologous arm with the corresponding restriction site was added to the 5' end of the cloning primers to facilitate recombination ligation. The obtained PCR product also required further purification before ligation. Ligation was performed according to the Novizan ClonExpress II One Step Cloning Kit instructions. The resulting cells were transformed into *E. coli*, and single clones were selected for sequencing verification. Finally, the transgenic overexpression vector pUbi:Pm55 was constructed. The pUbi:Pm55 plasmid was transformed into the powdery mildew-susceptible wheat variety Fielder via Agrobacterium infection. In the T0 generation, PCR amplification of the Pm55 gene was performed using primers P1 (GATCCTGACCATGGAAATTTC, SEQ ID NO.5) and P2 (TTCTATGCGCCAAACCTTGTTC, SEQ ID NO.6). Leaves from positive plants were collected for in vitro identification of powdery mildew. T0 generation self-pollination extended to T1 generation positive plants, which were then inoculated with powdery mildew at both the seedling and adult stages to verify the function of the Pm55 gene. The powdery mildew resistance identification results showed that, compared with the transgenic recipient material Fielder, the leaves of six wheat plants overexpressing the Pm55 gene exhibited significantly increased resistance at both the seedling and adult stages, further demonstrating the positive regulatory role of the Pm55 gene in wheat powdery mildew. Figure 3 (a) and (c) 1,000 seeds of TF5V-1 were subjected to EMS mutagenesis at a concentration of 1.0%. M0 plants were planted in the field, yielding approximately 500 M1 plants. 10-20 seeds were collected from each M1 plant and planted in a plastic greenhouse, inoculated with physiological wheat E09 containing powdery mildew. Infected individual plants were harvested and identified using Pm55 gene primers to confirm the presence of the gene in the infected material. Independently infected individual plants were planted in rows and inoculated again for powdery mildew identification. Simultaneously, PCR cloning and sequencing analysis were performed using Pm55 gene primers P1 (GATCCTGACCATGGAAATTTC, SEQ ID NO. 5) and P2 (TTCTATGCGCCAAACCTTGTTC, SEQ ID NO. 6). This revealed SNP mutations in the Pm55 gene sequence in all five independently infected mutant plants. The mutation site in mutant M729 was located in the NBS-ACR region of this gene, while the mutation sites in the other four mutants were located in the LRR region. The results of the susceptible mutation further demonstrate the function of Pm55 in resisting wheat powdery mildew. Figure 3 (b and d).

[0029] Example 2: Verification of the function of the SuPm55 gene using gene silencing technology

[0030] The silencing vector was a commercial barley stripe mosaic virus vector. The main procedures were performed according to the RiboMAX™ Large Scale RNA Production Systems-SP6 and T7 manual. Using the cloned SuPm55 gene sequence as a template, primers P7 (CATTTTTTTTTTTTTTTAGCTAGCGTACAACCTGAAAGACACG, SEQ ID NO. 9) and P8 (GATGATTCTTCTTCCGTTGCTAGCACTCGAGACTCTGTCGATTT, SEQ ID NO. 10) were designed in the CC structure region of the coding region for this gene silencing site. These primers all contained NheI restriction enzyme sites. The γ-PDS vector (Xing et al., 2018) was completely digested with the restriction endonuclease NheI, yielding an insert fragment of approximately 200 bp (the PDS gene sequence) and a vector fragment larger than 2 kb. The digested exogenous gene fragment was then ligated to the recovered vector fragment. The validated γ-recombinant vector plasmid and γ-PDS viral vector were linearized using MluI enzyme, and the β-vector was linearized using SpeI enzyme digestion. Phenotypic identification of plants inoculated with γ-empty and γ-PDS was used to verify the success of the VIGS silencing system; plants inoculated with BSMV:SuPm55 were used to silence the target gene. Both the target gene and control were repeated twice, with 10 plants inoculated each time. After inoculation, the plants were sprayed with DEPC water and incubated at 22℃ in the dark for 24 hours, followed by a 16h / 8h light / dark cycle at 18-20℃. Once PDS showed bleaching, leaves exhibiting the viral phenotype at the four-leaf stage were collected for in vitro identification and RNA extraction. The isolated leaves were neatly placed on 6-BA medium, and fresh powdery mildew spores were inoculated using the shaking method. Leaf disease was observed 5 days after inoculation. Using BSMV:γ applied to leaves of the same age as a control, the silencing efficiency was detected by qRT-PCR. It was found that the expression level of endogenous SuPm55 was significantly reduced by 50%-70% compared to the control. Phenotypic identification showed that spore development on leaves with silenced SuPm55 was significantly inhibited. Silencing SuPm55 can improve wheat resistance to powdery mildew, thus indicating that SuPm55 inhibits resistance to Pm55. Figure 4 (a and b).

