Recombinant adeno-associated virus genome and unipolar r aav vector packaged thereby

Abstract

This document relates to a recombinant adeno-associated virus (rAAV) genome and a single-polarity rAAV (spAAV) vector packaged therefrom. Provided herein is a pre-packaging spAAV genome having linear open ends at both ends, one of which does not have an inverted terminal repeat (ITR) or a portion thereof, and the other of which has an ITR truncation (ITRt) that does not form a T-shaped hairpin palindromic structure. The spAAV genome is single-polarity, single-stranded DNA. The spAAV vector produced from the pre-packaging spAAV genome provided herein is only one polarity of single-stranded DNA, i.e., either a spAAV vector of plus-strand DNA or a spAAV vector of minus-strand DNA, but not both. The spAAV vectors described herein are capable of delivering linear single-polarity, single-stranded DNA for gene expression, gene therapy, gene editing, gene regulation, and the like.

Description

Technical Field

[0001] This invention generally relates to gene vectors and the field of gene therapy, and more specifically, to a recombinant adeno-associated virus (rAAV) genome and a single polarity rAAV (spAAV) vector packaged therefrom. Background Technology

[0002] Gene therapy targets patients with genetic mutations caused by gene mutations or abnormal gene expression. It includes treating or preventing genetic diseases caused by gene defects, abnormal regulation, or abnormal expression, such as diseases resulting from insufficient or excessive gene expression, and malignant tumors. This can be achieved by providing patients with corrective genetic material to treat, prevent, or alleviate these conditions. Currently, gene delivery vectors mainly include viral gene vectors and non-viral gene vectors. Among the many available viral gene vectors, such as recombinant retroviruses, recombinant lentiviruses, and recombinant adenoviruses, recombinant adeno-associated virus (rAAV) gene vectors are becoming increasingly popular.

[0003] Adeno-associated virus (AAV) belongs to the Parvoviridae family. Due to its advantages such as non-pathogenicity, low immunogenicity, and broad-spectrum infectivity, it has become one of the most promising gene vectors for gene therapy. AAV is a non-enveloped single-stranded DNA virus carrying a linear single-stranded DNA genome of approximately 4.7 kb. At each end of the AAV DNA genome is a 145 bp inverted terminal repeat (ITR), with the last 125 bases forming a relatively long palindromic structure that folds itself through complementary base pairing, giving the ITR a T-shaped hairpin structure. Positive and negative strand DNA genomes carrying wild-type inverted terminal repeats are packaged into the AAV viral capsid with equal probability, resulting in the same number of positive or negative strand AAV viral particles. AAV viral particles infect cells, enter the nucleus, uncap, and release the AAV genome into the nucleus. The ITRs at both ends of the AAV genome can fold to form T-shaped hairpin structures. Their 3' ends act as primers for DNA synthesis, forming a second strand and creating a double-stranded DNA molecule, which then initiates the expression of genes carried in the AAV genome. The positive and negative strands of the AAV genome can also pair complementaryly to form a double-stranded DNA molecule, expressing genes.

[0004] Currently, it is widely believed in the art that the ITRs at both ends of the AAV DNA genome contain fundamental information for AAV DNA replication, packaging, integration, and rescue. The rAAV packaging systems used in this field all use the AAV ITRs as basic packaging elements, placing them at both ends of the exogenous genetic DNA that needs to be packaged into the rAAV capsid, thus packaging the exogenous genetic DNA into the rAAV vector. Such rAAV vectors have limitations in gene delivery, gene manipulation, and gene editing applications. For example, they cannot deliver single-stranded DNA with a single polarity for single-stranded DNA gene editing; it is difficult to design rAAV vectors that produce short-term gene expression for short-term gene expression, such as delivering nuclease genes for gene editing, as long-term gene expression poses off-target risks and cytotoxicity; it is difficult to achieve single-stranded gene pairing for the expression of large genes; and it cannot deliver long oligodeoxynucleotides for small nucleic acid gene therapy and gene regulation. Summary of the Invention

[0005] This paper presents a technical solution that provides an rAAV vector capable of packaging a single-polar, single-stranded DNA genome, also known as single-polar rAAV or spAAV. Through long-term research, the inventors have developed a pre-packaging spAAV genome with linear open ends. Its 5' end contains only a portion of the AAV ITR structural sequence elements, while its 3' end contains no AAV ITR structural sequence. The spAAV vector packaged according to this paper contains only DNA molecules of a single polarity; that is, it is either a positive-strand DNA molecule or a negative-strand DNA molecule, not a mixture of both. The spAAV vector can advantageously deliver single-stranded DNA with linear open ends of the same polarity (i.e., single-polar). In other words, the spAAV vector packaged according to this paper delivers either positive-strand DNA or negative-strand DNA; the two are not formed or delivered simultaneously. The spAAV vector packaged according to this paper can provide viral particle titers and cell infection performance comparable to traditional rAAV.

[0006] The spAAV vector obtained by pre-packaging spAAV genome as described in this article will greatly expand the application of AAV vectors in gene-targeted integration, large gene expression, efficient gene expression, short-term gene expression, nuclease-free gene editing, and long oligodeoxynucleotide delivery, and will strongly promote the development and application of AAV gene therapy.

[0007] On the one hand, this paper provides a pre-packaging spAAV genome, wherein both ends of the pre-packaging spAAV genome are linear open ends, one end of which does not have an ITR or a portion thereof, and the other end has an ITRt, wherein the ITRt does not form a T-shaped hairpin palindrome structure.

[0008] On the other hand, this article provides an spAAV vector comprising: a capsid protein; and a capsid protein-packaged spAAV genome; wherein the capsid protein-packaged spAAV genome is derived from the pre-packaged spAAV genome described herein.

[0009] On the other hand, this article also provides a spAAV transgenic plasmid for generating the pre-packaging spAAV genome described herein.

[0010] On the other hand, this paper also provides a method for packaging spAAV vectors, which includes: transforming the spAAV transgenic plasmid described herein and Cap and Rep expression plasmids into competent Escherichia coli cells, respectively; selecting white colonies after at least one round of blue-white screening, amplifying and extracting recombinant baculoviruses; transfecting insect cells with the recombinant baculoviruses to produce recombinant baculoviruses; and extracting the recombinant baculoviruses and infecting insect cells with the recombinant baculoviruses to obtain spAAV vectors.

[0011] On the other hand, this article also provides a method for delivering exogenous nucleic acids to cells, including contacting the cells with one or more spAAV vectors described herein.

[0012] The genome of one or more of the spAAV vectors contains the gene expression cassette of the exogenous nucleic acid and / or optional other DNA sequences.

[0013] On the other hand, this article also provides an isolated host cell containing the spAAV vector described herein.

[0014] On the other hand, this article also provides the use of the spAAV vector described herein in the preparation of products for gene expression.

[0015] On the other hand, this article also provides the use of the spAAV vector described herein in the preparation of products for gene therapy.

[0016] On the other hand, this article also provides the use of the spAAV vector described herein in the preparation of products for gene editing.

[0017] On the other hand, this article also provides the use of the spAAV vector described herein in the preparation of products for gene regulation. Attached Figure Description

[0018] The present invention will be further described below with reference to the accompanying drawings, which are shown only for illustrating embodiments of the present invention and are not intended to limit the scope of the present invention.

[0019] Figure 1 An exemplary schematic diagram of the DNA sequence structure of AAV2 Flip ITR (including RBE and trs) is shown.

[0020] Figure 2 A schematic diagram of the spAAV carrier construction package according to an exemplary embodiment of this document is shown.

[0021] Figure 3 This illustration shows a schematic diagram of gene expression in which positive and negative strand DNA of the spAAV vector simultaneously infects cells according to an exemplary embodiment of this document, the positive and negative strand DNA of the spAAV vector pairing, and gene expression.

[0022] Figure 4 This diagram illustrates gene expression through the integration of spAAV vector single-stranded DNA into the cellular genome according to an exemplary embodiment of this document.

[0023] Figure 5 The image shows an SDS-PAGE electrophoresis diagram of the spAAV vector capsid protein. Lane MW: protein molecular weight standard; Lane 1: rAAV-EGFP vector; Lane 2: spAAV-EGFP(+) vector; Lane 3: spAAV-EGFP(-) vector.

[0024] Figure 6 The image shows neutral agarose gel electrophoresis images of the positive and negative strands of the spAAV vector DNA. Lane MW: DNA molecular weight standard; Lane 1: rAAV-EGFP vector DNA; Lane 2: spAAV-EGFP(+) vector DNA; Lane 3: spAAV-EGFP(-) vector DNA; Lane 4: 2.4kb DNA PCR fragment.

[0025] Figure 7 The image shows alkaline denaturing agarose gel electrophoresis patterns of the positive and negative strands of the spAAV vector DNA. Lane MW: DNA molecular weight standard; Lane 1: rAAV-EGFP vector DNA; Lane 2: spAAV-EGFP(+) vector DNA; Lane 3: spAAV-EGFP(-) vector DNA; Lane 4: 2.4kb DNA PCR fragment.

[0026] Figure 8 The image shows the positive and negative strands of the spAAV vector DNA and the neutral agarose gel electrophoresis images after pairing. Lane MW: DNA molecular weight standard; Lane 1: rAAV-EGFP vector DNA; Lane 2: spAAV-EGFP(+) vector DNA; Lane 3: spAAV-EGFP vector DNA(-); Lane 4: annealed complementary product of spAAV-EGFP(+) vector DNA and spAAV-EGFP(-) vector DNA; Lane 5: 2.4kb DNA PCR fragment.

