Lactobacillus rhamnosus and a composition inhibiting helicobacter pylori

By combining hyaluronic acid with Lactobacillus rhamnosus, the lack of validation of hyaluronic acid and probiotics in the fight against Helicobacter pylori in the prior art has been solved, and the effects of significantly reducing the colonization rate of Helicobacter pylori and improving gastrointestinal health have been achieved.

CN116396884BActive Publication Date: 2026-07-31BLOOMAGE BIOTECHNOLOGY CORP LTD
View PDF 11 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
BLOOMAGE BIOTECHNOLOGY CORP LTD
Filing Date
2022-08-15
Publication Date
2026-07-31

AI Technical Summary

Technical Problem

In the existing technology, the combination of hyaluronic acid and probiotics lacks effective animal and human experimental verification in its anti-Helicobacter pylori (H. pylori) effect, resulting in a lack of relevant data on H. pylori colonization and clearance rates, and the anti-H. pylori effect is not significant.

Method used

A combination of hyaluronic acid or its salts with Lactobacillus rhamnosus has been verified through animal and human experiments. The preferred combination of Lactobacillus rhamnosus CCFM1259 and sodium hyaluronate is prepared into pills, granules, powders, tablets, capsules or emulsions for the purpose of inhibiting Helicobacter pylori.

Benefits of technology

It significantly reduces the colonization rate of Helicobacter pylori in the stomach, improves the gastric mucosal inflammatory response caused by Helicobacter pylori infection, increases the seroconversion rate and effectiveness, enhances the beneficial intestinal flora, and improves gastrointestinal health.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116396884B_ABST
    Figure CN116396884B_ABST
Patent Text Reader

Abstract

This application discloses a strain of Lactobacillus rhamnosus and a composition comprising Lactobacillus rhamnosus and Helicobacter pylori inhibitory agents. The composition also includes hyaluronic acid or its salt. This composition can significantly reduce the colonization rate of Helicobacter pylori in the stomach, alleviate the inflammatory response and gastrointestinal symptoms (GSRS score) of H. pylori infection, improve the seroconversion rate and efficacy of H. pylori patients, increase the abundance of beneficial bacteria in the patient's gut, and improve the patient's gastrointestinal health.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the fields of food and health product technology, specifically to a composition of Lactobacillus rhamnosus and Helicobacter pylori inhibitor. Background Technology

[0002] Helicobacter pylori ( Helicobacter pylori,H.pylori It is a microaerophilic, spiral-shaped Gram-negative bacillus. H. pylori I can adhere to and colonize the gastric mucosa through adhesins, invading the body's defense system. It utilizes the direct effects of its own toxins and the indirect effects of inducing inflammatory responses to cause digestive system diseases such as gastritis, as well as non-digestive system diseases such as ischemic cardiovascular and cerebrovascular diseases and cerebral hemorrhage. More importantly, H. pylori Infection can trigger the Correa cascade, causing gastric lesions to progress from non-atrophic gastritis to atrophic gastritis, intestinal metaplasia, etc., and in severe cases, further developing into gastric cancer. Because H. pylori is non-healing and high-risk, H. pylori H. pylori is classified as a Group 1 carcinogen by the International Agency for Research on Cancer. Antibiotic treatment is a possible treatment option for patients exhibiting symptoms of infection. However, with the rise in antibiotic resistance globally and the frequent occurrence of other adverse reactions, the eradication rate of H. pylori continues to decline.

[0003] In recent years, people have mainly been exploring the use of non-antibiotic substances to combat [the disease / promote]. H. pylori New approaches, such as probiotics, prebiotics, plant extracts, bioactive proteins, and polysaccharides, are being explored to improve existing treatment regimens and provide new, effective therapies. Among these, probiotics are particularly noteworthy due to their good biocompatibility, tolerance to harsh gastrointestinal environments, and antagonistic effects. H. pylori Its effects have been widely studied. Currently, the most studied anti-... H. pylori The probiotic strains mainly include *Lactobacillus reuteri*, *Lactobacillus salivarius*, *Lactobacillus rhamnosus*, *Lactobacillus acidophilus*, *Lactobacillus plantarum*, *Lactobacillus bulgaricus*, and *Bifidobacterium*. Probiotics play an important role in the supplementation and prevention of gastrointestinal diseases. They can be used as adjunctive therapy to minimize the use of antibiotics and their side effects, strengthen the mucosal barrier, reduce inflammatory responses, improve patients' clinical symptoms and compliance during treatment, and directly or indirectly improve... H. pylori The eradication rate of H. pylori is of great significance for the prevention and control of H. pylori and related diseases.

[0004] Patent CN108741090A discloses a method containing prebiotics, Bifidobacterium, Lactobacillus acidophilus, Lactobacillus paracasei, and Lactobacillus rhamnosus to inhibit... H. pylori Compound probiotic foods can be used to prevent H. pylori Infection. Patent WO2021 / 238890A1 discloses a strain that inhibits... H. pylori Lactobacillus rhamnosus, its H. pylori The clearance rate was 61.54%. Patent WO2004 / 031368 discloses a strain used for the treatment or prevention of... H. pylori Lactobacillus reuteri, a strain of which does not produce reuterin but can inhibit inflammation, is disclosed in patent WO2013027087A1. H. pylori Lactobacillus reuteri grown in vitro, patent CN102174450A relates to an acid-resistant, [unclear text - possibly related to bacteria or bacteria]. H. pylori It has an inhibitory effect on growth and urease activity, and is effective against infection in mice. H. pylori Lactobacillus plantarum, which has the effect of preventing or reducing the severity of infection, is disclosed in patent WO2020 / 083983A1 as being able to synergistically kill antibiotics. H. pylori Lactobacillus acidophilus and Bifidobacterium animalis, but neither has been reported. H. pylori Clearance rate. Summary of the Invention

[0005] Chinese Patent ZL2020113384895 is a previous research result of the applicant, disclosing a composition containing hyaluronic acid and its salts for use in anti-inflammatory purposes. H. pylori The gastrointestinal infection activity, with a molecular weight range of 800-2000 kDa, preferably 1000-2000 kDa, was primarily validated through animal experiments, including the effect of HA on the gastric tract of mice. H. pylori The impact of factors such as planting density was considered, but not discussed. H. pylori Clearance rate.

