Construction of endogenous crisper-cas system editing vector based on microbispora atroorientata and application thereof

Abstract

The application provides a kind of based on endogenous CRISPR-Cas system editing vector of A. spinosa and its application.The first aspect of the application provides a kind of nucleic acid molecule based on endogenous CRISPR-Cas system of A. spinosa, including Repeat sequence and crRNA sequence, the Repeat sequence is located in the upstream and downstream of the crRNA sequence, wherein: the nucleotide sequence of Repeat sequence is shown in SEQ ID NO:1;The crRNA sequence targets the downstream sequence of PAM sequence in A. spinosa genome, can be synthesized by the annealing of two primers of reverse complement, and the PAM sequence includes one of TCA, TCG, CCA and CCG.The application can knock out the target gene of A. spinosa genome, and provides a powerful genetic manipulation tool for functional genomics research, metabolic engineering and synthetic biology breeding of A. spinosa.

Description

Technical Field

[0001] This invention relates to the construction and application of an editing vector based on the endogenous CRISPR-Cas system of Polysporus spp., and relates to the field of synthetic biology genome editing technology. Background Technology

[0002] Saccharopolyspora spinosa is a fungicide with significant industrial value. Its fermentation produces spinosad, a green biological pesticide with huge market value. Spinosad not only has highly effective and broad-spectrum insecticidal effects, but also very low mammalian toxicity and excellent environmental friendliness. It has been registered in more than 100 countries and on more than 200 crops, becoming an outstanding representative of green agricultural antibiotics.

[0003] Meanwhile, *Saccharomyces cerevisiae* is also a recognized strain that is difficult to genetically manipulate, and traditional DNA double-crossover knockout is extremely inefficient. In recent years, genome editing technologies based on class II CRISPR systems, such as CRISPR-Cas9 or CRISPR-Cpf1 (Cas12a), have been widely used in genome editing of various cell types. However, exogenous Cas9 or Cpf1 proteins are highly cytotoxic to *Saccharomyces cerevisiae*, and the genes encoding Cas9 or Cpf1 are quite long, approximately 4 kb (Kilo base pair). Including the plasmid backbone and homologous arms, the entire edit plasmid can exceed 10 kb in length, making it difficult to introduce the edit plasmid into cells and limiting the application of exogenous CRISPR-Cas systems in *Saccharomyces cerevisiae*.

[0004] With the development of genome sequencing, different types of CRISPR-Cas systems are constantly being discovered in prokaryotic genomes. More than 50% of bacterial genomes contain CRISPR systems, of which 90% belong to class I systems. Unlike class II CRISPR systems, which require only one effector protein (such as Cas9 or Cpf1), class I systems rely on the Cascade effector complex, composed of multiple Cas proteins, to function. Modifying and utilizing the widely distributed class I endogenous CRISPR-Cas systems in bacteria has become a new and powerful genetic tool for circumventing the toxicity of exogenous Cas proteins and achieving efficient genome editing, especially for non-model species or strains where genetic manipulation is difficult. However, to date, there are no reports of genome editing of *Saccharopolyspora* using endogenous CRISPR-Cas systems. Summary of the Invention

[0005] This invention provides the construction and application of an editing vector based on the endogenous CRISPR-Cas system of *Saccharopolyspora*, for editing the genome of *Saccharopolyspora*, specifically for knocking out target genes in the *Saccharopolyspora* genome.

[0006] The first aspect of this invention provides a nucleic acid molecule constructed based on the endogenous CRISPR-Cas system of *Polysporium spp.*, the nucleic acid molecule comprising a repeat sequence and a crRNA sequence, wherein the repeat sequence is located upstream and downstream of the crRNA sequence, wherein:

[0007] The nucleotide sequence of the Repeat sequence is shown in SEQ ID NO:1;

[0008] The crRNA sequence is a sequence that targets a gene within the genome of *Saccharomyces cerevisiae*, and the upstream of the target gene includes a PAM sequence, which is one of TCA, TCG, CCA, or CCG.

[0009] Furthermore, the nucleic acid molecule also includes a homologous arm sequence that provides a repair template, the homologous arm sequence including a first homologous arm and a second homologous arm, the first homologous arm and the second homologous arm being identical to the upstream and downstream homologous arms of the target gene in the genome of *Saccharomyces cerevisiae*.