[0027] Figure 9The image shows the positive and negative strands of the spAAV vector DNA, after pairing and digestion with S1 nuclease, on a neutral agarose gel electrophoresis plate. Lane MW: DNA molecular weight standard; Lane 1: rAAV-Gli1 vector DNA; Lane 2: spAAV-EGFP(+) vector DNA; Lane 3: spAAV-EGFP(-) vector DNA; Lane 4: spAAV-EGFP(+) vector DNA + spAAV-EGFP(-) vector DNA; Lane 5: 2.4kb DNA PCR fragment; Lane 6: Denatured rAAV-Gli1 vector DNA; Lane 7: Denatured spAAV-EGFP(+) vector DNA + spAAV-EGFP(-) vector DNA; Lane 8: Denatured 2.4kb DNA PCR fragment.

[0028] Figure 10 Fluorescent images showing gene expression in HEK293 cells infected with the positive and negative strands of the spAAV vector DNA, respectively, and in combination, are displayed. A. HEK293 cells infected with the vector virus, EGFP expression after 24 hours; B. HEK293 cells infected with the vector virus, EGFP expression after 3 days; C. HEK293 cells infected with the vector virus, EGFP expression after 7 days; D. HEK293 cells infected with the vector virus, EGFP expression after 14 days. 1. rAAV-EGFP; 2. spAAV-EGFP(+); 3. spAAV-EGFP(-); 4. Co-infection with spAAV-EGFP(+) and spAAV-EGFP(-). Detailed Implementation

[0029] The technical terms used in this application have the same meaning as commonly understood by those skilled in the art, unless otherwise stated. In this application, the word "a" or its combination with various quantifiers includes both singular and plural meanings, unless specifically stated. In this application, when multiple numerical values, numerical ranges, or combinations thereof are given for the same parameter or variable, it is equivalent to specifically disclosing these numerical values, range endpoints, and numerical ranges formed by any combination thereof. In this application, any numerical value, whether or not it is modified by words such as "about," encompasses an approximate range that can be understood by those skilled in the art, such as plus or minus 10%, 5%, etc. In this document, each "implementation" equally refers to and covers the implementation methods and systems of this application. In this application, one or more technical features in any implementation can be freely combined with one or more technical features in any one or more other implementations, and the resulting implementation is also part of the disclosure of this application.

[0030] Adeno-associated virus (AAV) is a member of the parvoviridae family. It is non-enveloped and has an icosahedral symmetry structure. Currently, more than ten serotypes and more than one hundred variants of AAV have been discovered, among which AAV2 is the most thoroughly studied and widely used serotype.

[0031] The AAV genome consists of a linear single-stranded DNA of approximately 4.7 kb in length, with ITRs of approximately 145 bases each at both ends. The last 125 bases of the ITR contain a palindromic sequence that folds through complementary base pairing, forming a T-shaped hairpin structure. The ITR contains a Rep protein binding site (RBE) and a terminal resolution site (trs), which can be recognized and bound by the Rep protein, creating a cleavage at the trs.

[0032] The AAV genome contains two open reading frames (ORFs) between the two ITRs. These two ORFs encode the rep and cap genes, respectively. The rep gene encodes four Rep proteins: Rep78, Rep68, Rep52, and Rep40, which play a role in AAV viral replication, integration, rescue, and packaging. The cap gene encodes the AAV viral capsid proteins VP1, VP2, and VP3. VP1 is essential for the formation of infectious AAV, and VP3 is a major protein that makes up the AAV viral particle. The ratio of VP1, VP2, and VP3 in the AAV viral capsid is approximately 1:1:10.

[0033] Figure 1 A schematic diagram of the DNA sequence structure of the AAV2 Flip ITR is shown, in which the ITR forms a T-shaped palindromic hairpin structure. Figure 1 As shown, the sequence of the first 125 bases of the ITR can be divided into different segments: A', C', C, B', B, and A. B and B', and C and C' are anticomplementary, forming a T-shaped palindromic hairpin structure. A and A' form the handle of the hairpin. The A' segment is followed by the D segment. The positions of RBE and trs are shown below. Figure 1 exemplified.

[0034] Although the ITR sequences are not exactly the same in the genomes of AAV in various serotypes, they can all form T-shaped palindromic hairpin structures and have RBE and trs.

[0035] During AAV assembly to form viral particles, the positive and negative strands of the DNA genome carrying the wild-type ITR are packaged into the AAV viral capsid with equal probability, resulting in the production of the same number of positive or negative strand AAV viral particles. Once inside the cell, the AAV viral particles uncapsid and release the AAV genome. The ITRs at both ends of the AAV genome fold to form a T-shaped palindromic hairpin structure, and using the 3' end as a primer, a second strand is synthesized, forming a double-stranded molecule, which then initiates the expression of the genes carried by the AAV genome. The positive and negative strands of the AAV genome can also form double-stranded DNA through complementary pairing to express genes.

[0036] On the one hand, this paper provides a pre-packaging spAAV genome, wherein both ends of the pre-packaging spAAV genome are linear open ends, one end of which does not have an ITR or a portion thereof, and the other end has an ITRt, wherein the ITRt does not form a T-shaped hairpin palindrome structure.

[0037] In this article, the terms "unipolar" or "sp" refer to a single DNA polarity. That is, the spAAV vector generated from the pre-packaging spAAV genome packaging described in this article has only one polarity: either a spAAV vector with positive-strand DNA or a spAAV vector with negative-strand DNA; the two are not generated simultaneously. The spAAV vector generated from the pre-packaging spAAV genome packaging described in this article is also called a "unipolar rAAV vector" or "spAAV vector."

[0038] In this article, the term "recombinant adeno-associated virus vector" or "rAAV" refers to a non-wild-type adeno-associated virus particle that serves as a gene delivery vector and contains a recombinant AAV genome packaged within a viral capsid.

[0039] In this article, the term "pre-packaging spAAV genome" refers to the recombinant AAV genome to be packaged for subsequent packaging into the capsid protein.

[0040] In this article, the terms “open end” or “linear open end” refer to a 3’ or 5’ nucleotide sequence end that does not have any structure other than a linear straight chain (e.g., a hairpin structure).

[0041] In this article, the term "ITR or a portion thereof" refers to all or part of the DNA segment of the ITR, including "ITR constituent elements." For example, in Flip ITR (e.g., as... Figure 1 In the case shown), the components of the ITR include, but are not limited to: D region, trs site, RBE site, A' region (partial), C' region, C region, B' region, B region, A region, etc.

[0042] It should be understood that ITR sequences at the ends of the AAV genome often exhibit the same or different segment orientations, such as Flip / Flop, Flop / Flip, Flip / Flip, or Flop / Flop. An exemplary structural orientation of the “Flip” ITR is shown below. Figure 1 As shown. An exemplary structural orientation of the “Flop” ITR is as follows. Figure 1 As shown, the difference is that the positions of segment B' and segment C' are swapped, and the positions of segment B and segment C are swapped.

[0043] In this article, the term "ITR truncated portion" or "ITRt" is distinguished from an ITR that can form a T-shaped hairpin palindrome structure. It refers to a portion of the DNA segment (e.g., a portion of the ITR constituent elements) of the ITR that does not form a hairpin palindrome structure, which forms a linear open end and allows the rAAV genome to be packaged.

[0044] In this article, the term "hairpin structure," also known as "hair clip structure," refers to the "hairpin" shape formed when DNA molecules fold back, causing some bases within the folded region to come close together and pair complementaryly. Examples include T-shaped hairpin structures, such as... Figure 1 As shown.

[0045] Unlike traditional pre-packaged rAAV genomes, the pre-packaged spAAV genome presented herein does not contain ITRs capable of forming hairpin structures (e.g., T-shaped hairpin structures) at both ends of its linear single-stranded DNA. Instead, it has ITRts at the 5' end that form linear open ends and do not form hairpin structures. The inventors surprisingly discovered that the spAAV vectors packaged from the pre-packaged spAAV genome described herein have only one polarity: either a positive-strand DNA spAAV vector or a negative-strand DNA spAAV vector, and the two are not generated simultaneously. Furthermore, the titer and cellular infectivity of the packaged spAAV viral particles are comparable to those of traditional rAAV viral particles. Using the spAAV viral particles packaged according to the present invention, it is advantageous to deliver single-polarity, single-stranded DNA with linear open ends of the same polarity. Because it is a single-stranded DNA with only one polarity and no 3'ITR structure that can be used as a DNA replication primer, spAAV DNA can only exist in the form of single-stranded DNA in cells. Therefore, it can be used for gene integration, gene editing, promoting efficient DNA pairing to express large genes, and delivering long oligodeoxynucleotides for small nucleic acid gene therapy.

[0046] In some embodiments, the spAAV genome is a single-stranded DNA.

[0047] In some embodiments, the pre-packaging spAAV genome does not have an ITR or a portion thereof at its 3' end. In some embodiments, the pre-packaging spAAV genome has the ITRt at its 5' end. In some embodiments, the pre-packaging spAAV genome does not have an ITR or a portion thereof at its 3' end, and has the ITRt at its 5' end.

[0048] Because the spAAV vector does not have an ITR palindrome at the 3' end, it cannot synthesize a second strand and form a double-stranded DNA molecule by using the 3' end as a primer after entering the host cell.

[0049] In some implementations, the ITRt includes trs and RBE. In some implementations, the ITRt includes D, A', and C' segments derived from the Flip ITR, for example, with the corresponding structure as follows: Figure 1 As shown in the diagram. In some implementations, the ITRt includes D, A', and B' segments derived from the Flop ITR.