[0006] In the existing technology, there is no information regarding the synergistic effect of hyaluronic acid and probiotics in fighting [diseases]. H. pylori Research on anti-Helicobacter pylori probiotics and hyaluronic acid has been limited, with screening and verification primarily conducted through in vitro antibacterial tests. There is a lack of animal or human studies to validate their anti-Helicobacter pylori efficacy, indicating a lack of relevant research. H. pylori Based on the colonization and clearance rate data, this application proposes a combination of hyaluronic acid and probiotics, and verifies the anti-Helicobacter pylori efficacy through animal and human experiments.

[0007] Specifically, this application adopts the following technical solution. 1. A strain of Lactobacillus rhamnosus, deposited at the Guangdong Provincial Center for Microbial Culture Collection, with accession number GDMCCNO.62419.

[0008] 2. The 16S rRNA gene sequence of Lactobacillus rhamnosus as described in item 1 is shown in SEQ ID NO:1.

[0009] 3. Lactobacillus rhamnosus as described in item 1, which is used to inhibit Helicobacter pylori.

[0010] 4. A composition for inhibiting Helicobacter pylori, comprising hyaluronic acid or a salt thereof and Lactobacillus rhamnosus.

[0011] 5. The composition according to item 4, wherein the salt of hyaluronic acid is any one or more of sodium salt, potassium salt, magnesium salt, calcium salt, zinc salt, and bismuth salt of hyaluronic acid.

[0012] 6. The composition according to item 4 or 5, wherein the hyaluronic acid or its salt has an average molecular weight of 1200-2000 kDa, preferably 1400-1800 kDa.

[0013] 7. The composition according to any one of items 4-6, wherein the composition is capable of providing ≥80 mg / day / person of hyaluronic acid or a salt thereof; The viable count of the *Lactobacillus rhamnosus* is ≥1×10⁻⁶. 9 cfu / day / human Lactobacillus rhamnosus

[0014] Preferably, the composition is capable of providing ≥100 mg / day / person of hyaluronic acid or a salt thereof, or; The viable count of the *Lactobacillus rhamnosus* is ≥1×10⁻⁶. 10 cfu / day / human Lactobacillus rhamnosus

[0015] 8. The composition according to any one of items 4-7 further comprises excipients, preferably one or more of inulin, galactooligosaccharides, isomaltooligosaccharides or maltodextrin.

[0016] 9. The composition according to any one of items 4-8, wherein the dosage form of the composition may be pills, granules, powders, tablets, capsules or emulsions.

[0017] 10. The composition according to any one of items 4-9, wherein the Lactobacillus rhamnosus is any one of items 1-3.

[0018] 11. The use of any one of the Lactobacillus rhamnosus in items 1-3, or any one of the compositions in items 4-10, in the preparation of food or health products.

[0019] 12. Use of Lactobacillus rhamnosus and hyaluronic acid or their salts together in the preparation of food or health products.

[0020] 13. According to the use described in item 12, the dosage of the hyaluronic acid or its salt is ≥80 mg / day / person, or; The dosage of Lactobacillus rhamnosus used is ≥1×10⁻⁶ viable bacteria count. 9 CFU / human Lactobacillus rhamnosus Preferably, the dosage of the hyaluronic acid or its salt is ≥100mg / day / person, or; The dosage of Lactobacillus rhamnosus used is ≥1×10⁻⁶ viable bacteria count. 10 cfu / day / human Lactobacillus rhamnosus

[0021] 14. According to the use described in item 12 or 13, the salt of the hyaluronic acid is any one or more of the sodium salt, potassium salt, magnesium salt, calcium salt, zinc salt, and bismuth salt of hyaluronic acid.

[0022] 15. The use according to any one of items 12-14, wherein the hyaluronic acid or its salt has an average molecular weight of 1200-2000 kDa, preferably 1400-1800 kDa.

[0023] 16. The use according to any one of items 11-15, wherein the Lactobacillus rhamnosus is any one of items 1-3.

[0024] invention effect 1. The hyaluronic acid or its salt and Lactobacillus rhamnosus composition provided in this application, after oral administration, can significantly reduce the Helicobacter pylori colonization rate in the stomach to a normal level. H. pylori Both the gastric mucosal inflammation caused by infection and the subjects' gastrointestinal symptoms (GSRS score) were significantly improved. H. pylori The patients' seroconversion rate and effectiveness rate can reach 70.59% and 82.35% respectively, and the abundance of beneficial intestinal flora increases, which is beneficial to improving the patients' gastrointestinal health.

[0025] 2. The hyaluronic acid and Lactobacillus rhamnosus composition provided in this application, for H. pylori Prevention and control of the disease in susceptible populations has been eradicated. H. pylori The patient's relapse and absence of clinical symptoms H. pylori It provides new and effective treatment methods for patients with infections.

[0026] 3. A synergistic inhibition method provided in this application H. pylori A combination of hyaluronic acid or its salts and Lactobacillus rhamnosus can significantly reduce the colonization rate of Helicobacter pylori in the stomach and alleviate [the symptoms]. H. pylori The inflammatory response and gastrointestinal symptoms of infection (GSRS score) improve H. pylori The negative conversion rate and effectiveness of the patients can be improved, the abundance of beneficial bacteria in the patient's gut can be increased, and the patient's gastrointestinal health can be improved. Attached Figure Description

[0027] The accompanying drawings are provided to better understand this application and do not constitute an undue limitation thereof. Wherein: Figure 1 Different treatments on the gastric contents of mice H. Pylori The effect of planting density; where * in the figure indicates a significant difference between the intervention group and the model group (p<0.05); ** indicates a significant difference between the intervention group and the model group (p<0.01); *** indicates an extremely significant difference between the intervention group and the model group (p<0.001); & indicates a significant difference between the HA group, CCFM1259 group and the compound group (p<0.05); ## indicates a significant difference between the blank group and the model group (p<0.01); Figure 2 A, Figure 2 B. Figure 2 C Figure 2 D、 Figure 2 E represents the HE staining result of mouse gastric mucosa (200×). Figure 2 A: Blank group; Figure 2 Model group B; Figure 2 C: HA group; Figure 2 D: CCTV1259 group; Figure 2 E: HA+CCFM1259 compound group); Figure 3 Different molecular weight HAs and Lactobacillus rhamnosus were combined in the stomachs of mice. H. Pylori The effect of colonization rate; where * in the figure indicates a significant difference between the intervention group and the model group (p<0.05); ** indicates a significant difference between the intervention group and the model group (p<0.01); *** indicates an extremely significant difference between the intervention group and the model group (p<0.001); ## indicates a significant difference between the blank group and the model group (p<0.01); Figure 4 The changes in GSRS after intervention in each group (* indicates a significant difference compared to before intervention; p<0.05); Figure 5 A and Figure 5 B subjects' gut microbiota phylum level ( Figure 5 A) and genus level ( Figure 5 B) Result. Detailed Implementation

