A microbial compound inoculant suitable for fermenting livestock and poultry manure and straw, and its preparation method.

Abstract

This invention discloses a microbial compound agent suitable for the fermentation of livestock and poultry manure and straw, and its preparation method. The microbial compound agent consists of the following bacteria: the DNA gene sequence of *Lysinibacillus macroides* is shown in SEQ ID NO.1; the DNA gene sequence of *Bacillus sp.* is shown in SEQ ID NO.2; and the DNA gene sequence of *Brevibacillus sp.* is shown in SEQ ID NO.3. The strains of the microbial compound agent of this invention are derived from the high-temperature dominant bacterial groups during the natural fermentation process of straw compost. Through long-term screening and domestication, it can effectively promote the fermentation production process of organic fertilizer using straw and livestock and poultry manure as the main raw materials, improve the production efficiency and fertilizer effect of organic fertilizer, and at the same time improve the harmless treatment effect of straw and manure.

Description

Technical Field

[0001] This invention relates to the field of microbial technology, specifically to a microbial compound agent suitable for the fermentation of livestock and poultry manure and straw, and its preparation method. Background Technology

[0002] Organic fertilizers are rich in organic nutrients such as humic acid and amino acids, as well as inorganic nutrients such as nitrogen, phosphorus, and potassium, and have always played a vital role in my country's agricultural development. In the development of modern agricultural science and technology, the use of chemical fertilizers has brought enormous benefits to agricultural production, increasing crop yields and farmers' incomes. However, since the mid-20th century, due to the excessive use of chemical fertilizers and insufficient attention paid to organic fertilizers, the area and amount of organic fertilizers applied have gradually decreased. This has led to adverse consequences such as soil degradation, soil compaction, reduction of organic matter and beneficial microorganisms, imbalance of the farmland ecological environment, decline in product quality, and pollution of the agricultural environment and groundwater resources, posing a potential threat to human health. The development of the market economy and the increasing demand for green food have placed higher requirements on the quality of agricultural products, especially fruits and vegetables. Therefore, it is necessary to use appropriate amounts of harmless and highly stable organic fertilizers to replenish the substances taken from the soil by crops, enrich the soil fertility, and achieve the goals of ecological sustainability, safety, high yield, high quality, and high efficiency.

[0003] Straw is a general term for the stems and leaves (ears) of mature crops. Straw is rich in nitrogen, phosphorus, potassium, calcium, magnesium and organic matter, and is a renewable biological resource with multiple uses. Livestock and poultry manure mainly refers to a type of rural solid waste generated in the livestock and poultry breeding industry, including pig manure, cow manure, sheep manure, chicken manure and duck manure. In agricultural production, straw and livestock and poultry manure are often mixed and fermented as organic fertilizer for reuse in farmland. However, the fermentation agents used in the existing straw and livestock and poultry manure mixed fermentation are relatively simple. The functions of single microbial strains are limited, and they cannot maximize the improvement of the efficiency of livestock and poultry manure and straw fermentation composting technology. Summary of the Invention

[0004] One object of the present invention is to solve at least the above-mentioned problems and / or defects, and to provide at least the advantages described below.

[0005] To achieve these objectives and other advantages according to the present invention, a microbial compound agent suitable for fermenting livestock and poultry manure and straw is provided. The microorganisms in the microbial compound agent consist of the following bacteria: *Lysinibacillus macroides* SWUST-1, *Bacillus* sp. SWUST-3, and *Brevibacillus* sp. SWUST-3. Specifically, the *Lysinibacillus macroides* is classified as *Lysinibacillus macroides* SWUST-1 and was deposited with the China General Microbiological Culture Collection Center (CGMCC) on May 12, 2022, with accession number CGMCC No. M 24857; the *Bacillus* sp. SWUST-3 was registered with the CGMCC on May 12, 2022, with accession number CGMCC No. M 24858; and the *Brevibacillus* sp. SWUST-3 is classified as *Brevibacillus* sp. SWUST-3. sp.SWUST-2 was deposited at the China General Microbiological Culture Collection Center (CGMCC) on May 12, 2022, with accession number CGMCC No.M 24859. The deposit address is No.3, No.1 Beichen West Road, Chaoyang District, Beijing.

[0006] Preferably, the DNA gene sequence of the slender lysine spore bacillus (Lysinibacillus macroides SWUST-1) is shown in SEQ ID NO.1.