[0031] Example 4: Verification of the function of the SuPm55 gene using CRISPR / Cas9 gene editing technology

[0032] Based on the SuPm55 sequence, two target sites were identified in the CC domain using the CRISPRdirect website (http: / / crispr.dbcls.jp / ). sgRNA primers, P9 (ACACGGTGAAGAAGGGAATTAGG, SEQ ID NO. 11) and P10 (GACCAAGCCACGCACCTTCAAGG, SEQ ID NO. 12), were designed before the PAM structure for this gene editing site. Vector construction and genetic transformation were performed using publicly available methods (Zhang et al., 2021). The Agrobacterium strain used was EHA105 (a commercial strain), and the recipient was TF5V-1 (Zhang et al., 2016). T0-positive transgenic plants were identified using Cas9 and 35S markers (Zhang et al., 2021). Using the full-length SuPm55 markers P3 (TTAGGTACACGCAATTTCAA, SEQ ID NO.7) and P4 (CCTCAAATTAAGCTAGTGAG, SEQ ID NO.8), T0 transgenic positive plants were cloned, resulting in four different types of positive plants. All base deletions occurred at the first target site. Figure 4 c). Heterozygous mutant plants were screened and self-pollinated to obtain homozygous mutant plants from the self-pollinated progeny for powdery mildew resistance identification and analysis. Seedlings were inoculated with powdery mildew physiological race E09 using the shaking method. Results showed that leaves edited with the SuPm55 gene exhibited significantly higher resistance than their parents. Figure 4 d). Meanwhile, the homozygous mutant SuPm55 plants grown in plastic greenhouses showed significantly better resistance in the leaf sheath region of mature plants compared to their parent TF5V-1. Figure 4 e). The results of CRISPR / Cas9 gene editing of SuPm55 showed that SuPm55 mainly induces the phenotype of tissue-differential resistance in mature plants by suppressing resistance to Pm55.

[0033] To further clarify the impact of SuPm55 on major agronomic traits, four homozygous mutant lines generated by CRISPR / Cas9 gene editing of SuPm55 were compared with TF5V-1 for major agronomic traits. The results showed that under pathogen-free field production conditions, the number of tillers, number of panicles per plant, and yield per plant of the four SuPm55 gene-edited mutants were significantly lower than those of the parents, while plant height, number of grains per panicle, and thousand-grain weight were not significantly different from those of the parents. Figure 5 This indicates that SuPm55 has a positive effect on promoting wheat tillering, further confirming the breeding utilization value of the Pm55 / SuPm5 gene pair.