[0028] The following description provides exemplary embodiments of this application, including various details to aid understanding, and should be considered merely exemplary. Therefore, those skilled in the art will recognize that various changes and modifications can be made to the embodiments described herein without departing from the scope and spirit of this application. Similarly, for clarity and brevity, descriptions of well-known functions and structures are omitted in the following description.

[0029] This application provides a strain of Lactobacillus rhamnosus deposited at the Guangdong Provincial Center for Microbial Culture Collection, accession number GDMCC NO.62419, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, postal code 510070, on May 17, 2022.

[0030] The term "Lactobacillus rhamnosus" conforms to the general definition in this field, abbreviated as LGG. Belonging to the genus Lactobacillus, it is part of the normal flora of the human body, present in the oral cavity and intestines, primarily in the intestines. Lactobacillus rhamnosus is an anaerobic, acid-resistant, non-spore-forming probiotic; its Gram staining is purple, thus it is also a Gram-positive bacterium. The main functions of Lactobacillus rhamnosus include enhancing the gastrointestinal mucosal barrier, regulating the body's immunity, antagonizing pathogenic bacteria, aiding digestion, lowering blood lipids, and protecting the liver. It is a non-toxic, side-effect-free probiotic, whose main functional characteristics include regulating intestinal flora, preventing and treating diarrhea, eliminating toxins, and enhancing the body's immunity.

[0031] The Lactobacillus rhamnosus provided in this application was inoculated on MRS solid plates and incubated at 37 ℃ for 48 h. The colonies were round with relatively neat edges, smooth and raised surfaces, uniform texture, and milky white color.

[0032] The 16S rRNA gene sequence of *Lactobacillus rhamnosus* is shown in SEQ ID NO:1, SEQ ID NO:1: CTTAGACGGCTCGCTCCCTAAAGGGTTACGCCACCGGCTTCGGG The Lactobacillus rhamnosus provided in this application can be used to inhibit Helicobacter pylori.

[0033] This application further provides a composition for inhibiting Helicobacter pylori, comprising hyaluronic acid or a salt thereof and Lactobacillus rhamnosus.

[0034] The viable count of the *Lactobacillus rhamnosus* is not less than 1 × 10⁻⁶. 9 CFU / g or 1×10 9 CFU / ml, and more preferably, the viable count of the *Lactobacillus rhamnosus* is not less than 1×10⁻⁶. 10 CFU / g or 1×10 10 CFU / ml, the viable count of the *Lactobacillus rhamnosus* is not less than 1×10⁻⁶. 11 CFU / g or 1×10 11 CFU / ml.

[0035] The term "hyaluronic acid" conforms to the general definition in this art and refers to a biopolymer material composed of linearly linked repeating units N-acetyl-D-glucosamine and D-glucuronic acid, also known as hyaluronic acid or glass acid. It is an acidic mucopolysaccharide whose unique molecular structure and physicochemical properties exhibit a variety of important functions in the body. The term "hyaluronic acid" or its salts are used to include hyaluronic acid itself, its salts, or combinations thereof. Examples of hyaluronic acid salts include, but are not limited to: inorganic salts such as sodium hyaluronate, potassium hyaluronate, calcium hyaluronate, magnesium hyaluronate, zinc hyaluronate, bismuth hyaluronate, and cobalt hyaluronate; and organic salts such as tetrabutylammonium hyaluronate. In this application, hyaluronic acid itself or its salts may be used alone, or combinations of two or more hyaluronic acids or their salts may be used. For example, it may include one hyaluronic acid salt, two hyaluronic acid salts, three hyaluronic acid salts, four hyaluronic acid salts, five hyaluronic acid salts, or six hyaluronic acid salts; the salts are selected from sodium salts, potassium salts, magnesium salts, calcium salts, zinc salts, and bismuth salts.

[0036] The hyaluronic acid or its salts described in this application are not limited. In a preferred embodiment, the hyaluronic acid salt is a water-soluble salt of hyaluronic acid, and more preferably any one of sodium hyaluronate, zinc hyaluronate, magnesium hyaluronate, or potassium hyaluronate. In a specific embodiment, the hyaluronic acid salt is sodium hyaluronate.

[0037] In a preferred embodiment, the average molecular weight of the sodium hyaluronate is 1200-2000 kDa, for example, 1300 kDa, 1400 kDa, 1500 kDa, 1600 kDa, 1700 kDa, 1800 kDa, 1900 kDa, or 2000 kDa, preferably 1400-1800 kDa.

[0038] In a preferred embodiment, the viable count of *Lactobacillus rhamnosus* in the anti-*Helicobacter pylori* composition provided in this application is ≥1×10⁻⁶. 9 CFU / day / person. Those skilled in the art should understand that, generally, a person's weight is calculated in units of 60 kg. If the person's weight is not 60 kg, this standard can be used for conversion.

[0039] In a preferred embodiment, the hyaluronic acid or its salt in the anti-Helicobacter pylori composition provided in this application is used at a dosage of ≥80mg / day / person. Those skilled in the art should understand that, generally, a person's weight is 60kg.

[0040] In a preferred embodiment, the viable count of *Lactobacillus rhamnosus* in the anti-*Helicobacter pylori* composition provided in this application is ≥1×10⁻⁶. 10 CFU / day / person. Those skilled in the art should understand that, under normal circumstances, a person's weight is considered to be 60 kg.

[0041] In a preferred embodiment, the hyaluronic acid or its salt in the anti-Helicobacter pylori composition provided in this application is used at a dosage of ≥100mg / day / person. Those skilled in the art should understand that, generally, a person's weight is 60kg.