[0010] A second aspect of the present invention provides an expression vector comprising any of the nucleic acid molecules described above.

[0011] Furthermore, the expression vector also includes promoter J23119.

[0012] A third aspect of the present invention provides a method for constructing the above-mentioned expression vector, comprising:

[0013] A vector template is constructed, comprising a Repeat sequence and a recognition sequence encoding the BbsI restriction endonuclease, wherein the Repeat sequence is located upstream and downstream of the recognition sequence;

[0014] The vector template was cleaved using the type II-S restriction endonuclease BbsI, and the crRNA sequence was ligated to the cleavage product of the vector template using the Golden Gate method to obtain the expression vector.

[0015] Furthermore, the method also includes:

[0016] Using the genome of *Saccharomyces cerevisiae* as a template, the upstream and downstream homologous arms of the target gene were amplified;

[0017] The upstream and downstream homologous arms are connected to the expression vector to construct an expression vector including the homologous arm sequence.

[0018] A fourth aspect of the present invention provides the application of the above-described expression vector in genome editing of *Saccharomyces cerevisiae*, wherein the gene editing includes knocking out a target gene in the genome of *Saccharomyces cerevisiae*.

[0019] A fifth aspect of the present invention provides a method for genome editing of *Saccharopolyspora*, wherein the gene editing includes knocking out a target gene in the *Saccharopolyspora* genome, comprising:

[0020] The expression vector described above is introduced into *Saccharopolyspora* to achieve the knockout of the target gene within the *Saccharopolyspora* genome.

[0021] Further, the expression vector is introduced into *Polysporium spp.*, specifically including the following steps:

[0022] The expression vector was transformed into Escherichia coli S17-1 competent cells, and then transformed into Polysporus spp. via conjugation transfer.

[0023] Further, the *Saccharomyces cerevisiae* strain introduced into the expression vector was cultured on plates, and positive transformants were selected to obtain *Saccharomyces cerevisiae* strains with the target gene knocked out.

[0024] This invention utilizes the endogenous CRISPR-Cas system of *Saccharopolyspora* to guide the endogenous Cas protein complex to cleave the target sequence, eliminating the need for the introduction of exogenous Cas proteins and avoiding their toxicity issues. Furthermore, the sequence introduced into *Saccharopolyspora* is typically only about 100 bp in length, simplifying the construction and length of the editing plasmid, resulting in smaller plasmids that are easier and more efficiently introduced into cells, thus improving transformation efficiency. Simultaneously, the crRNA encoded by the expression vector introduced into *Saccharopolyspora* can guide the endogenous Cas protein complex to target and cleave the bacterial genome, exhibiting a reverse screening effect. Theoretically, the resulting conjugates are all successfully edited mutants, improving the knockout efficiency of the target gene. In summary, this invention can knock out the target gene in the *Saccharopolyspora* genome, providing a powerful genetic manipulation tool for functional genomics research, metabolic engineering, and synthetic biology modification breeding of *Saccharopolyspora*. Attached Figure Description

[0025] Figure 1 A Type IB CRISPR / Cas system for endogenous *Saccharomyces cerevisiae*;

[0026] Figure 2 The validation results for the PAM sequence;

[0027] Figure 3This diagram illustrates the spnR2 knockout using the endogenous CRISPR-Cas system of *Saccharomyces cerevisiae*. A shows the colony PCR verification results of 10 conjugates after introducing the edited plasmid pWT-J23119-Repeat-TSpnR2-Repeat-HA into *Saccharomyces cerevisiae*. B shows the sequencing verification results of the spnR2 knockout strain.

[0028] Figure 4 This diagram illustrates NcoI knockout using the endogenous CRISPR-Cas system of *Saccharomyces cerevisiae*. In the diagram, A shows the colony PCR verification results of the four conjugates after the editing plasmid pWT-J23119-Repeat-TNcoI-Repeat-HA was introduced into *Saccharomyces cerevisiae*; B shows the sequencing verification results of the NcoI knockout strain. Detailed Implementation

[0029] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions in the embodiments of this invention will be clearly and completely described below in conjunction with the embodiments of this invention. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0030] The primers used in this application, along with their numbers and sequences, are shown in Table 1.