[0007] Preferably, the DNA gene sequence of the Bacillus sp. SWUST-3 is shown in SEQ ID NO.2.

[0008] Preferably, the DNA gene sequence of the Brevibacillus sp. SWUST-2 is shown in SEQ ID NO.3.

[0009] This invention also provides a method for preparing the microbial compound inoculant suitable for fermentation of livestock and poultry manure and straw, as described above. Two loops of *Lysinibacillus macroides* SWUST-1, *Bacillus sp.* SWUST-3, and *Brevibacillus sp.* SWUST-2* slant seed culture are picked up using an inoculation loop and placed in a 250 mL Erlenmeyer flask containing 50 mL of nutrient broth. The flask is then incubated at 37°C and 150 rpm for 18 h to obtain primary seed cultures of *Lysinibacillus macroides*, *Bacillus sp.* SWUST-3, and *Brevibacillus sp.* SWUST-2, respectively. The primary seed culture of *Lysinibacillus macroides* is then inoculated at 3% (v / v) into 250 mL of optimized culture medium and incubated at 37°C and 150 rpm for 30 h in a shake flask to obtain *Lysinibacillus macroides* SWUST-1. Secondary seed culture of Bacillus: Primary seed culture of Bacillus and primary seed culture of Bacillus brevis were inoculated into 250 mL of nutrient broth medium at an inoculation rate of 6% (v / v) and cultured in a shake flask at 37℃ and 150 r / min for 30 h to obtain secondary seed culture of Bacillus and Bacillus brevis, respectively; Secondary seed culture of Bacillus slenderus, Bacillus, and Bacillus brevis was combined in a ratio of 1-1.5:2:2 to obtain a microbial compound inoculum.

[0010] Preferably, the optimized culture medium has the following composition: CMC-Na 5.0g, (NH4)2SO4 2.0g, K2HPO4 1.0g, MgSO4·7H2O 0.5g, NaCl 0.5g, FeSO4·7H2O 0.1g, distilled water 1000mL, and pH value 7.0-7.2.

[0011] Preferably, the total bacterial count of the compound bacterial solution reaches 2.5 × 10⁻⁶. 9 CFU / mL.

[0012] The present invention has at least the following beneficial effects: the strains of the microbial compound agent of the present invention are derived from the high-temperature dominant microbial groups in the natural fermentation process of straw compost. After long-term screening and domestication, it can effectively promote the fermentation production process of organic fertilizer with straw and livestock and poultry manure as the main raw materials, improve the production efficiency and fertilizer effect of organic fertilizer, and at the same time improve the harmless treatment effect of straw and manure.

[0013] Other advantages, objectives and features of the present invention will become apparent in part from the following description, and in part from those skilled in the art through study and practice of the invention. Attached image description:

[0014] Figure 1 The hydrolysis zone is a staining zone formed during the initial screening process of the strain of this invention.

[0015] Figure 2 This is the glucose standard curve during the secondary screening process of the strains of this invention. Detailed implementation method:

[0016] The present invention will now be described in further detail with reference to the accompanying drawings, so that those skilled in the art can implement it based on the description.

[0017] It should be understood that terms such as “having,” “comprising,” and “including” as used herein do not imply the presence or addition of one or more other elements or combinations thereof.

[0018] Example 1:

[0019] A microbial compound agent suitable for fermenting livestock and poultry manure and straw, wherein the microorganisms in the microbial compound agent consist of the following bacteria: *Lysinibacillus macroides* SWUST-1, *Bacillus* sp. SWUST-3, and *Brevibacillus* sp. SWUST-3. Specifically, the *Lysinibacillus macroides* is classified as *Lysinibacillus macroides* SWUST-1, and was deposited at the China General Microbiological Culture Collection Center (CGMCC) on May 12, 2022, with accession number CGMCC No. M 24857; the *Bacillus* sp. SWUST-3 is classified as *Bacillus* sp. SWUST-3, and was deposited at the CGMCC on May 12, 2022, with accession number CGMCC No. M 24858; the *Brevibacillus* sp. SWUST-3 is classified as *Brevibacillus* sp. SWUST-3. The gene sequence of *S. SWUST-2* was deposited at the China General Microbiological Culture Collection Center (CGMCC) on May 12, 2022, with accession number CGMCC No. M 24859. The DNA sequence of *Lysinibacillus macroides* SWUST-1 is shown in SEQ ID NO. 1; the DNA sequence of *Bacillus sp. SWUST-3* is shown in SEQ ID NO. 2; and the DNA sequence of *Brevibacillus sp. SWUST-2* is shown in SEQ ID NO. 3.