[0042] In a preferred embodiment, the composition further includes excipients, which may be suitable solvents, propellants, solubilizers, co-solvents, emulsifiers, colorants, binders, disintegrants, fillers, lubricants, wetting agents, osmotic pressure regulators, stabilizers, flow aids, flavoring agents, preservatives, suspending agents, coating materials, fragrances, anti-adhesion agents, binding agents, penetration promoters, pH adjusters, buffers, plasticizers, surfactants, foaming agents, defoamers, thickeners, encapsulating agents, humectants, absorbents, diluents, flocculants and anti-flocculation agents, filter aids, release inhibitors, etc.

[0043] In a further preferred embodiment, the excipient is one or more of inulin, galactooligosaccharide, isomaltooligosaccharide, or maltodextrin.

[0044] The compositions of this application can be prepared by common methods, wherein one or more diluents or carriers may be added, for example, in oral form, such as pills, tablets, capsules, granules, powders, lozenges, syrups, emulsions, suspensions, etc.

[0045] This application further provides the use of Lactobacillus rhamnosus and hyaluronic acid or their salts together in the preparation of food or health products.

[0046] The combined use can be a mixture of Lactobacillus rhamnosus and hyaluronic acid or its salts, or one of Lactobacillus rhamnosus and hyaluronic acid or its salts can be agent A and the other agent B, with A used first and then B used, or B used first and then A used, or A and B can be used simultaneously.

[0047] In a preferred embodiment, the dosage of the hyaluronic acid or its salt used in the stated application is ≥80mg / day / person. Those skilled in the art should understand that, typically, a person's weight is 60kg.

[0048] In a preferred embodiment, in the stated use, the dosage of *Lactobacillus rhamnosus* is ≥1 × 10⁻⁶ viable bacteria. 9 Lactobacillus rhamnosus cfu / day / human, those skilled in the art should understand that, under normal circumstances, a human weight is considered to be 60kg.

[0049] In a preferred embodiment, the dosage of the hyaluronic acid or its salt used in the stated application is ≥100 mg / day / person of hyaluronic acid or its salt. Those skilled in the art should understand that, generally, a person's weight is 60 kg.

[0050] In a preferred embodiment, in the stated use, the dosage of *Lactobacillus rhamnosus* is ≥1 × 10⁻⁶ viable bacteria. 10 CFU / day / human Lactobacillus rhamnosus. Those skilled in the art should understand that, typically, a person's weight is considered to be 60 kg. In a preferred embodiment, the hyaluronic acid salt is any one or more of the following: sodium salt, potassium salt, magnesium salt, calcium salt, zinc salt, and bismuth salt of hyaluronic acid.

[0051] In a preferred embodiment, the average molecular weight of the hyaluronic acid or its salt is 1200-2000 kDa, for example, 1300 kDa, 1400 kDa, 1500 kDa, 1600 kDa, 1700 kDa, 1800 kDa, 1900 kDa, or 2000 kDa, preferably 1400-1800 kDa.

[0052] The *Lactobacillus rhamnosus* CCFM1259 provided in this application exhibits excellent inhibitory activity against *Helicobacter pylori*, with a stronger antibacterial effect than other strains, such as *Lactobacillus paracasei* TY-O1 and *Lactobacillus plantarum* SN-L3. Specifically, the inhibition zone of CCFM1259 is 0.76 mm and 1.67 mm larger than the other two strains, respectively, and is also superior to other *Lactobacillus rhamnosus* strains, such as *Lactobacillus rhamnosus* TY-O4 and *Lactobacillus rhamnosus* FB-O1. Furthermore, the *Lactobacillus rhamnosus* CCFM1259 provided in this application demonstrates good reduction... H. pyloriThe adhesion rate of CCFM1259 was superior to that of Lactobacillus paracasei TY-O1 and Lactobacillus plantarum SN-L3. The adhesion rate of CCFM1259 was 4.86 and 8.08 percentage points lower than that of the other two strains, respectively. Its adhesion rate was also lower than that of other Lactobacillus rhamnosus strains, such as Lactobacillus rhamnosus TY-O4 and Lactobacillus rhamnosus FB-O1.

[0053] The composition provided in this application for inhibiting Helicobacter pylori, comprising hyaluronic acid or its salt and Lactobacillus rhamnosus powder, uses hyaluronic acid or its salt and Lactobacillus rhamnosus powder in a compound formulation, which reduces... H. Pylori It has a better effect on colonization rate than hyaluronic acid or its salt alone and Lactobacillus rhamnosus alone. As can be seen from the experimental data of this application, the composition of this application has a significant difference in effect compared with hyaluronic acid or its salt alone and Lactobacillus rhamnosus alone. p <0.05), indicating that the composition of this application reduces [the concentration of certain substances]. H. Pylori It has a synergistic effect on the amount of planting.

[0054] The composition comprising hyaluronic acid or its salts and Lactobacillus rhamnosus powder, which inhibits Helicobacter pylori, provided in this application, shows better improvement in gastric pathology. Compared with hyaluronic acid or its salts alone and Lactobacillus rhamnosus alone, the composition of this application shows more significant improvement in the gastric mucosa of mice after treatment, with virtually no inflammatory cell infiltration. This further demonstrates the antagonistic effect of the composition of this application. H. Pylori Inflammatory responses caused by infection have a synergistic effect.

[0055] Furthermore, a clinical trial was conducted to investigate the anti-Helicobacter pylori effect of the composition of this application. Subjects were given a combination of placebo and the composition of hyaluronic acid or its salts provided in this application and Lactobacillus rhamnosus powder. Compared with the placebo group, the negative conversion rate and effective rate of the combination group increased by 125.88% and 119.60%, respectively. There was no significant change in gastrointestinal adverse symptoms in the placebo group before and after the intervention. p >0.05); however, after intervention with the composition, the gastrointestinal symptoms of all subjects were significantly improved (GSRS score, p <0.05), and the negative conversion rate and efficacy of the subjects were also increased several times, indicating that the composition antagonizes the gastric... H. pylori The infection has a significant effect. In addition, the composition of this application also improves the composition and diversity of intestinal flora, reduces the proportion of pathogenic bacteria in the intestine, and increases the abundance of beneficial bacteria such as Lactobacillus and Bifidobacterium, which is beneficial to maintaining the gastrointestinal health of patients.