[0050] In some exemplary embodiments, the pre-packaging spAAV genome comprises, in a 5' to 3' sequence, an ITRt, a foreign gene expression cassette, and / or optional other foreign DNA sequences, wherein the ITRt comprises RBE and trs. In some exemplary embodiments, the pre-packaging spAAV genome comprises, in a 5' to 3' sequence, an ITRt, a foreign gene expression cassette, and / or optional other foreign DNA sequences, wherein the ITRt comprises D, A', and C' regions derived from Flip ITR. In some exemplary embodiments, the pre-packaging spAAV genome comprises, in a 5' to 3' sequence, an ITRt, a foreign gene expression cassette, and / or optional other foreign DNA sequences, wherein the ITRt comprises D, A', and B' regions derived from Flop ITR.

[0051] In some exemplary embodiments, the ITR described herein has the following nucleotide sequence (Flip ITR):

[0052] Flip ITR (SEQ ID NO:1):

[0053] aggaacccctagtgatggagttggccactccctctctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccg ggcgtcgggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagagagggagtggccaa

[0054] In some exemplary embodiments, the ITR described herein has the following nucleotide sequence (Flop ITR):

[0055] Flop ITR (SEQ ID NO:2):

[0056] aggaacccctagtgatggagttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgc ccgacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcagagagggagtggccaa

[0057] In some exemplary embodiments, the nucleotide sequence of the ITR described herein has greater than 80%, greater than 85%, greater than 90%, greater than 95%, greater than 98%, greater than 99%, or 100% sequence identity with the nucleotide sequence shown in SEQ ID NO:1 or SEQ ID NO:2. In some exemplary embodiments, the nucleotide sequence of the ITR described herein is the nucleotide sequence shown in SEQ ID NO:1 or SEQ ID NO:2.

[0058] In some exemplary embodiments, the nucleotide sequence of the RBE described herein has the nucleotide sequence shown in SEQ ID NO:3:

[0059] RBE (SEQ ID NO:3):

[0060] gcgc gctc gctc gctc

[0061] In some exemplary embodiments, the nucleotide sequence of the RBE described herein has greater than 80%, greater than 85%, greater than 90%, greater than 95%, greater than 98%, greater than 99%, or 100% sequence identity with the nucleotide sequence shown in SEQ ID NO:3. In some exemplary embodiments, the nucleotide sequence of the RBE described herein is the nucleotide sequence shown in SEQ ID NO:3.

[0062] In some exemplary embodiments, the nucleotide sequence of the trs described herein has the nucleotide sequence shown in SEQ ID NO:4:

[0063] trs(SEQ ID NO:4):

[0064] agttgg

[0065] In some exemplary embodiments, the nucleotide sequence of the trs described herein has greater than 80%, greater than 85%, greater than 90%, greater than 95%, greater than 98%, greater than 99%, or 100% sequence identity with the nucleotide sequence shown in SEQ ID NO:4. In some exemplary embodiments, the nucleotide sequence of the trs described herein is the nucleotide sequence shown in SEQ ID NO:4.

[0066] In some exemplary embodiments, the ITRt described herein has the nucleotide sequence shown in SEQ ID NO:5:

[0067] ITRt(SEQ ID NO:5):

[0068] aggaacccctagtgatggagttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaa

[0069] In some exemplary embodiments, the nucleotide sequence of the ITRt described herein has greater than 80%, greater than 85%, greater than 90%, greater than 95%, greater than 98%, greater than 99%, or 100% sequence identity with the nucleotide sequence shown in SEQ ID NO:. In some exemplary embodiments, the nucleotide sequence of the ITRt described herein is the nucleotide sequence shown in SEQ ID NO:5.

[0070] Those skilled in the art will understand that the ITR, RBE, and trs sequences described above are for illustrative purposes only and not for limiting purposes, based on the AAV2 description. Those skilled in the art will be able to determine the ITR sequences, RBE, and trs sequences for each type (e.g., each serotype) of rAAV and practice the invention with appropriate modifications but without departing from the teachings herein.

[0071] In some embodiments, the pre-packaging spAAV genome does not have nucleotide sequences encoding the rep gene and / or cap gene.

[0072] In some embodiments, the pre-packaging spAAV genome includes a foreign nucleic acid, such as a foreign gene expression cassette, between one end having an ITRt and the other end. The foreign nucleic acid may have a nucleotide sequence encoding a foreign gene. In some embodiments, the pre-packaging spAAV genome includes an optional DNA sequence between one end having an ITRt and the other end. The optional DNA sequence may be a nucleotide sequence that does not encode a foreign gene, such as a filler sequence.

[0073] In this document, the terms “exogenous gene,” “exogenous nucleic acid,” or “target gene” refer to genes or DNA derived from sources other than the organism of interest or study (e.g., an individual organism). The exogenous gene, exogenous nucleic acid, or target gene can be any exogenous gene or exogenous DNA that is intended to be expressed or to produce a biological function in the recipient cells to which the spAAV viral particles are to be delivered.

[0074] In some embodiments, the spAAV genome comprises a positive-stranded single-stranded DNA sequence of a foreign nucleic acid (e.g., a foreign gene expression cassette). In some embodiments, the spAAV genome comprises a negative-stranded single-stranded DNA sequence of a foreign nucleic acid (e.g., a foreign gene expression cassette).

[0075] In some embodiments, the nucleotide sequence encoding the foreign gene includes a forward-oriented foreign gene expression frame. In some exemplary embodiments, the forward-oriented foreign gene expression frame may include a promoter, a foreign gene open reading frame, and a polyA sequence in the 5'-3' direction. In some exemplary embodiments, the forward-oriented foreign gene expression frame may also include an enhancer and an intron. In some exemplary embodiments, the enhancer and intron are located between the promoter and the foreign gene open reading frame. In some exemplary embodiments, the forward-oriented foreign gene expression frame may include a DNA sequence for gene editing or gene regulation in the 5'-3' direction.

[0076] In some embodiments, the nucleotide sequence encoding the foreign gene includes an inverted foreign gene expression frame. In some exemplary embodiments, the inverted foreign gene expression frame may include, in the 5'-3' direction, an inverted complementary sequence of a poly-A sequence, an inverted complementary sequence of a foreign gene open reading frame, and an inverted complementary sequence of a promoter. In some exemplary embodiments, the inverted foreign gene expression frame may also include enhancers and introns. In some exemplary embodiments, the enhancers and introns are located between the inverted complementary sequence of the promoter and the inverted complementary sequence of the foreign gene open reading frame. In some exemplary embodiments, the inverted foreign gene expression frame may include, in the 5'-3' direction, an inverted complementary sequence of a DNA sequence used for gene editing or gene regulation.

[0077] In some implementations, the promoter may include, for example, the CMV promoter, the CAG promoter, or cell-specific promoters such as the GFAP promoter, the hAAT promoter, etc.

[0078] In some embodiments, the pre-packaging spAAV genome can be generated by constructing a plasmid (such as an spAAV transgenic plasmid). The spAAV transgenic plasmid described herein can be any plasmid suitable for generating the pre-packaging spAAV genome described herein. Suitable spAAV transgenic plasmids can be based on, for example, but not limited to, pFastBacdual, pFastBac1 plasmids, etc.

[0079] The pre-packaging spAAV genome can then be packaged into the capsid protein using an spAAV vector packaging system to form an spAAV vector. In some embodiments, the spAAV vector packaging system may include, for example, an insect cell baculovirus packaging system, a mammalian cell packaging system, etc.

[0080] On the other hand, this paper provides an spAAV carrier that includes:

[0081] Capsid proteins, and

[0082] spAAV genome packaged with capsid proteins;

[0083] The spAAV genome packaged by the capsid protein is derived from the pre-packaged spAAV genome described herein.

[0084] In this article, "spAAV vector" is also referred to as "spAAV viral particle," which is generated by packaging the pre-packaging spAAV genome into the AAV capsid protein (e.g., using an spAAV vector packaging system).

[0085] In some implementations, examples of the spAAV vector packaging system may include, for example, insect cell baculovirus packaging systems, mammalian cell packaging systems, etc.

[0086] In some embodiments, the spAAV genome packaged by the capsid protein is a single-pole, single-stranded DNA.

[0087] In some embodiments, the capsid protein-packaged spAAV genome (also referred to herein as "packaged spAAV genome") has linear open ends at both ends, one end of which does not have an ITR or a portion thereof, and the other end has an ITRt-derived sequence.

[0088] In this paper, the term "ITRt-derived sequence" is obtained by cutting at the trs site contained in the ITRt, which forms a linear open end and does not form a hairpin structure.

[0089] In some embodiments, the packaged spAAV genome has an ITRt-derived sequence at its 5' end. In some embodiments, the packaged spAAV genome does not have an ITR or a portion thereof at its 3' end. In some embodiments, the packaged spAAV genome has an ITRt-derived sequence at its 5' end and does not have an ITR or a portion thereof at its 3' end.

[0090] In some embodiments, the ITRt source sequence includes an RBE. In some embodiments, the ITRt source sequence includes an RBE and a portion of the trs sequence (the remaining trs portion after Rep cleavage).

[0091] In some embodiments, the packaged spAAV genome does not have nucleotide sequences encoding the rep gene and / or cap gene.

[0092] In some embodiments, the packaged spAAV genome includes a foreign nucleic acid, such as a foreign gene expression cassette, between one end having an ITRt-derived sequence and the other end. The foreign nucleic acid may have a nucleotide sequence encoding a foreign gene. In some embodiments, the nucleotide sequence encoding the foreign gene is a single-pole, single-stranded DNA sequence. In some embodiments, the packaged spAAV genome includes an optional DNA sequence between one end having an ITRt-derived sequence and the other end. The optional DNA sequence may be a nucleotide sequence that does not encode a foreign gene, such as a filler sequence.