[0020] A method for preparing a microbial compound inoculant suitable for fermenting livestock and poultry manure and straw, as described above, involves using an inoculation loop to pick two loops of slant seed culture of *Lysinibacillus macroides* SWUST-1, *Bacillus sp.* SWUST-3, and *Brevibacillus sp.* SWUST-2, respectively, and placing them into a 250 mL Erlenmeyer flask containing 50 mL of nutrient broth. The flask is then incubated at 37°C and 150 r / min for 18 h to obtain primary seed cultures of *Lysinibacillus macroides*, *Bacillus sp.* SWUST-3, and *Brevibacillus sp.* SWUST-2, respectively. The primary seed culture of *Lysinibacillus macroides* is then inoculated at a rate of 3% (v / v) into 250 mL of optimized culture medium (CMC-Na 5.0 g, (NH4)2SO4 2.0 g, K2HPO4 1.0 g, MgSO4·7H2O 0.5 g, NaCl). 0.5g of *Bacillus longiflorus*, 0.1g of FeSO4·7H2O, 1000mL of distilled water (pH 7.0–7.2), were cultured in a shake flask at 37℃ and 150r / min for 30h to obtain a secondary seed culture of *Bacillus longiflorus*. The primary seed cultures of *Bacillus longiflorus* and *Bacillus brevis* were inoculated at 6% (v / v) into 250mL of nutrient broth and cultured in a shake flask at 37℃ and 150r / min for 30h to obtain secondary seed cultures of *Bacillus longiflorus* and *Bacillus brevis*, respectively. The secondary seed cultures of *Bacillus longiflorus*, *Bacillus longiflorus*, and *Bacillus brevis* were combined in a ratio of 1.5:2:2 to obtain a microbial compound inoculum. The total colony count of the compound inoculum reached 2.5 × 10⁻⁶. 9 CFU / mL.

[0021] Application Example 1:

[0022] Pig manure and straw were mixed at a weight ratio of 1:3, and the carbon-nitrogen ratio was adjusted to 25:1. At the same time, the compound microbial agent of Example 1 was added at a weight ratio of 3%. Water was added to adjust the moisture content to 60%. Temperature and moisture content were monitored regularly, and the temperature was maintained at 60°C. Water was added to maintain the compost moisture content at about 60%. When the temperature dropped significantly, the compost was turned over. The compost was turned over 3 times. After the temperature no longer rose significantly, the compost was fermented for 10 days to obtain organic fertilizer. Its various properties (Table 1) meet the national standards.

[0023] Comparative Example 1:

[0024] Pig manure and straw were mixed at a weight ratio of 1:3, and the carbon-nitrogen ratio was adjusted to 25:1. At the same time, 3% of Bacillus lysine spores were inoculated. Water was added to adjust the moisture content to 60%. Temperature and moisture content were monitored regularly. The temperature was maintained at 60℃, and water was added to maintain the compost moisture content at about 60%. When the temperature dropped significantly, the compost was turned over. The compost was turned over 3 times. After the temperature no longer rose significantly, it was decomposed for 10 days to obtain organic fertilizer. Its various properties are shown in Table 1.

[0025] The preparation method of the *Bacillus lysine* inoculum is as follows: Two loops of *Bacillus lysine* slant seed culture are picked up with an inoculation loop and placed in a 250 mL Erlenmeyer flask containing 50 mL of nutrient broth. The flask is incubated at 37°C and 150 r / min for 18 h to obtain the primary seed culture of *Bacillus lysine*. The primary seed culture of *Bacillus lysine* is then inoculated at a rate of 3% (v / v) into 250 mL of optimized culture medium (CMC-Na 5.0 g, (NH4)2SO4 2.0 g, K2HPO4 1.0 g, MgSO4·7H2O 0.5 g, NaCl 0.5 g, FeSO4·7H2O). A secondary seed culture of *Lysinibacillus macroides* was prepared by incubating 0.1 g of *Lysinibacillus macroides* (000 mL of distilled water, pH 7.0–7.2) in a shake flask at 37°C and 150 r / min for 30 h, which is called *Lysinibacillus macroides* inoculum. The *Lysinibacillus macroides* is classified as *Lysinibacillus macroides* SWUST-1 and was deposited at the China General Microbiological Culture Collection Center on May 12, 2022, with accession number CGMCC No. M24857. The DNA sequence of *Lysinibacillus macroides* SWUST-1 is shown in SEQ ID NO. 1.