[0056] Example Animal experiment arrangement: 1) Use of animal-derived products 4-week-old male C57BL / 6 mice.

[0057] 2) Information on proposed breeding facilities Jiangsu Provincial Institute for Schistosomiasis Control

[0058] 3) Sources of sodium hyaluronate (HA) Bloomage Biotechnology Co., Ltd., food-grade sodium hyaluronate and related products.

[0059] 4) Sources of probiotics Lactobacillus rhamnosus CCFM1259 is deposited at the Guangdong Provincial Center for Microbial Culture Collection, with accession number GDMCCNO.62419.

[0060] 5) Methods of anesthesia and sacrifice of laboratory animals After the final gavage, the mice were fasted for 24 hours. They were then anesthetized by intraperitoneal injection of a 1% sodium pentobarbital solution. Blood was then collected from the mice's eyes. Finally, the mice were euthanized by cervical dislocation. The stomachs were immediately dissected and removed. The stomachs were cut along the greater curvature and the complete stomach tissue (including the antrum and body) was taken. Half of the tissue was used for pathological examination, and the other half was used to detect pyloric colonization, immune factors, and other related indicators.

[0061] Example 1 Antagonism H. pylori Screening of Lactobacillus strains (1) Experimental materials and usage methods Helicobacter pylori was derived from the NTCC National Type Culture Collection Center. H. pylori SS ; H. pylori When using, dip a small amount of bacterial solution from the preservation tube into the inoculation loop and streak it on a Columbia blood agar plate (containing 7.5% sterile defibrinated sheep blood). Incubate at 37°C in a tri-gas incubator (85% N2, 10% CO2, 5% O2) for 3 days. Pick a single colony from the surface of the plate and inoculate it into liquid BHI medium (containing 5% fetal bovine serum) for 4 days. Then, inoculate it with 2% of the culture into fresh BHI medium and incubate for 4 days before use.

[0062] Human gastric adenocarcinoma cells (AGS) were purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences. Before use, AGS cells were resuspended in fetal bovine serum containing 10% DMSO, subjected to gradient cooling, and then frozen in liquid nitrogen. For AGS cell preparation, 10 mL of F-12 medium containing 5% fetal bovine serum was added to a culture dish. After centrifugation and discarding the supernatant, the cells were resuspended in medium, poured into a culture dish to ensure even dispersion, and cultured in a 37°C incubator containing 5% CO2. When the cells reached a confluent monolayer, they were passaged at a ratio of 1:3. Cells after two passages were ready for use.

[0063] Lactobacillus is isolated from fermented foods, dairy products, or human saliva and feces. When using Lactobacillus, first streak it on an MRS plate and incubate it at 37°C for two days. Then, pick a single colony and inoculate it into an MRS liquid culture tube and incubate it for 18 hours. Finally, inoculate it with 2% of the culture medium into fresh MRS medium and incubate it for 18 hours before use.

[0064] (2) Lactobacillus against H. pylori Determination of growth-inhibiting effect: Two generations of activated bacteria were tested. H. pylori The bacterial suspension concentration was adjusted to 1*10 8 CFU / mL, take 100 μL and spread it evenly on a Columbia blood agar plate. After the surface of the culture medium is dry, place it on an Oxford cup and gently press it down. Add 150 μL of Lactobacillus suspension (1*10). 8 The culture medium was prepared by diffusion at 4 ℃ for 4 h (CFU / mL) and a blank control (100 μL of MRS liquid medium at pH 6.2). After diffusion, the medium was incubated in a tri-gas incubator for 72 h. The inhibition results were observed and the diameter of the inhibition zone was measured using calipers.

[0065] (3) Lactobacillus against H. pylori Determination of AGS cell adhesion inhibition ability: AGS cells were seeded in 96-well plates (2 × 10⁻⁶ cells / well). 4 Cells were cultured overnight (number per well) until they adhered to the culture vessel. Dead cells were removed by washing three times with PBS. Cells were then resuspended in F-12 medium (serum-free) at a multiplicity of infection (MOI) of 100. H. pylori Co-cultured with lactobacillus for 2 hours, then washed three times with PBS to remove unadhered lactobacillus and lactobacillus. H. pylori Finally, 200 μL of urease reagent (0.9% NaCl, 14 μg / mL phenol red, 20 mmol / L urea, pH 6.8) was added and the mixture was incubated for 3 h. The absorbance at 550 nm was then measured.

[0066] Table 1. Comparison of antibacterial effects and adhesion rates of different Lactobacillus strains.

[0067] Note: * represents a value > 15.00 mm; # represents a value < 80.00%.

[0068] (4) Lactobacillus against H. pylori Antibacterial effect of growth The experiment used 30 Lactobacillus strains as the starting strains, as shown in Table 1. The results were compared with... H. pylori The inhibition zone size was determined, and the inhibition zones of 30 strains ranged from 8.27 to 17.51 ​​mm. Among them, 6 strains showed resistance to... H. pyloriThe inhibition zone was greater than 15 mm, indicating a stronger antibacterial effect than other strains. The six strains were numbered and sorted according to the size of their inhibition zones as follows: CCFM1259, FB-O1, NJ-F3, TY-O1, SN-L3, and TY-O4.

[0069] (5) Lactobacillus against H. pylori Inhibitory effect on adhesion AGS cells The experiment compared the effects of 30 strains of Lactobacillus on... H. pylori The inhibitory effects on adhesion to AGS cells are shown in Table 1. The results show that different lactobacilli reduced... H. pylori The adhesion ability varies considerably after treatment with different lactobacilli. H pylori The adhesion rate ranged from 66.53% to 113.36%, with 5 strains corresponding to [the specific bacteria / organisms]. H. pylori The adhesion rate is less than 80%. According to the... H. pylori The five strains were ranked by their ability to inhibit adhesion rate, and their strain numbers were: FB-A3, CCFM1259, FB-O2, TY-O1, and SN-L3.