[0093] In some embodiments, the packaged spAAV genome comprises a positive-stranded single-stranded DNA sequence of a foreign nucleic acid (e.g., a foreign gene expression cassette). In some embodiments, the packaged spAAV genome comprises a negative-stranded single-stranded DNA sequence of a foreign nucleic acid (e.g., a foreign gene expression cassette).

[0094] In some embodiments, the nucleotide sequence encoding the foreign gene includes a forward-oriented foreign gene expression frame. In some exemplary embodiments, the forward-oriented foreign gene expression frame may include a promoter, a foreign gene open reading frame, and a polyA sequence in the 5'-3' direction. In some exemplary embodiments, the forward-oriented foreign gene expression frame may also include an enhancer and an intron. In some exemplary embodiments, the enhancer and intron are located between the promoter and the foreign gene open reading frame. In some exemplary embodiments, the forward-oriented foreign gene expression frame may include a DNA sequence for gene editing or gene regulation in the 5'-3' direction.

[0095] In some embodiments, the nucleotide sequence encoding the foreign gene includes an inverted foreign gene expression frame. In some exemplary embodiments, the inverted foreign gene expression frame may include, in the 5'-3' direction, an inverted complementary sequence of a poly-A sequence, an inverted complementary sequence of a foreign gene open reading frame, and an inverted complementary sequence of a promoter. In some exemplary embodiments, the inverted foreign gene expression frame may also include enhancers and introns. In some exemplary embodiments, the enhancers and introns are located between the inverted complementary sequence of the promoter and the inverted complementary sequence of the foreign gene open reading frame. In some exemplary embodiments, the inverted foreign gene expression frame may include, in the 5'-3' direction, an inverted complementary sequence of a DNA sequence used for gene editing or gene regulation.

[0096] In some implementations, the promoter may include, for example, the CMV promoter, the CAG promoter, or cell-specific promoters such as the GFAP promoter, the hAAT promoter, etc.

[0097] In some embodiments, the capsid protein is an AAV capsid protein. In some embodiments, the capsid protein may be a capsid protein selected from various AAVs such as AAV1-AAV12 (AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12).

[0098] In some embodiments, the capsid protein is an AAV capsid protein variant, such as a tyrosine mono- or poly-amino acid variant, a tyrosine, serine, or threonine variant, or a multi-serumotype chimera such as AAV-DJ, or a polypeptide incorporation variant, etc.

[0099] In some embodiments, the capsid protein can be produced by a plasmid expressing the AAV capsid protein Cap using an spAAV vector packaging system.

[0100] In some embodiments, the spAAV vector may be packaged using an spAAV vector packaging system from an spAAV transgenic plasmid (producing the pre-packaging spAAV genome) and a plasmid expressing the AAV capsid protein Cap and the replication protein Rep (producing Cap and Rep proteins). In some embodiments, the AAV Cap encoding gene and the AAV Rep encoding gene may reside on the same plasmid or on two different plasmids. In some embodiments, the AAV Cap and / or AAV Rep expression plasmid may include the Cap and / or Rep gene expression cassettes and desired expression elements, as well as intron sequences for enhancing expression. There are no particular restrictions on the plasmids used to express AAVCap and / or Rep. Those skilled in the art can routinely use AAVCap and / or Rep expression plasmids, see, for example, Urabe M, Ding C, Kotin RM. Insect cells as a factory to produce adeno-associated virus type 2 vectors. Hum Gene Ther. 2002 Nov 1; 13(16):1935-43. doi:10.1089 / 10430340260355347.PMID:12427305.

[0101] On the other hand, this article also provides a spAAV transgenic plasmid for generating the pre-packaging spAAV genome described herein.

[0102] The spAAV transgenic plasmids described herein can be any plasmid suitable for generating the pre-packaged spAAV genome described herein. Suitable spAAV transgenic plasmids can be based on, for example, but not limited to, pFastBacdual plasmids, pFastBac1 plasmids, etc.

[0103] In some exemplary embodiments, the spAAV transgenic plasmid may be designed as a positive-stranded single-stranded DNA sequence encoding a foreign gene, which may include, in 5' to 3' order: ITRt (containing RBE and trs), promoter (e.g., CMV), foreign gene open reading frame, and polyA. In some exemplary embodiments, the spAAV transgenic plasmid may also include a filler sequence. In some specific embodiments, the filler sequence may be present, for example, upstream of the promoter and / or downstream of polyA.

[0104] In some exemplary embodiments, the spAAV transgenic plasmid may be designed as a negative-stranded single-stranded DNA sequence encoding a foreign gene, which may include, in a 5' to 3' order: ITRt (containing RBE and trs), polyA', foreign gene open reading frame', promoter' (e.g., CMV'). In some exemplary embodiments, the spAAV transgenic plasmid may also include a filler sequence. In some specific embodiments, the filler sequence may be present, for example, downstream of the promoter' and / or upstream of the polyA'.

[0105] In this document, the term "filler sequence" refers to auxiliary DNA added to fill in cases where the target DNA length is less than the AAV packaging length of 4.7 kb, in order to bring the DNA length to the AAV packaging length. In some embodiments, the filler sequence may have a different length, as long as the final DNA reaches, for example, a length of about 4.7 kb.

[0106] The spAAV transgenic plasmid can be packaged together with the Rep and Cap gene expression plasmids via the spAAV vector packaging system to produce the spAAV vector described herein.

[0107] On the other hand, this paper also provides a method for packaging spAAV vectors, which includes: transforming the spAAV transgenic plasmid described herein and Cap and Rep expression plasmids into competent Escherichia coli cells, respectively; selecting white colonies after at least one round of blue-white screening, amplifying and extracting recombinant baculoviruses; transfecting insect cells with the recombinant baculoviruses to produce recombinant baculoviruses; and extracting the recombinant baculoviruses and infecting insect cells with the recombinant baculoviruses to obtain spAAV vectors.

[0108] In some embodiments, the *E. coli* competent cells are *E. coli* DH10Bac competent cells. In some embodiments, the spAAV vector packaging system is an insect cell baculovirus packaging system.

[0109] In some embodiments, white colonies are selected after at least one round of blue-white screening, amplified, and recombinant bacteria are extracted. In some embodiments, white colonies are selected after two or more rounds of blue-white screening, amplified, and recombinant bacteria are extracted.

[0110] In some implementations, recombinant baculoviruses are transfected into insect cells (e.g., insect Sf9 cells) to produce recombinant baculoviruses (e.g., P3 generation recombinant baculoviruses).

[0111] In some implementations, insect cells (e.g., Sf9 insect cells) are infected (e.g., co-infected) with recombinant baculoviruses (e.g., two or three recombinant baculoviruses from generation P3) and packaged to obtain the spAAV vector.

[0112] Figure 2 The document provides a schematic diagram of the construction and packaging of an spAAV vector according to an exemplary embodiment of this invention. In this embodiment, during spAAV vector packaging, the Rep protein recognizes the Rep binding site (RBE) on the recombinant baculovirus DNA, binds to this site, recognizes the terminal unwinding site (trs), breaks the phosphodiester bond between the tt bases, and covalently binds to the 5' end, introducing the DNA into the AAV capsid. The length of the DNA packaged into the capsid is approximately 4.7 kb.

[0113] For another method of packaging rAAV vectors using an insect cell baculovirus packaging system, see, for example, Urabe M, Ding C, Kotin RM. Insect cells as a factory to produce adeno-associated virus type 2 vectors. Hum Gene Ther. 2002 Nov 1; 13(16):1935-43. doi:10.1089 / 10430340260355347.PMID:1242730.

[0114] On the other hand, this document also provides a method for delivering exogenous nucleic acids to cells, comprising contacting the cells with one or more spAAV vectors described herein, wherein the genome of one or more of the spAAV vectors contains a gene expression cassette of the exogenous nucleic acid and / or optionally other DNA sequences.

[0115] In some embodiments, the cell may be a eukaryotic cell. In some embodiments, the cell may be an animal cell. In some embodiments, the cell may be a vertebrate cell. In some embodiments, the cell may be a mammalian cell, such as a human cell.

[0116] In some embodiments, the exogenous nucleic acid comprises a nucleic acid sequence of a exogenous gene. In some embodiments, the exogenous nucleic acid comprises a nucleic acid sequence of a non-exogenous gene.

[0117] In some embodiments, the genome of the spAAV vector contains a positive-stranded single-stranded DNA sequence or a negative-stranded single-stranded DNA sequence of the exogenous gene.

[0118] In some embodiments, one or more of the spAAV vectors include: spAAV vectors containing only the positive-stranded single-stranded DNA sequence of the exogenous nucleic acid and / or spAAV vectors containing only the negative-stranded single-stranded DNA sequence of the exogenous nucleic acid.

[0119] In some embodiments, one or more of the spAAV vectors comprise two or more spAAV vectors, which include at least a first spAAV vector having a positive-stranded single-stranded DNA sequence of the foreign gene and a second spAAV vector having a negative-stranded single-stranded DNA sequence of the foreign gene.