[0026] Table 1

[0027]

[0028]

[0029] Comparative Example 2:

[0030] Pig manure and straw were mixed at a weight ratio of 1:3, and the carbon-nitrogen ratio was adjusted to 25:1. At the same time, Bacillus inoculum was inoculated at a weight ratio of 3%. Water was added to adjust the moisture content to 60%. Temperature and moisture content were monitored regularly, and the temperature was maintained at 60℃. Water was added to maintain the compost moisture content at about 60%. When the temperature dropped significantly, the compost was turned over. The compost was turned over 3 times in total. After the temperature no longer rose significantly, the compost was decomposed for 10 days to obtain organic fertilizer. Its various properties are shown in Table 1.

[0031] The preparation method of the Bacillus inoculum is as follows: Two loops of Bacillus slant seed culture are picked up with an inoculation loop and placed in a 250 mL Erlenmeyer flask containing 50 mL of nutrient broth. The flask is incubated at 37°C and 150 r / min for 18 h to obtain a primary seed culture of Bacillus. The primary seed culture of Bacillus is then inoculated into 250 mL of nutrient broth at an inoculation rate of 6% (v / v). The flask is then incubated at 37°C and 150 r / min for 30 h to obtain a secondary seed culture of Bacillus, i.e., the Bacillus inoculum. The Bacillus is classified as Bacillus sp. SWUST-3, and was deposited at the China General Microbiological Culture Collection Center on May 12, 2022, with accession number CGMCC No. M 24858. The DNA gene sequence of Bacillus sp. SWUST-3 is shown in SEQ ID NO. 2.

[0032] Comparative Example 3:

[0033] Pig manure and straw were mixed at a weight ratio of 1:3, and the carbon-nitrogen ratio was adjusted to 25:1. At the same time, Bacillus brevis inoculum was inoculated at a weight ratio of 3%. Water was added to adjust the moisture content to 60%. Temperature and moisture content were monitored regularly, and the temperature was maintained at 60℃. Water was added to maintain the compost moisture content at about 60%. When the temperature dropped significantly, the compost was turned over. The compost was turned over 3 times in total. After the temperature no longer rose significantly, the compost was decomposed for 10 days to obtain organic fertilizer. Its various properties are shown in Table 1.

[0034] The preparation method of the *Brevibacillus sp. SWUST-2* inoculum is as follows: Two loops of *Brevibacillus sp. SWUST-2* slant seed culture are picked up with an inoculation loop and placed in a 250 mL Erlenmeyer flask containing 50 mL of nutrient broth. The flask is incubated at 37°C and 150 r / min for 18 h to obtain primary seed culture of *Brevibacillus sp. SWUST-2*. The primary seed culture is then inoculated into 250 mL of nutrient broth at a 6% (v / v) inoculation rate and cultured at 37°C and 150 r / min for 30 h to obtain secondary seed culture of *Brevibacillus sp. SWUST-2*. The *Brevibacillus sp. SWUST-2* is classified and deposited at the China General Microbiological Culture Collection Center (CGMCC) on May 12, 2022, with accession number CGMCC No. M 24859. The DNA sequence of *Brevibacillus sp. SWUST-2* is shown in SEQ ID NO. 3.

[0035] The screening and identification process of slender lysine-containing Bacillus, Bacillus, and brevis Bacillus used in this invention is as follows:

[0036] I. Initial screening of bacterial strains (high-temperature enrichment and high-temperature culture)

[0037] Take 10g of manure sample from the composting process of poultry and livestock, and place it in a 250mL Erlenmeyer flask containing 100mL of sterile physiological saline under aseptic conditions; activate and enrich it in a constant temperature shaking incubator at 50℃ and 150r / min for 24h.