[0070] (6) Antagonism H. pylori Selection of Lactobacillus strains Taking into account the inhibition of lactobacilli H. pylori Growth capacity and inhibition H. pylori Three strains of bacteria inhibited the ability of AGS cells to adhere. H. pylori While growing, they also effectively reduced adhesion rates. Ranked by their ability to inhibit adhesion, the following strains were observed: *Lactobacillus rhamnosus* CCFM1259, *Lactobacillus paracasei* TY-O1, and *Lactobacillus plantarum* SN-L3. CCFM1259 exhibited an inhibition zone 0.76 mm and 1.67 mm larger than the other two strains, respectively, and had adhesion rates 4.86 and 8.08 percentage points lower, respectively. Therefore, *Lactobacillus rhamnosus* CCFM1259 was selected as the preferred antagonist in this experiment. H. pylori Lactobacillus strains.

[0071] Example 2: Evaluation of the anti-Helicobacter pylori efficacy of HA combined with Lactobacillus rhamnosus in animals. After one week of normal feeding, several C57BL / 6 mice were randomly divided into 5 groups (n=10): control group, model group, and intervention group. The intervention group received HA (HA with an average molecular weight of 1400 kDa) and Lactobacillus rhamnosus CCFM1259 (1*10⁻⁶). 9 The first gavage consisted of (CFU / mL) and a mixture thereof, followed by a 1-hour interval before gavage administration of BHI resuspension. H. pylori (1*10 9(CFU / mL). Mice in the control group and model group were given the same volume of PBS during the first gavage, followed by an equal volume of BHI one hour later. Mice were gavaged every other day. Body weight changes in the mice were measured regularly. At the end of the experiment, the amount of pyloric colonization in the stomach, serum levels of anti-pyloric antibodies and cytokines (IL-8 and TNF-α) were measured, and histopathological sections of the gastric antrum and body were prepared. Mice were provided with normal drinking water and standard feed.

[0072] The specific treatment protocols for laboratory animals are shown in Table 2.

[0073] Table 2. Experimental animal treatment protocol 1 (n=10)

[0074] Note: BHI is brain-heart broth culture medium. The first and second gavages are administered one hour apart each day.

[0075] HA group: The amount of sodium hyaluronate is calculated at 200mg / day / person (person is calculated as 60kg), which is converted to the recommended dose for mice: 9.1*200mg / 60kg=30mg / kg (mice are calculated as 20g). Based on the gavage volume of 0.2mL, the concentration of sodium hyaluronate solution is 3g / L.

[0076] HA+CCFM1259 group: The dosage of sodium hyaluronate and Lactobacillus rhamnosus was halved compared with the HA group and CCFM1259 group.

[0077] (1) Changes in mouse body weight during the experiment As shown in Table 3, the weight of the mice remained around 20g throughout the experiment, with no significant differences in weight between groups and no significant changes in weight before and after intervention between groups. H. Pylori Infection and compound formulation intervention did not have a significant effect on mouse body weight.

[0078] Table 3. Changes in mouse body weight in each group during the experiment (Mean ± SD)

[0079] (2) Different treatments H. Pylori The impact of planting quantity H. Pylori Changes in the amount of colonization in the mouse stomach reflect the effect of the intervention group on... H. Pylori The most direct indicator of the effectiveness of infection control. (By...) Figure 1 It can be seen that: in the stomach of the model group mice H. Pylori The content was approximately 236 times that of the control group, and the model group H. Pylori The number of plants planted increased significantly ( p <0.01 indicates successful modeling. After HA ( p<0.01), Lactobacillus rhamnosus CCFM1259 ( p <0.05) and compound formulations ( p After treatment with <0.001), the stomach of mice was infected. H. Pylori The number of plants planted decreased significantly; compared with the model group, H. Pylori The mean Log values ​​of colony size decreased by approximately 34.75%, 29.33%, and 52.64%, respectively. Furthermore, the combined treatment group showed significantly better results than the HA and CCFM1259 groups. p <0.05), compared with the HA group and CCFM1259 group, the compound group H. Pylori The mean Log values ​​of colonization decreased by 27.41% and 32.97%, respectively. In summary, the combined formulation is more effective than either HA or Lactobacillus rhamnosus CCFM1259 alone in reducing colony size. H. Pylori It has a synergistic effect on the amount of planting.

[0080] (3) Improvement of gastric pathology by different treatments Results of HE staining of gastric mucosa in mice under different treatment groups are as follows: Figure 2 As shown, infection H. Pylori The infiltration of inflammatory cells (lymphocytes and eosinophils) in the lamina propria of the gastric mucosa of mice was significantly increased afterward. Figure 2 B), after HA group ( Figure 2 C), Lactobacillus rhamnosus CCFM1259 group ( Figure 2 D) and compound formulations ( Figure 4 After processing, H. Pylori The inflammatory response caused by the infection was significantly improved. Compared with the HA group ( Figure 2 C) and Lactobacillus rhamnosus CCFM1259 group ( Figure 2 Compared to D), the compound formulation ( Figure 2 E) The treatment significantly improved the gastric mucosa of mice, with virtually no inflammatory cell infiltration. This further demonstrates the antagonistic effect between Lactobacillus rhamnosus CCFM1259 and HA. H. Pylori Inflammatory responses caused by infection have a synergistic effect.

[0081] The results of this embodiment show that HA, Lactobacillus rhamnosus CCFM1259, and the compound formulation can all significantly reduce gastric toxicity in mice. H. Pylori Planting density, and for H. Pylori The inflammatory response caused by infection was significantly improved. The compound formulation showed a greater reduction in [the inflammatory response] compared to HA alone or probiotics alone. H. Pylori The colonization effect was more significant in terms of improving the gastric mucosa in mice. There was virtually no inflammatory cell infiltration in the lamina propria of the mouse gastric mucosa, indicating that *Lactobacillus rhamnosus* CCFM1259 and HA have an antagonistic relationship. H. PyloriInfection-induced inflammatory response and reduction of gastric contents in mice H. Pylori There is a synergistic effect in terms of planting volume.

[0082] Example 3: Evaluation of the efficacy of different molecular weight HA combined with Lactobacillus rhamnosus in in vivo infection of Helicobacter pylori. After one week of normal feeding, several C57BL / 6 mice were randomly divided into 7 groups (n=10): control group, model group, and intervention group. The intervention group was treated with HA (hypoallergenic acid) with average molecular weights of 1200 kDa, 1400 kDa, 1600 kDa, 1800 kDa, and 2000 kDa, respectively, along with Lactobacillus rhamnosus CCFM1259 (1*10). 9 The mixture (CFU / mL) was prepared by mixing the contents at a 1:1 volume ratio and administered via the first gavage. One hour later, BHI resuspension was administered via gavage. H. pylori (1*10 9 (CFU / mL). The control group and model group mice were given the same volume of PBS by gavage for the first time, and then the same volume of BHI by gavage one hour later. Mice were gavaged every other day. Changes in mouse body weight were measured regularly; the amount of pyloric colonization in the stomach of the mice was measured at the end of the experiment. Mice were provided with normal drinking water and standard feed.