[0120] In some embodiments, cells are contacted with an spAAV vector containing a positive-stranded single-stranded DNA sequence of the foreign gene. In some embodiments, cells are contacted with an spAAV vector containing a negative-stranded single-stranded DNA sequence of the foreign gene. In a preferred embodiment, cells are contacted with a first spAAV vector containing a positive-stranded single-stranded DNA sequence of the foreign gene and a second spAAV vector containing a negative-stranded single-stranded DNA sequence of the foreign gene. In some embodiments, cells are contacted simultaneously with a first spAAV vector containing a positive-stranded single-stranded DNA sequence of the foreign gene and a second spAAV vector containing a negative-stranded single-stranded DNA sequence of the foreign gene. In some embodiments, cells are contacted sequentially (e.g., sequentially over a 24-hour period) with a first spAAV vector containing a positive-stranded single-stranded DNA sequence of the foreign gene and a second spAAV vector containing a negative-stranded single-stranded DNA sequence of the foreign gene, and vice versa. It should be understood that, herein, "first spAAV vector" and "second spAAV vector" are used only to distinguish between the two and are not intended to limit their order of use.

[0121] When cells are infected with spAAV vectors containing either the positive-stranded single-stranded DNA sequence of the exogenous gene or the negative-stranded single-stranded DNA sequence of the exogenous gene, the exogenous gene carried by the vector has a high probability (e.g., 20%) of being integrated into the cell genome, resulting in long-term and stable expression of the exogenous gene.

[0122] By using a spAAV vector containing a positive-stranded single-stranded DNA sequence of the exogenous gene and a spAAV vector containing a negative-stranded single-stranded DNA sequence of the exogenous gene in combination, it is beneficial to enable the positive and negative strands of the spAAV genome to rapidly complement each other in the nucleus of the host cell to form a double-stranded molecule, thereby initiating gene expression.

[0123] Figure 3This diagram illustrates the complementary pairing of positive and negative strand DNA in a spAAV vector according to an exemplary embodiment of this document for gene expression. In this case, the spAAV DNA is a monopolar, single-stranded DNA. Upon cell infection, it releases the monopolar, single-stranded DNA it carries. Because this DNA lacks an ITR structure and therefore lacks a 3' primer for DNA synthesis, it cannot synthesize a second complementary DNA strand, and thus cannot express the gene. When co-infected with another complementary monopolar spAAV virus, the two complementary monopolar, single-stranded DNAs can pair to form a double-stranded DNA, enabling gene expression.

[0124] Figure 4 A schematic diagram illustrating the integration of an spAAV vector into cellular genomic DNA according to an exemplary embodiment of this document is shown. In this case, the spAAV DNA is a single-stranded, monopolar DNA that, upon infecting a cell, releases the carried single-stranded DNA. This single-stranded DNA may undergo homologous or non-homologous recombination with the cellular genomic DNA, thereby integrating into the cellular genome and then synthesizing a second complementary DNA strand, potentially expressing a gene.

[0125] On the other hand, this article also provides an isolated host cell containing the spAAV vector described herein.

[0126] In some embodiments, the host cell may be a eukaryotic cell. In some embodiments, the host cell may be an animal cell. In some embodiments, the host cell may be a vertebrate cell. In some embodiments, the host cell may be a mammalian cell. In some embodiments, the host cell may be a human cell.

[0127] In some embodiments, the host cell is obtained by contacting a eukaryotic cell (e.g., an animal cell, such as a mammalian cell, such as a human cell) with the spAAV vector described herein.

[0128] On the other hand, the spAAV vector described herein is also provided for gene expression. The use of the spAAV described herein in the preparation of products for gene expression is also provided. In some embodiments, the gene expression is performed on animals, specifically vertebrates, more specifically mammals, and even more specifically humans.

[0129] On the other hand, the spAAV vector described herein is also provided for use in gene therapy. The use of the spAAV described herein in the preparation of products for gene therapy is also provided. In some embodiments, the gene therapy is directed at animals, specifically vertebrates, more specifically mammals, and even more specifically humans.

[0130] On the other hand, the spAAV vector described herein is also provided for gene editing. The use of the spAAV described herein in the preparation of products for gene editing is also provided. In some embodiments, the gene editing is performed on animals, specifically vertebrates, more specifically mammals, and even more specifically humans.

[0131] On the other hand, the spAAV vector described herein is also provided for gene regulation. The use of the spAAV described herein in the preparation of products for gene regulation is also provided. In some embodiments, the gene regulation is directed at animals, specifically vertebrates, more specifically mammals, and even more specifically humans.

[0132] Example

[0133] Construction of plasmid vectors for spAAV vector packaging

[0134] In this article, rAAV transgenic plasmids that contain ITR-related sequences only at one end of the expression cassette of the exogenous gene are also called "unipolar" plasmids.

[0135] The main plasmid involved in this invention is the spAAV DNA genomic plasmid.

[0136] Construction method:

[0137] 1. spAAV-EGFP(+) DNA genomic plasmid

[0138] The plasmid DNA contains a D sequence and an A'B sequence in the 5' to 3' direction. The DA'B sequence is: 5'-AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTC GCTCACTGAGGCCGGGCGCACCAAA-3' (SEQ ID NO: 5). A 1.3kb stuff1 filler sequence, a forward-oriented EGFP gene expression cassette (CMV-EGFP-polyA) sequence, and a 1.3kb stuff2 filler sequence make up the entire packaging frame (5.0kb). The EGFP gene expression cassette sequence sequence is: promoter CMV, enhancer, intron, EGFP open reading frame, and polyA sequence. The pFastBacdual-ITR-EGFP vector was used for construction.

[0139] The first step was to construct pFastBacdual-DtrsA'B'-CMV-EGFP-polyA-RHstuff. DtrsA'B' was constructed by ordering primers (primer 1: 5'-CAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCACCAAAA-3' (SEQ ID NO:6); primer 2: 5'-CGCGTTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGG GAGTGGCCAACTCCATCACTAGGGGTTCCTGGTAC-3' (SEQ ID NO:7)) (synthesized by Sangon Biotech (Shanghai) Co., Ltd.), renaturing, and adding 5 μl each of primer 1 and primer 2 oligonucleotides (concentration of 200 μM), 4 μl of 5× annealing buffer, and then supplementing with deionized water free of DNase and RNase to a final volume of 20 μl. Annealing was performed at 95°C for 4 minutes in a PCR instrument. The reaction tube was then removed and placed on the lab bench for 5-10 minutes to cool to room temperature, forming oligo-dsDNA with KpnI / MluI sticky ends. This was then inserted into the pFastBacdual-ITR-EGFP vector, which was double-digested with KpnI / MluI.

[0140] RHstuff renatured oligo-dsDNA with RsrII / HindIII sticky ends by ordering primers (primer 3: 5'-GACCGATAATCTCTAGATTGAGGAACAA-3' (SEQ ID NO: 8); primer 4: 5'-AGCTTTGTTCCTCAATCTAGAGATTATCG-3' (SEQ ID NO: 9)) (synthesized by Sangon Biotech (Shanghai) Co., Ltd.), and inserted it into the KpnI / MluI double-digested pFastBacdual-DtrsA'B'-CMV-EGFP-polyA vector.

[0141] The second step is to construct pFastBacdual-DtrsA'B'-1.3kb stuff1-CMV-EGFP-polyA-1.3kbstuff2. The 1.3kb stuff1 fragment is cloned by PCR fusion with a CMV fragment, and the primer sequences are as follows: Primer 5: 5'-TCACTGACGCGTCGGAAGGTCGGTATCCACGGA-3' (SEQ ID NO: 10); Primer 6: 5'-CTTCAACCGGCTGAAGCTGGCTAGTTATTAATAGTAATCA-3' (SEQ ID NO: 11); Primer 7: 5'-TGATTACTATTAATAACTAGCCAGCTTCAGCCGGTTGAAG-3' (SEQ ID NO: 12); Primer 8: 5'-CCCGGGGAATTCAATCGATGTTCGAATCCCAAT-3' (SEQ ID NO: 12). NO:13) (synthesized by Sangon Biotech (Shanghai) Co., Ltd.), the renaturated fragment was inserted into the pFastBacdual-DtrsA'B'-CMV-EGFP-polyA-RHstuff vector by double digestion with MluI / EcoRI.

[0142] The 1.3kb stuff2 fragment was cloned by PCR using primer sequences (primer 9: 5'-TTTGTAGGTAACCTCAAGAAGCACATCCTGAATC-3' (SEQ ID NO: 14); primer 10: 5'-GCACGTGGTTACCTTGCCCAGAATGTCTGTGCTG-3' (SEQ ID NO: 15)) (synthesized by Sangon Biotech (Shanghai) Co., Ltd.). The renatured fragment was then digested with BstEII and inserted into the pFastBacdual-DtrsA'B'-1.3kb stuff1-CMV-EGF-polyA-RHstuff vector. This yielded the pFastBacdual-DtrsA'B'-1.3kb stuff1-CMV-EGF-polyA-1.3kb stuff2 (spAAV-CMV-EGFP(+)) vector, which is the spAAV-CMV-EGFP(+) genome packaging plasmid. For the construction of the EGFP expression cassette, please refer to: Li Taiming et al., Preparation of AAV-ITR gene expression microcarriers from insect cells, Chinese Journal of Biotechnology, 2015, 31(8), 1232, 1.2.1, “Construction of pFastBacdual-ITR-EGFP plasmid”.