[0034] Example 5: High-efficiency breeding utilization of the Pm55 / SuPm5 gene

[0035] Using the T5DL.5VS translocation line TF5V-1 carrying the Pm55 / SuPm5 gene pair as the disease-resistant parent, it was crossed with the high-yielding but disease-susceptible variety Nannong 0686 in production. Figure 6 Molecular marker-assisted selection was performed using co-dominant molecular markers P11 (AAGGAGGAGTTCAACAGGCG, SEQ ID NO. 13) and P12 (GGCCTGTCCGATCCCTTT, SEQ ID NO. 14). DNA from homozygous T5DL.5VS translocation chromosome monocultures (containing both Pm55 and SuPm5 gene pairs) showed only a 5VS-specific band after PCR amplification. DNA from monocultures without the T5DL.5VS translocation chromosome (not containing both Pm55 and SuPm5 gene pairs) showed only a 5DS-specific band after PCR amplification. Heterozygous monocultures showed both 5VS and 5DS-specific bands. Figure 7 Based on field powdery mildew resistance identification and agronomic trait analysis, new wheat lines with high resistance to powdery mildew and excellent agronomic traits were bred. Through regional trials, new disease-resistant wheat lines (species) carrying the Pm55 / SuPm5 gene were obtained. Compared with the susceptible recurrent parent Nannong 0686, the new lines exhibited tissue-specific resistance to powdery mildew at the adult stage, meaning the basal leaf sheaths were susceptible, while the leaves and other tissues showed near-immunity. Plot yield evaluation showed that the new lines yielded more than 5% higher than the backcross parent. Figure 8 ).

Claims

1. Possesses reproductive period and tissue-dependent resistance genes against powdery mildew. Pm55 / SuPm55 From tufted wheat ( Dasypyrum villosum 91C43 chromosome arm 5VS, Pm55 The DNA sequence of the gene is shown in SEQ ID NO.

1. SuPm55 The DNA sequence of the gene is shown in SEQ ID NO.

3.

2. The gene pair according to claim 1 Pm55 / SuPm55 Encoded protein, Pm55 The encoded protein amino acid sequence is SEQ ID NO.

2. SuPm55 The encoded protein amino acid sequence is SEQ ID NO.

4.

3. The gene pair according to claim 1 Pm55 / SuPm55 Cloning sequence primers, characterized in that clone Pm55 The primers are SEQ ID NO.5 and SEQ ID NO.6, for cloning. SuPm55 The primers are SEQ ID NO.7 and SEQ ID NO.

8.

4. Containing the gene pair as described in claim 1 Pm55 / SuPm55 A recombinant expression vector for any one of the genes.

5. The gene pair according to claim 1 Pm55 / SuPm55 Application in the breeding of wheat varieties resistant to powdery mildew.

6. The application according to claim 5, characterized in that... Will carry Pm55 / SuPm55 The wheat-fleshly T5DL.5VS translocation line and the non-carrier pair Pm55 / SuPm55 By hybridizing wheat varieties with gene pairs, molecular marker-assisted selection was used to select homozygous materials containing the T5DL.5VS translocation chromosome, and then breeding materials carrying the gene pair was developed. Pm55 / SuPm55 A new wheat variety with gene pairs improves wheat resistance to powdery mildew; the molecular marker-assisted selection uses the primers shown in SEQ ID NO.13 and SEQ ID NO.

14.

7. The application according to claim 5, characterized in that... The gene pair described in claim 1 Pm55 / SuPm55 By introducing genetic engineering techniques into wheat varieties susceptible to powdery mildew, a wheat variety can be obtained in which only the basal leaf sheaths show a certain degree of susceptibility to the disease at the mature stage, while other parts show high resistance; or the gene described in claim 1 can be introduced into the wheat variety. Pm55 Genetic engineering techniques are used to introduce the virus into wheat varieties susceptible to powdery mildew in order to improve their resistance to the disease.

8. Containing the contents of claim 1 Pm55 Application of recombinant gene expression vectors in breeding wheat varieties resistant to powdery mildew.

9. A kind Pm55 / SuPm55 Codominant molecular marker primers for gene pairs, characterized by It consists of primers shown in SEQ ID NO.13 and SEQ ID NO.

14.

10. The application of the codominant molecular marker primers of claim 9 in wheat powdery mildew resistance breeding; characterized in that... By screening for homozygous materials containing the T5DL.5VS translocation chromosome using the aforementioned molecular marker primers, and combining this with agronomic trait selection, materials simultaneously carrying the T5DL.5VS translocation chromosome can be obtained. Pm55 / SuPm5 A new genetic strain.

Images