[0038] The activated bacterial solution was diluted sequentially with sterile water until the bacterial solution was diluted to 10. -5 10 -6 10 -7 Three gradients were used. 100 μL of each diluted solution was added dropwise to screening medium (sodium carboxymethyl cellulose (CMC-Na) 5.0 g, ammonium sulfate (NH4)2SO4 2.0 g, dipotassium hydrogen phosphate (K2HPO4) 1.0 g, magnesium sulfate heptahydrate (MgSO4·7H2O) 0.5 g, sodium chloride (NaCl) 0.5 g, ferrous sulfate heptahydrate (FeSO4·7H2O) 0.1 g, agar powder 20 g, pH 7.0–7.2. After dissolving the above substances, the volume was adjusted to 1000 mL with distilled water. The medium was sterilized at 121℃ and 0.1 MPa for 20 min. The plates were evenly spread and allowed to dry and fix the bacterial culture. The plates were then inverted and placed in a constant temperature incubator at 50℃ for 72 h.

[0039] Large and distinct single colonies were selected and repeatedly streaked on plates for isolation and purification. Gram staining and electron microscopy observation were performed until no contaminating bacteria were observed. The purified colonies were inoculated onto selection medium plates and incubated at 30°C for 72 hours. After colony growth, Congo red staining was performed for 0.5 hours, followed by soaking in 1 mol / L sterile physiological saline for 0.5 hours. The enzyme-producing capacity of the strain was assessed based on the diameter of the clear hydrolysis zone produced by the colony. Generally, the larger the hydrolysis zone, the stronger the enzyme-producing capacity of the strain (e.g., ...). Figure 1 The obtained strain was mixed with 0.7 mL of bacterial solution and 0.3 mL of glycerol and stored at -80°C for later use.

[0040] II. Secondary screening of strains (carboxymethyl cellulase activity assay)

[0041] The cellulose-degrading bacteria obtained from the initial screening were inoculated into fermentation medium (carboxymethyl cellulose sodium CMC-Na 10.0g, ammonium sulfate (NH4)2SO4 2.0g, dipotassium hydrogen phosphate K2HPO4 1.0g, magnesium sulfate heptahydrate MgSO4·7H2O 0.5g, sodium chloride NaCl 0.5g, ferrous sulfate heptahydrate FeSO4·7H2O 0.1g, agar powder 20g, pH 7.0–7.2. After dissolving the above substances, the volume was adjusted to 1000mL with distilled water. Sterilized at 121℃, 0.1MPa for 20min) and cultured at 30℃ in a constant temperature shaking incubator at 150r / min for 72h. The activity of carboxymethyl cellulase (CMCase) was measured, and the strain with higher enzyme activity was selected as the target strain. The specific steps are as follows:

[0042] 1. Construction of the glucose standard curve

[0043] Take seven clean and dried 10 mL colorimetric tubes, and add 2 mL of glucose-citric acid mixture at concentrations of 0, 0.04, 0.08, 0.12, 0.16, 0.20, and 0.40 mg / mL, respectively. Then add 1.5 mL of DNS reagent, incubate in a boiling water bath for 10 min, rinse with running water, cool, and then add 1.5 mL of distilled water to bring the volume to 5 mL. Zero the instrument at a wavelength of 540 nm using a colorimetric tube with a glucose concentration of 0, and measure the absorbance at different glucose concentrations. Figure 2 ).

[0044] 2. Preparation of crude enzyme solution

[0045] Take 10 mL of fermentation broth and place it in a clean and dried 50 mL centrifuge tube. Centrifuge at 5000 r / min for 5 min at 4℃. The supernatant is then collected as the crude enzyme solution.

[0046] 3. Determination of enzyme activity

[0047] The enzyme activity of the fermentation broth was determined using the 3,5-dinitrosalicylic acid colorimetric method. The crude enzyme solution degraded cellulose to produce reducing sugars. These reducing sugars reduced the nitro groups of 3,5-dinitrosalicylic acid to amino groups, forming new amino compounds and causing a colorimetric reaction that turned the solution yellow. Under certain reducing sugar concentrations, the color depth of the mixture increased with increasing reducing sugar concentration, indicating a positive correlation between enzyme activity and the degree of colorimetric reaction.

[0048] CMCase activity assay: Four sterile and dried 10mL colorimetric tubes were used and numbered. Tube 0 was filled with 1.5mL of citrate buffer as a blank sample. The other three tubes were each filled with 1.5mL of 1.0% CMC-Na solution. 0.5mL of crude enzyme solution was added to each of the four tubes, and the mixture was incubated at 50℃ for 30min. After the incubation, 1.5mL of DNS reagent was added, and the mixture was boiled for 10min. The tubes were then rinsed with tap water and rapidly cooled. 1.5mL of distilled water was added. The absorbance was measured at 540nm (Table 2).