[0143] 2, spAAV-EGFP(-) DNA genomic plasmid

[0144] The plasmid DNA contains a D sequence and an A'B sequence in the 5' to 3' direction. The DA'B sequence is 5'-AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTC GCTCACTGAGGCCGGGCGCACCAAA-3' (SEQ ID NO:5). It also contains the inverted EGFP gene expression frame sequence, namely the polyA sequence, the inverted complementary sequence of the EGFP open reading frame, introns, enhancers, promoters, and downstream Rep recognition and cleavage sequences. The inverted EGFP expression cassette was cloned by PCR using pFastBacdual-DtrsA'B'-1.3kb stuff1-CMV-EGF-polyA-1.3kbstuff2 as a template. The primer sequences were: Primer 11: 5'-TCACTGACGCGTCACGTGGTTACCTTGCCCAGA-3' (SEQ ID NO: 16); Primer 12: 5'-CAAGATCGGTCCGCGGAAGGTCGGTATCCACGGA-3' (SEQ ID NO: 16). NO:17) (synthesized by Sangon Biotech (Shanghai) Co., Ltd.), the renatured fragment was inserted into the pFastBacdual-DtrsA'B'-CMV-EGFP-polyA-RHstuff vector by double digestion with MluI / RsrII, thus obtaining the pFastBacdual-DtrsA'B'-1.3kb stuff2'-polyA'-EGFP'-CMV'-1.3kb stuff1'(spAAV-EGFP(-)) genome packaging plasmid.

[0145] Preparation of recombinant Bacmid

[0146] The three recombinant plasmids from the previous step were used to prepare recombinant Bacmids, as follows:

[0147] 1. Slowly melt 100 μl of DH10Bac competent cells on ice.

[0148] 2. Add 500 ng of plasmid DNA and mix gently.

[0149] 3. Place on ice for 30 minutes, then subject to heat shock at 42°C for 90 seconds, and immediately transfer to ice for 2 minutes.

[0150] 4. Add 900 μl of LB medium and shake at 37℃ and 225 rpm for 2-3 hours.

[0151] 5. Add 40 μl of 2% (20 mg / ml) X-gal and 20 μl of 20% (200 mg / ml) IPTG to the center of a pre-prepared 90 mm agar plate containing 50 μg / ml Kan, 7 μg / ml Gen, and 10 μg / ml Tet. Distribute the solution evenly over the entire surface of the plate using a sterile spreader and incubate at room temperature until all liquid has evaporated.

[0152] 6. Dilute the cells 10-fold serially with LB medium (10... -1 10 -2 ), take 100 μl of each gradient and apply it to an LB plate.

[0153] 7. Incubate at 37°C for 48 hours, then pick two white clones and streak them onto a new LB agar plate (same as above for antibiotics). Incubate overnight at 37°C.

[0154] 8. Select two single plaques for PCR identification; the primers used for PCR identification of Bacmid are the target gene F / R and PUC M13 F / R, respectively.

[0155] 9. Take out the correctly identified Bacmid plaques, inoculate them into 10 ml LB (Kan+, Gen+, Tet+) and shake for 12 h. Use the OMEGA kit to extract and isolate the recombinant rod-like DNA. Follow the kit instructions for the experimental method. After measuring the rod-like DNA concentration, aliquot and freeze at -20℃.

[0156] Preparation of baculovirus

[0157] 1. Prepare transfection reagent

[0158] Prepare 1×HBS200ml

[0159] Hepes 0.954g

[0160] NaCl 1.754g

[0161] Sterilized ddH2O 150ml

[0162] Adjust the pH to 7.4 with 1M NaOH.

[0163] Bring the volume to 200ml, aseptically filter in a biosafety cabinet, and store at 4°C.

[0164] Prepare 20ml of PEI

[0165] PEI 0.043g

[0166] 1 ml of anhydrous ethanol

[0167] After complete dissolution, bring the volume to 20 ml with 1×HBS, freeze and thaw three times (freeze at -20℃, thaw at room temperature), and store at -20℃.

[0168] 2. Cell plating

[0169] Plating: Take a 6-well plate, aspirate and count the suspended culture cells to achieve a cell density of 2*102. 6 Cells / ml, 2ml per well, cell viability is over 95%.

[0170] 3. Transfection (amount per well)

[0171] Solution A: PEI: Add 6 μl of PEI and 94 μl of 1×HBS, mix well, and let stand for 4 minutes.

[0172] Solution B: Take 3 μg of rod-like DNA (pre-inactivate rod-like DNA at 65°C for 30 minutes), add 1×HBS to make a final volume of 100 μl, and mix gently.

[0173] Add 100 μl of solution A to solution B, mix well, and incubate at room temperature for 30 minutes. Add the mixture to wells containing seeded cells and incubate for 96 hours.

[0174] 4. Virus amplification

[0175] 1) Separate P1

[0176] After confirming that the cells were in the late infection stage (96h), 2ml of virus-containing culture medium was collected from each well into a sterile 15ml centrifuge tube and centrifuged at 500g for 5 minutes to remove cell debris.

[0177] Collect the supernatant into sterile EP tubes and store at 4°C protected from light. For long-term storage, aliquot and freeze at -80°C.

[0178] 2) Amplify the virus to obtain P2

[0179] Take 8 ml of cells in suspension culture with an MOI of 0.1, at a density of 2 × 10⁸ cells / ml. 6 Cells / ml, the required P1 volume is calculated to be 1.6 ml. Incubate at 27°C for 72 h, then collect the suspension cultured cells into sterile 15 ml centrifuge tubes and centrifuge at 500 g for 5 minutes. Aliquot the supernatant into sterile EP tubes. This viral supernatant is P2. Store at 4°C protected from light. For long-term storage, aliquot and freeze at -80°C.

[0180] 3) Amplify the virus to obtain P3

[0181] P3 can be obtained by amplification using the method described above, with an MOI of 0.1 and a density of 2 × 10⁻⁶. 6 Cells / ml, add 200μl of P2 stock solution to 10ml of suspension cultured cells, culture for 72h and collect P3.

[0182] The P1 virus titer usually obtained is 1×10⁻⁶. 6 -1×10 7 Between 1×10⁻⁶, the P2 titer is... 7 -1×10 8 between.

[0183] 4) Virus packaging

[0184] Take cells with an MOI of 1, 100 ml of suspension culture, and a density of 5 × 10⁻⁶ cells / ml. 6 Add 5 ml each of P3 generation Rep, Cap, and target gene, and culture for 72 hours to collect cells.

[0185] spAAV carrier packaging

[0186] The spAAV vector packaging system involved in this invention can be an insect cell baculovirus packaging system or a mammalian cell packaging system. The insect cell used is Sf9 cell. First, one or two recombinant plasmids expressing the AAV replication protein Rep and the AAV capsid protein Cap (Rep and Cap genes are on one or two different plasmids), and another plasmid containing spAAV DNA genome, are transformed into *E. coli* DH10Bac competent cells. Through two rounds of blue-white screening, colonies containing recombinant baculoviruses are white, and colonies that have not undergone recombination are blue. White colonies are selected for amplification, and the recombinant baculoviruses are extracted.

[0187] Then, using insect cell transfection reagents, the two or three types of recombinant baculoviruses mentioned above were transfected into Sf9 insect cells. After 4–5 days, the cell supernatant was collected to obtain P1 generation recombinant baculovirus. The P1 generation recombinant baculovirus was amplified by infecting Sf9 insect cells twice to obtain P3 generation recombinant baculovirus. The titer of P3 generation baculovirus was determined using the plaque assay: virus titer (pfu / ml) = 1 / dilution factor × number of plaques × 1 / inoculation volume per well.

[0188] Finally, two or three recombinant baculoviruses from generation P3 were co-infected with Sf9 insect cells, and the spAAV vector virus particles were packaged. For the procedure, please refer to: Urabe M, Ding C, Kotin RM. Insect cells as a factory to produce adeno-associated virus type 2 vectors. Hum Gene Ther. 2002 Nov 1; 13(16):1935-43. doi:10.1089 / 10430340260355347.PMID:12427305.

[0189] A schematic diagram of the packaging system using insect cell baculoviruses is shown below. Figure 2 As shown.

[0190] Iodixanol density gradient ultracentrifugation purification steps

[0191] 1. Obtain cell lysate

[0192] 1) After co-transfection for 72 hours, cells were collected by centrifugation at 1000g for 5 minutes;

[0193] 2) Discard the supernatant and resuspend the cells in 10 ml of Lysis Buffer;

[0194] Lysis Buffer(1L):Nacl 8.766g

[0195] Tris 6.055g

[0196] DH2O 950ml

[0197] Adjust the pH to 8.5 with 5M HCl, then bring the volume to 1L.

[0198] Aseptic filtration in a biosafety cabinet, stored at 4°C

[0199] 3) Freeze with liquid nitrogen, thaw at 37°C, repeat 3-4 times until clear;

[0200] 4) Centrifuge at 4℃, 5000g for 30 minutes to collect the supernatant; resuspend the precipitate in 4-5ml PBS, centrifuge again to collect the supernatant;

[0201] 5) Add DNase (10 μl / ml) and RNase (1 μl / ml), digest in a water bath at 37°C for 1 h, and wait for purification;

[0202] 2. Virus purification by iodixanol density gradient ultracentrifugation

[0203] 1) Dilute 60% iodixanol to 15%, 25%, 40%, and 58% using PBS-MK (1×PBS, 1mM MgCl2, 2.5mM KCl). Add solid NaCl to the 15% phase to a final concentration of 1M. 2) Add 0.5% phenol red solution to the 15% and 25% phases to a final concentration of 1.5 μl / ml. Add 0.5% phenol red solution to the 58% phase to a final concentration of 0.5 μl / ml.

[0204] 3) Using a 1.27*120mm flat-tipped spinal puncture needle, add 8ml of 15%, 6ml of 25%, 8ml of 40%, and 5ml of 58% iodixanol diluent sequentially from the bottom of a 39ml quick-sealing tube, avoiding the formation of air bubbles;

[0205] 4) Carefully cover the cell lysis buffer onto the iodixanol density gradient solution, filling the tube (level with the tube opening line). If necessary, supplement the volume with Lysis Buffer to fill the tube, balance the volume, and centrifuge at 69,000 rpm, 18°C ​​for 1.5 h (BECKMANCOULTER 70Ti centrifuge rotor).