[0083] The specific treatment protocols for laboratory animals are shown in Table 4.

[0084] Table 4. Experimental animal treatment plan 2 (n=10)

[0085] Note: BHI is brain-heart broth culture medium. The first and second gavages are administered one hour apart each day.

[0086] Sodium hyaluronate is administered at a dose of 200 mg / day / person (based on a human weight of 60 kg). The recommended dose for mice is 9.1 * 200 mg / 60 kg = 30 mg / kg (based on a mouse weight of 20 g). Based on an oral gavage volume of 0.2 mL, the concentration of the sodium hyaluronate solution is 3 g / L.

[0087] When HA and Lactobacillus rhamnosus are mixed at a 1:1 ratio, the concentration of HA is 1.5 g / L and the concentration of Lactobacillus rhamnosus is 5 x 10⁻⁶ g / L. 8 CFU / mL.

[0088] (1) Survival rate and weight changes of mice during the experiment As shown in Table 5, the mouse weight remained around 20 g throughout the experiment, with no significant differences in weight between groups and no significant changes in weight before and after intervention between groups. H. Pylori Infection and compound formulation intervention did not have a significant effect on mouse body weight.

[0089] Table 5. Changes in mouse body weight in each group during the experiment (Mean±SD)

[0090] (2) Different molecular weight HA and Lactobacillus rhamnosus combination H. Pylori The impact of colonization Depend on Figure 3 It can be seen that: compared with the blank group, the model group H. Pylori The number of colonies increased significantly ( p The value was <0.01, and the mean value was approximately 155 times that of the control group, indicating successful modeling. Treatment with HA containing average molecular weights of 1200 kDa, 1400 kDa, 1600 kDa, 1800 kDa, and 2000 kDa, combined with *Lactobacillus rhamnosus* CCFM1259, significantly reduced gastric toxicity in mice. H. Pylori Population size ( p <0.05); compared with the model group, H. Pylori The mean Log values ​​of colonization decreased by 31.93%, 47.83%, 53.92%, 49.16%, and 34.76%, respectively. In particular, the combination of HA with average molecular weights of 1400 kDa, 1600 kDa, and 1800 kDa with *Lactobacillus rhamnosus* CCFM1259 significantly reduced gastric colonization. H. Pylori The colony population decreased significantly. p <0.001), the effect is similar to that of the blank group.

[0091] As can be seen from the results of this embodiment, H. Pylori Infected mice, after being administered a compound of HA (with an average molecular weight of 1400-1800 kDa) and Lactobacillus rhamnosus CCFM1259 via gavage, showed a significant reduction in gastric thrombocytopenia compared to the model group. H. Pylori Planting quantity ( p <0.01), and H. Pylori The mean Log value of colonization can decrease by 47.83%-53.92%, which is more significant than that of HA compound products with 1200 kDa and 2000 kDa, and is close to the normal level.

[0092] Example 4: Clinical efficacy evaluation of hyaluronic acid-Lactobacillus rhamnosus composition against Helicobacter pylori 4.1 Study population The clinical study recruited 40 patients (aged 28-65, half male and half female) who tested positive for Helicobacter pylori infection. The diagnostic criteria were... 14 C-breath test, rapid urease test, or histological examination. Volunteers were required to have not previously received anti-Helicobacter pylori treatment and had not taken antibiotics or probiotic products in the month prior to enrollment; had not undergone gastrointestinal surgery; and strictly adhere to the product instructions during the experiment, without taking antibiotics or other probiotic products.

[0093] 4.2 Clinical Study Design (1) Experimental products The probiotic compound product, hyaluronic acid product, and placebo product in the experiment were all food-grade products, which could be taken directly or dissolved in warm water (not exceeding 37 ℃). They were provided by the Food Biotechnology Center of the School of Food Science and Technology, Jiangnan University. All products were powders and had the same appearance and packaging.

[0094] A: HA-Probiotic Compound Products: ① Lactobacillus rhamnosus freeze-dried powder (1×10 11 ① 50mg / strip of CFU / g bacterial powder; ② 100mg / strip of sodium hyaluronate with an average molecular weight of 1600kDa; ③ 300mg / strip of inulin; ④ 150mg / strip of galactooligosaccharide; ⑤ 80mg / strip of isomaltooligosaccharide; ⑥ 1320mg / strip of maltodextrin.

[0095] B: Placebo products: ① Inulin 300mg / strip; ② Galacto-oligosaccharide 150mg / strip; ③ Isomaltooligosaccharide 80mg / strip; ④ Maltodextrin 1470mg / strip.

[0096] (2) Experimental design and subject grouping The experimental design was a double-blind, parallel randomized controlled trial.

[0097] After the 40 participants were recruited, they were divided into two groups. Using computer software to generate a random number sequence, the 40 patients infected with Helicobacter pylori were randomly assigned to two groups: a placebo group and a hyaluronic acid-probiotic combination group, with 20 participants in each group. Each group took the probiotic powder twice daily (the placebo group and the combination group were identical in appearance and packaging except for the ingredients, showing no significant difference).

[0098] (3) Research period Because probiotics require a certain amount of time to exert their physiological characteristics, the study period was 10 weeks. This included a 2-week preparatory period, a 4-week probiotic administration period, and a 4-week follow-up observation period.

[0099] (4) Index Measurement 14 C. Breath test, scale indicators (GSRS scale), and gut microbiota distribution.

[0100] 4.3 Clinical Trial Results (1) Basic information of clinical subjects Table 6 Basic Information of Enrolled Subjects

[0101] The clinical trial recruited 40 qualified participants. H. pyloriPositive patients, of whom 7 withdrew midway or were lost to follow-up. Table 6 shows the basic information of the two groups of participants, such as gender and age. There was no significant difference in the baseline characteristics of the two groups of participants.