[0049] Table 2

[0050]

[0051]

[0052] III. Molecular Identification of Strains

[0053] Strains #1, #3, and #5, which exhibited high enzyme activity, were selected for sequencing identification. Colony DNA was extracted using a kit method, and PCR amplification was performed using 27F (GAGAGTTTGATCCTGGCTCAG) and 1492R (TACGGCTACCTTGTTACGAC) as forward and reverse primers, respectively. Electrophoresis revealed amplified bands at approximately 1500 bp for all three strains. The sequence of strain #1 is shown in SEQ ID NO.3; the sequence of strain #3 is shown in SEQ ID NO.1; and the sequence of strain #5 is shown in SEQ ID NO.2. The sequencing results were assembled using ContigExpress, and inaccurate ends were removed. The assembled sequences were compared in the NCBI database (blast.ncbi.nlm.nih.gov). Strains #1: *Brevibacillus* sp.; Strains #3: *Lysinibacillus macroides*; and Strains #5: *Bacillus* sp.

[0054] Although embodiments of the present invention have been disclosed above, they are not limited to the applications listed in the specification and embodiments. They can be applied to various fields suitable for the present invention. For those skilled in the art, other modifications can be easily made. Therefore, without departing from the general concept defined by the claims and their equivalents, the present invention is not limited to the specific details and examples shown and described herein.

Claims

1. A microbial compound inoculant suitable for fermenting livestock and poultry manure and straw, characterized in that, The microbial compound agent contains the following bacteria: Bacillus lysine-containing bacteria (… Lysinibacillus macroides SWUST-1, Bacillus ( Bacillus sp.) SWUST-3 and Bacillus brevis ( Brevibacillus sp.) SWUST-2; wherein, the slender lysine-containing Bacillus (sp.) Lysinibacillus macroides SWUST-1 was deposited with the China General Microbiological Culture Collection Center (CGMCC) on May 12, 2022, with accession number CGMCC No. M 24857; the Bacillus ( Bacillus SWUST-3 sp. was deposited at the China General Microbiological Culture Collection Center (CGMCC) on May 12, 2022, with accession number CGMCC No. M 24858; the described Bacillus brevis ( Brevibacillus sp.)SWUST-2 was deposited at the China General Microbiological Culture Collection Center on May 12, 2022, with accession number CGMCC No.M 24859.

2. A method for preparing a microbial compound inoculant suitable for fermenting livestock and poultry manure and straw as described in claim 1, characterized in that, Two loops of slender lysine-containing Bacillus were picked up using an inoculation loop. Lysinibacillus macroides SWUST-1, Bacillus ( Bacillus sp.) SWUST-3 and Bacillus brevis ( Brevibacillus (sp.) SWUST-2 slant seeds were cultured in 250 mL Erlenmeyer flasks containing 50 mL of nutrient broth at 37℃ and 150 r / min for 18 h to obtain primary seed cultures of *Bacillus longiflorus*, *Bacillus*, and *Bacillus shortiflorus*. The primary seed culture of *Bacillus longiflorus* was inoculated at 3% v / v into 250 mL of optimized medium and cultured in shake flasks at 37℃ and 150 r / min for 30 h to obtain secondary seed cultures of *Bacillus longiflorus*. Bacillus primary seed culture and Bacillus brevis primary seed culture were inoculated into 250 mL of nutrient broth medium at an inoculation rate of 6% v / v and cultured in a shake flask at 37℃ and 150 r / min for 30 h to obtain Bacillus secondary seed culture and Bacillus brevis secondary seed culture, respectively. The Bacillus brevis secondary seed culture, Bacillus secondary seed culture and Bacillus brevis secondary seed culture were combined in a ratio of 1-1.5:2:2 to obtain a microbial compound inoculum. The optimized culture medium consists of: CMC-Na 5.0 g, (NH4)2SO4 2.0 g, K2HPO4 1.0 g, MgSO4·7H2O 0.5 g, NaCl 0.5 g, FeSO4·7H2O 0.1 g, and 1000 mL of distilled water, with a pH of 7.0–7.

2.

3. The method for preparing the microbial compound inoculant suitable for fermenting livestock and poultry manure and straw as described in claim 2, characterized in that, The total bacterial count of the compound microbial agent reached 2.5 × 10⁻⁶. 9 CFU / mL.

Images