[0206] 5) Pierce the quick-seal tube from the bottom, discard the first 4 ml (corresponding to 58% phase), and collect 6 ml of solution in the tube;

[0207] 6) Ultrafiltration using ultrafiltration tubes (Amicon Ultra-4 Centrifugai Filters, Ultracel-100k), centrifugation at 3000g for 5 minutes; repeated washing with PBS (1×PBS, Solarbio, with 5M NaCl added to a final concentration of 350mM) until the residual concentration of iodixanol is <0.1%, and finally the volume of each 100ml package is compressed to about 200μl;

[0208] 7) Add glycerol to a final concentration of 5%, filter aseptically, and aliquot and store at -80℃;

[0209] Method for detecting spAAV vector titer by real-time PCR

[0210] RT-PCR method

[0211] 1. Dilute plasmid ITR-EGFP 10-fold, then perform serial dilutions, creating a standard curve after 5 dilutions.

[0212] 2. Dilute the virus 10-fold, then perform serial dilutions, diluting at four different levels.

[0213] 3. Buffer preparation (protect from light):

[0214] 2xSuperpreMix Plus(SYBR Green)10μl

[0215] Upstream primer, 5'-TCCGCGTTACATAACTTACGG-3' (SEQ ID NO:18; synthesized by Sangon Biotech (Shanghai) Co., Ltd.) 0.3 μl

[0216] Downstream primer, 5'-GGGCGTACTTGGCATATGAT-3' (SEQ ID NO:19; synthesized by Sangon Biotech (Shanghai) Co., Ltd.) 0.3 μl

[0217] DD H2O 4.4μl

[0218] 4. Sample loading: 20 μl system: 5 μl template + 15 μl buffer, two replicates per gradient.

[0219] 5. RT-PCR (Roche LightCycler) program:

[0220] Stage 1 Pre-degradation Reps 1 95℃ 600s

[0221] Stage 2 Cyclic Reaction Reps 40 95℃ 10s

[0222] 55℃ 30s

[0223] 72℃ 30s

[0224] Stage 3 melting curve (Reps 1) 95℃ 15s

[0225] 60℃ 60s

[0226] 95℃ for 15 seconds

[0227] SDS-PAGE electrophoresis analysis of spAAV vector capsid proteins

[0228] 1. Glue making:

[0229] 1) Separating Gel (10%): In the beaker for preparing the separating gel, add the following ingredients (9.093 ml): 3.69 ml double-distilled water, 2.97 ml 30% acrylamide gelling solution (acrylamide:methylenebisacrylamide = 29:1), 2.25 ml 2M Tris, pH 8.8, 90 μl 10% ammonium persulfate, 90 μl 10% SDS, and 3 μl TEMED. Mix well and use a dropper to drop the separating gel between two glass plates until the liquid level reaches 1 cm below the bottom edge of the comb. Slowly add 75% ethanol using a dropper, let stand, and after the separating gel polymerizes, pour off the 75% ethanol layer.

[0230] 2) Stacking gel (5%): In the beaker for preparing the stacking gel, add the following ingredients (2.357 ml): 1.83 ml double-distilled water, 0.39 ml 30% acrylamide gelling solution (acrylamide:methylenebisacrylamide = 29:1), 0.75 ml 0.5 M Tris, pH 6.8, 30 μl 10% ammonium persulfate, 30 μl 10% SDS, and 2 μl TEMED. Mix well and immediately use a dropper to add the stacking gel to the separating gel between the two glass plates until full. Gently insert a comb. Let it stand until it solidifies to form a gel plate.

[0231] 2. Sample preparation:

[0232] Virus sample: Mix 5X loading buffer at a ratio of 2:1, boil in water for 10 minutes, centrifuge briefly after boiling, and take all samples for electrophoresis.

[0233] 3. Electrophoresis

[0234] 1) Vertically mount the gel plate made of two glass plates onto the power supply frame in the electrophoresis tank, so that the concave edge of the gel plate is close to the power supply frame.

[0235] 2) Fix the gel plate and power supply frame in the power supply tank as required, add electrophoresis buffer as required, and gently remove the comb from the gel plate.

[0236] 3) Take the processed sample solution and slowly add 15 μl of sample solution into the notch (sample entry point) in the gel plate using a microsyringe.

[0237] 4) During electrophoresis, control the voltage: 90V for the stacking gel and 120V for the separating gel. Stop electrophoresis when the bromophenol blue stripe in the gel reaches about 1cm from the bottom.

[0238] 4. Staining. Gently pry open the two glass plates outside the gel plate with a blade or thin plate. Cut off the separating gel along the junction of the separating gel and the stacking gel with a blade. Then carefully transfer the separating gel into a staining dish, add 100 ml of staining solution, cover, and stain for 1-3 hours.

[0239] 5. Destaining. Discard the staining solution. Rinse the stained gel several times with water, then place it in clean water (just enough to cover the gel). Microwave on high for 2 minutes, then remove and shake gently. Repeat this process until protein bands are clearly visible.

[0240] Figure 5 The results of SDS-PAGE electrophoresis of the spAAV vector capsid protein are shown. The spAAV capsid protein is no different in composition from the ordinary rAAV capsid protein, both consisting of three proteins: VP1, Vp2, and Vp3, with a ratio of approximately 1:1:10.

[0241] spAAV vector genome identification

[0242] DNA neutral agarose gel electrophoresis analysis

[0243] 1. Prepare an agarose solution by adding an accurate amount of agarose powder and a quantitative amount of 1X TAE electrophoresis buffer to an Erlenmeyer flask or glass bottle.

[0244] 2. Gently seal the neck of the flask with Kimwipes paper. If using a glass bottle, loosen the stopper. Heat the suspension in a boiling water bath or microwave until the agarose dissolves.

[0245] 3. Cool the clear solution to 40-50℃, add 4S red staining solution and quickly pour the gel. Once the gel has completely solidified, place it in an electrophoresis tank and add freshly prepared 1X TAE electrophoresis buffer until it just covers the gel.

[0246] 4. Prepare 10 μl of virus, add 1.1 μl of 10X PCR Buffer, put it into the PCR instrument, and incubate at 95℃ for 5 minutes, 72℃ for 5 minutes, 55℃ for 5 minutes, 37℃ for 5 minutes, 80℃ for 5 minutes, 72℃ for 5 minutes, 55℃ for 5 minutes, and 37℃ for 15 minutes.

[0247] 5. Add 0.2 times the volume of 6X gel loading buffer to the renatured sample.

[0248] 6. Add all the sample dissolved in 6X loading buffer into the sample wells. Start electrophoresis at 100V for 50 minutes.

[0249] 7. Imaging: Place the gel in a gel imaging system and take pictures to record the image.

[0250] Figure 6 The results of neutral agarose gel electrophoresis of the spAAV gene vector are shown. spAAV DNA is a single-stranded DNA, and in neutral agarose gel electrophoresis analysis, its DNA will appear as DNA bands that are much smaller than its molecular weight and are often diffuse.

[0251] DNA alkaline agarose gel electrophoresis analysis

[0252] 1. Preparation of alkaline agarose gel: Prepare an agarose solution by adding 0.36g of agarose powder and 27ml of distilled water to a conical flask or glass bottle. Gently seal the neck of the conical flask with Kimwipes paper. If using a glass bottle, loosen the stopper. Heat the suspension in a microwave oven over medium heat until the agarose dissolves. Equilibrate the clear solution in a water bath at 56°C for 5 minutes. Add 3ml of 10X alkaline gel electrophoresis buffer (equilibrate in a 56°C water bath for 2 minutes) and mix well. Quickly pour the mixture into a gel. Once the gel has completely solidified, place it in an electrophoresis tank and add freshly prepared 1X electrophoresis buffer (4°C) until it just covers the gel.

[0253] 2. Sample preparation: Take 30 μl of virus sample, add 3 μl of proteinase K (20 mg / ml), digest at 65℃ for 15 minutes, centrifuge at 12000g for 5 minutes, take 30 μl of supernatant, and add 6 μl of 6X alkaline gel loading buffer.

[0254] 3. Electrophoresis: Add all DNA samples to the wells and begin electrophoresis at a voltage of <3.5V / cm. (Horizontal electrophoresis tank JY-SPAT 27V electrophoresis for 3 hours.)

[0255] 4. Elution: Place the gel in 400ml of water for injection and elute on a horizontal shaker at 56rpm for 1 hour, changing the water every 30 minutes.

[0256] 5. Staining: Use 1X TAE staining solution containing 0.5 μg / ml EB (ethidium bromide) to stain the washed gel.

[0257] 6. Imaging: Place the gel in a gel imaging system and take pictures to record the image.

[0258] Figure 7 The results of alkaline agarose gel electrophoresis of the spAAV vector are shown. The spAAV DNA is a single-stranded DNA, appearing as a single DNA band on alkaline agarose gel electrophoresis. The molecular weight of the single-stranded DNA is 4.7 kb. Traditional rAAV EGFP packaging often contains DNA molecules of different molecular weights. This rAAV EGFP package contains two DNA molecules with different molecular weights: a single-stranded DNA with a molecular weight of 4.7 kb and a single-stranded DNA with a molecular weight of 2.7 kb.

[0259] spAAV genome annealing identification of unipolar genomes containing the positive and negative strands of the target gene DNA

[0260] 8 μl each of spAAV-EGFP(+) DNA and spAAV-EGFP(-) DNA were added to 4 μl of 5× annealing buffer and incubated at 95°C for 15 minutes. After incubation, the workbench was allowed to cool to room temperature, and then the mixture was placed in a 37°C water bath for 30 minutes. The DNA was then subjected to neutral agarose gel electrophoresis and analyzed by Goldview staining.