[0102] (2) Effects of different intervention methods on subjects 14 Effect of C-expiratory value Measurement 14 C-expiratory value can characterize the patient's... H. pylori The infection status. The experimental results in Tables 7 and 8 show that after taking the compound formula, the seroconversion rate and effectiveness rate of Helicobacter pylori patients reached 70.59% and 82.35%, respectively. Compared with the placebo group, the seroconversion rate and effectiveness rate increased by 125.88% and 119.60%, respectively.

[0103] Table 7. Effects of compound formulations on subjects H. pylori Impact of negative conversion rate

[0104] Table 8. Effect of compound formulation on the anti-hepatitis B efficacy of subjects

[0105] (3) The effects of different intervention methods on the gastrointestinal symptoms of the subjects The GSRS (Gastrointestinal Symptom Rating Scale) is an important indicator of the severity and frequency of gastrointestinal symptoms in clinical patients; a lower score indicates milder symptoms. Subjects completed the test one day before and one day after the experiment. Figure 4 Statistical results showed that there was no significant change in gastrointestinal adverse symptoms in the placebo group before and after the intervention. p >0.05); however, after intervention in the HA-probiotic compound group, the gastrointestinal symptoms of all subjects were significantly improved ( p <0.05).

[0106] (4) The effects of different intervention methods on the composition and diversity of gut microbiota in subjects Compared with the placebo group, the gut microbiota composition of the subjects changed after intervention with the HA-probiotic compound formulation.

[0107] Door level analysis: like Figure 5 As shown in Figure A, the gut microbiota is mainly composed of Firmicutes, Actinobacteria, Bacteroidetes, and Proteobacteria. Compared with the placebo group, the proportion of Actinobacteria in the fecal gut microbiota of the combination therapy group was increased.

[0108] Genus-level analysis: Furthermore, genus-level analysis was performed on the fecal gut microbiota of the two groups, and the results are as follows: Figure 5As shown in B, compared with the placebo group, the combination group reduced the abundance of Streptococcus spp., Ruminococcus spp., and opportunistic pathogens Escherichia spp.-Shigella spp., while increasing the abundance of beneficial bacteria such as Lactobacillus spp. and Bifidobacterium spp.

[0109] The results of the above examples show that after intervention with the prebiotic combination of HA and Lactobacillus rhamnosus, the gastrointestinal symptoms of the subjects were significantly improved (GSRS score). p <0.05), the patient's negative conversion rate and efficacy were also increased several times, indicating that the composition of this application has an antagonistic effect on the stomach. H. pylori The treatment showed significant efficacy against infection. Following intervention with the compound preparation, H. pylori The patients' seroconversion rate and efficacy rate reached 70.59% and 82.35%, respectively, which were 2.126 times and 2.120 times that of the placebo group. In addition, the compound group also improved the composition and diversity of intestinal flora, reduced the proportion of pathogenic bacteria in the intestine, and increased the abundance of beneficial bacteria such as Lactobacillus and Bifidobacterium, which is beneficial to maintaining the gastrointestinal health of patients.

[0110] Although the embodiments of this application have been described above in conjunction with the specific embodiments described, this application is not limited to the specific embodiments and application fields described above. The specific embodiments described above are merely illustrative and instructive, and not restrictive. Those skilled in the art can make many other forms based on the teachings of this specification and without departing from the scope of protection of the claims of this application, and these are all within the scope of protection of this application.

Claims

1. A strain of Lactobacillus rhamnosus ( Lactobacillus rhamnosus It is deposited at the Guangdong Provincial Center for Microbial Culture Collection, with accession number GDMCC NO.62419.

2. The Lactobacillus rhamnosus of claim 1, wherein the 16S rRNA gene sequence is shown in SEQ ID NO:

1.

3. The use of Lactobacillus rhamnosus as described in claim 1 in the preparation of products that inhibit Helicobacter pylori.

4. A composition for inhibiting Helicobacter pylori, comprising hyaluronic acid or a salt thereof and Lactobacillus rhamnosus as described in claim 1 or 2.

5. The composition of claim 4, wherein, in, The average molecular weight of the hyaluronic acid or its salt is 1400-1800 kDa.

6. The composition of claim 4, wherein, The hyaluronic acid salt is any one or more of the sodium, potassium, magnesium, calcium, zinc, and bismuth salts of hyaluronic acid.

7. The composition according to claim 4 or 5, characterized in that, The composition is capable of providing ≥80 mg / day / person of hyaluronic acid or a salt thereof, or, The viable cell number of the Lactobacillus rhamnosus is ≥ 1 x 10 9 cfu / day / person of Lactobacillus rhamnosus.

8. The composition according to claim 4 or 5, characterized in that, The composition is capable of providing ≥100 mg / day / person of hyaluronic acid or a salt thereof, or, The viable cell number of the Lactobacillus rhamnosus is ≥ 1 x 10 10 cfu / day / person of Lactobacillus rhamnosus.

9. The composition of claim 4, wherein, It also includes auxiliary materials.

10. The composition of claim 9, wherein, The excipients are one or more of inulin, galactooligosaccharide, isomaltooligosaccharide, or maltodextrin.

11. The composition of claim 4, wherein, The dosage form of the composition may be pills, granules, powders, tablets, capsules, or emulsions.

12. The use of Lactobacillus rhamnosus as described in claim 1 or 2 in the preparation of food or health products.

13. Use of the composition according to any one of claims 4-11 in the preparation of food or health products.

14. Use according to claim 13, characterized in that, The dosage of the hyaluronic acid or its salt is ≥80mg / day / person, or, The dosage of the Lactobacillus rhamnosus is ≥1×10 9 cfu / day / person of Lactobacillus rhamnosus.

15. The use according to claim 13, characterized in that, The dosage of the hyaluronic acid or its salt is ≥100mg / day / person, or, The dosage of the Lactobacillus rhamnosus is ≥1×10 10 cfu / day / person of Lactobacillus rhamnosus.

16. Use according to claim 13, characterized in that, The hyaluronic acid salt is any one or more of the sodium, potassium, magnesium, calcium, zinc, and bismuth salts of hyaluronic acid.

17. Use according to any one of claims 13-16, characterized in that, The average molecular weight of the hyaluronic acid or its salt is 1200-2000 kDa.

18. Use according to claim 17, characterized in that, The average molecular weight of the hyaluronic acid or its salt is 1400-1800 kDa.