[0261] Figure 8 The results of neutral agarose gel electrophoresis show the complementary pairing of the positive and negative strands of spAAV DNA. spAAV DNA is a single-stranded, monopolar DNA. During neutral agarose gel electrophoresis, it appears as DNA bands much smaller than its molecular weight, often in a diffuse pattern. If the positive and negative strands of the positive and negative strands of the spAAV vector are annealed together, they will pair complementaryly to form double-stranded DNA, with a molecular weight of 4.7 kb.

[0262] S1 enzyme digestion was used to identify the spAAV vector single-stranded DNA genome.

[0263] Mix S1 enzyme and buffer (5X Reaction Buffer: S1Nuclease = 10:1), add the extracted spAAV vector DNA genome, incubate at 37°C for 30 minutes, and then detect the DNA by neutral agarose gel electrophoresis.

[0264] Figure 9 The results of neutral agarose gel electrophoresis show the digestion of spAAV DNA by S1 nuclease. S1 nuclease is a specific single-stranded nucleotide endonuclease that degrades single-stranded DNA. spAAV DNA is monopolar, single-stranded DNA, and S1 nuclease will degrade it. However, if the positive and negative strands of spAAV DNA anneal together, they will pair complementaryly to form double-stranded DNA, which will not be degraded by S1 nuclease.

[0265] spAAV vector infection of HEK293 cells for gene expression

[0266] HEK293 cells were seeded in 24-well plates at a density of 1.5 x 10⁻⁶ cells / well. 5 The following day, HEK293 cells were infected with rAAV6-EGFP, spAAV-EGFP(+), and spAAV-EGFP(-), respectively. HEK293 cells were also co-infected with spAAV-EGFP(+) and spAAV-EGFP(-), MOI 1x10⁻⁶. 6 Cell fluorescence was observed using a fluorescence microscope and photographed.

[0267] Figure 10 The results of gene expression detection in HEK293 cells infected with the spAAV vector are shown. Because the spAAV genomic DNA is single-stranded and lacks an ITR structure, it cannot synthesize a second complementary DNA strand, nor can it synthesize a second complementary DNA strand within the cell. Unlike the bipolar rAAV vector, it cannot express genes through the formation of double strands from complementary positive and negative strands of DNA. Therefore, fluorescent protein expression is almost unobservable in the first two days after spAAV infection. Fluorescent protein expression is gradually observed in a few cells three days after infection, and becomes more abundant after about a week. Fluorescent cells show clustered together, and the expression of fluorescent protein is stable and does not decrease with cell division. This is the expression pattern of the single-stranded DNA released by the spAAV vector after integration into the cell genome through homologous recombination or non-homologous recombination; such gene expression is stable and long-lasting.

[0268] When HEK293 cells are simultaneously infected with a positive-strand DNA spAAV vector and a negative-strand DNA spAAV vector, positive and negative-strand DNA are released. The two complementary single-stranded DNA molecules can pair to form double-stranded DNA, thereby enabling gene expression. spAAV vectors express proteins through complementary pairing, which is generally faster and more efficient.

[0269] Therefore, when two spAAV vectors described herein, namely spAAV-EGFP(+) or spAAV-EGFP(-), containing either the positive or negative strand of the target DNA gene, infect cultured cells (e.g., HEK 293 cells), their genomes can integrate into the cell genome, resulting in long-term and stable fluorescent protein expression. Furthermore, when two spAAV vectors described herein, namely spAAV-EGFP(+) and spAAV-EGFP(-), containing the positive and negative strands of the target DNA gene respectively, co-infect cultured cells (e.g., HEK 293 cells), they can complement each other to produce double-stranded DNA molecules, enabling the expression of the target gene at a high proportion. sequence list <110> Suzhou Jiheng Gene Technology Co., Ltd. <120> Recombinant adeno-associated virus genome and its packaged monopolar rAAV vector <130> 216544 <160> 16 <170> PatentIn version 3.3 <210> 1 <211> 145 <212> DNA <213> AAV2 <400> 1 aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg 60 ccgcccgggc aaagcccggg cgtcgggcga cctttggtcg cccggcctca gtgagcgagc 120 gagcgcgcag agaggggagtg gccaa 145 <210> 2 <211> 145 <212> DNA <213> AAV2 <400> 2 aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg 60 ccgggcgacc aaaggtcgcc cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc 120 gagcgcgcag agagggagtg gccaa 145 <210> 3 <211> 16 <212> DNA <213> AAV2 <400> 3 gcgcgctcgc tcgctc 16 <210> 4 <211> 6 <212> DNA <213> AAV2 <400> 4 agttgg 6 <210> 5 <211> 73 <212> DNA <213> AAV2 <400> 5 aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg 60 ccgggcgacc aaa 73 <210> 6 <211> 75 <212> DNA <213> Artificial sequence <400> 6 caggaacccc tagtgatgga gttggccact ccctctctgc gcgctcgctc gctcactgag 60 gccgggcgac caaaa 75 <210> 7 <211> 83 <212> DNA <213> Artificial sequence <400> 7 cgcgttttgg tcgcccggcc tcagtgagcg agcgagcgcg cagagaggga gtggccaact 60 ccatcactag gggttcctgg tac 83 <210> 8 <211> 28 <212> DNA <213> Artificial sequence <400> 8 gaccgataat ctctagattg aggaacaa 28 <210> 9 <211> 29 <212> DNA <213> Artificial sequence <400> 9 agctttgttc ctcaatctag agattatcg 29 <210> 10 <211> 33 <212> DNA <213> Artificial sequence <400> 10 tcactgacgc gtcggaaggt cggtatccac gga 33 <210> 11 <211> 40 <212> DNA <213> Artificial sequence <400> 11 cttcaaccgg ctgaagctgg ctagttatta atagtaatca 40 <210> 12 <211> 40 <212> DNA <213> Artificial sequence <400> 12 tgattactat taataactag ccagcttcag ccggttgaag 40 <210> 13 <211> 33 <212> DNA <213> Artificial sequence <400> 13 cccggggaat tcaatcgatg ttcgaatccc aat 33 <210> 14 <211> 34 <212> DNA <213> Artificial sequence <400> 14 tttgtaggta acctcaagaa gcacatcctg aatc 34 <210> 15 <211> 34 <212> DNA <213> Artificial sequence <400> 15 gcacgtggtt accttgccca gaatgtctgt gctg 34 <210> 16 <211> 33 <212> DNA <213> Artificial sequence <400> 16 tcactgacgc gtcacgtggt taccttgccc aga 33 <210> 17 <211> 34 <212> DNA <213> Artificial sequence <400> 17 caagatcggt ccgcggaagg tcggtatcca cgga 34 <210> 18 <211> twenty one <212> DNA <213> Artificial sequence <400> 18 tccgcgttac ataacttacg g 21 <210> 19 <211> 20 <212> DNA <213> Artificial sequence <400> 19 gggcgtactt ggcatatgat 20

Claims

1. A pre-packaging monopolar recombinant adeno-associated virus (adeno-associated virus) spAAV genome, wherein both ends of the spAAV genome are linear open ends, one end of which does not have an inverted terminal repeat (ITR) sequence, and the other end has an ITRt truncated portion, wherein the ITRt does not form a T-shaped hairpin palindrome structure, wherein the spAAV genome is a monopolar, single-stranded DNA, and wherein the spAAV genome does not have an ITR at the 3' end and has the ITRt at the 5' end, wherein the ITRt includes a Rep protein-binding element (RBE) and a terminal unwinding site (trs).

2. The spAAV genome of claim 1, wherein the ITRt comprises D, A', and C' regions derived from Flip ITR.

3. The spAAV genome of claim 1, wherein the ITRt comprises D, A', and B' regions derived from the Flop ITR.

4. An spAAV carrier, comprising: Capsid proteins; and spAAV genome packaged with capsid proteins; in, The spAAV genome packaged with capsid proteins is derived from the spAAV genome as described in claim 1.

5. The spAAV carrier as described in claim 4, wherein, The spAAV genome packaged by capsid proteins is a single-pole, single-stranded DNA.

6. An spAAV transgenic plasmid for generating the spAAV genome as described in claim 1.

7. A non-therapeutic in vitro method for delivering exogenous nucleic acids to cells, comprising contacting the cells with one or more spAAV carriers as described in claim 4, wherein, The genome of one or more of the spAAV vectors contains the gene expression cassette of the exogenous nucleic acid.

8. The non-therapeutic in vitro method as described in claim 7, wherein, One or more of the spAAV vectors include: an spAAV vector containing only the positive-stranded single-stranded DNA sequence of the exogenous nucleic acid and / or an spAAV vector containing only the negative-stranded single-stranded DNA sequence of the exogenous nucleic acid.

9. Use of the spAAV vector as described in claim 4 in the preparation of a product for delivering exogenous nucleic acids to cells, wherein, The genome of one or more of the spAAV vectors contains the gene expression cassette of the exogenous nucleic acid.

10. The use as described in claim 9, wherein, One or more of the spAAV vectors include: an spAAV vector containing only the positive-stranded single-stranded DNA sequence of the exogenous nucleic acid and / or an spAAV vector containing only the negative-stranded single-stranded DNA sequence of the exogenous nucleic acid.

11. An isolated host cell comprising the spAAV vector as described in claim 4.

12. Use of the spAAV vector as described in claim 4 in the preparation of products for gene expression, gene therapy, gene editing or gene regulation.

Images