[0031] Table 1. Primers used in this invention, their numbers, and sequences.

[0032]

[0033]

[0034] Figure 1 For endogenous Type IB CRISPR / Cas systems of Polysporum spp., such as Figure 1 As shown, *Saccharopolyspora* possesses a typical Type IB CRISPR-Cas system, containing eight Cas proteins (Cas1-Cas8). Each Cas protein has a CRISPR array upstream and downstream, composed of several "Repeat+Spacer+Repeat" units, where rectangular blocks represent Spacers and black diamonds represent Repeaters. Based on the characteristics of *Saccharopolyspora*'s endogenous CRISPR ("Repeat+Spacer+Repeat"), the Repeat sequence is kept unchanged, while the Spacer sequence is replaced with crRNA that can target the genomic target gene. Simultaneously, the 5' end of the target sequence contains a PAM sequence, enabling the use of *Saccharopolyspora*'s endogenous Cas protein complex to cleave the target sequence.

[0035] To determine the PAM sequence, the following experiments were conducted in this application:

[0036] Step 1: Perform Blast analysis on the Spacer sequence in the CRISPR array of Polysporus spp. to find the corresponding possible Protospacer (from bacteriophage or exogenous plasmid). Then, select the 8 bases upstream of the 5′ of the Protospacer for alignment. Through Weblogo (http: / / weblogo.threeplusone.com / ) plotting analysis, it is inferred that its possible PAM sequence is "NCG / A".

[0037] Step 2: Verify the activity of the endogenous CRISPR-Cas system and determine the PAM sequence through plasmid interference experiments. The specific steps are as follows: First, select the most recently captured spacer sequence in the *Saccharomyces cerevisiae* CRISPR2 array, denoted as "C2S1". Using AAC as a control, construct interference plasmids (containing PAM+C2S1) using TCA, TCG, CCA, and CCG as examples. The specific steps are as follows: 1) Digest the pCM265 plasmid with EcoRI and BglII to obtain a linearized vector; 2) Mix the paired primers AAC-C2S1-F / R, TCA-C2S1-F / R, TCG-C2S1-F / R, CCA-C2S1-F / R, and CCG-C2S1-F / R thoroughly; 3) Perform an annealing program on a PCR instrument: 95℃ for 5 min, 16℃ for 10 min; 4) Ligate the annealed primer pairs and the linearized vector using Solution I (Takara DNA Ligation Kit) to obtain interference plasmids containing different PAM sequences. Finally, each interference plasmid is introduced into *Saccharomyces cerevisiae* using conjugation transfer. By comparing the number of conjugates, the functionality of the endogenous CRISPR / Cas system in *Saccharomyces cerevisiae* can be verified, as well as the PAM sequences required for the system to function.

[0038] Experimental results are as follows Figure 2 As shown, under the same experimental conditions, the empty plasmid control group pCM265 and the non-PAM sequence AAC negative control group both produced a large number of conjugates (~1500), while the TCA group produced only a few conjugates, and TCG, CCA, and CCG produced no conjugates. These results indicate that the endogenous CRISPR-Cas system of *Saccharomyces cerevisiae* is active, and that TCA, TCG, CCA, and CCG are the PAM sequences required for its function.

[0039] To effectively drive miniCRISPR transcription, this invention selected J23119, a commonly used strong promoter in actinomycetes, to drive miniCRISPR transcription. The miniCRISPR module was cloned into the free plasmid pWT297 to obtain the targeting plasmid pWT-J23119-Repeat-Target-Repeat. However, the use of other promoters with similar functions, such as kasOp, to drive miniCRISPR transcription is not excluded.

[0040] The crRNA encoded by the miniCRISPR module guides the endogenous Cascade complex to target its own genome, forming double-strand breaks. To precisely repair these double-strand breaks, approximately 2.5 kb homologous arms (HA) fragments upstream and downstream of the cleavage site were obtained via PCR. These homologous arms were then cloned into the aforementioned target plasmid, resulting in the editing plasmid pWT-J23119-Repeat-Target-Repeat-HA. The editing plasmid was then introduced into *Saccharomyces cerevisiae* via conjugation transfer, enabling the recognition, cleavage, and homologous recombination repair of the target gene, thus achieving precise editing of the target gene.

[0041] Furthermore, the upstream and downstream homologous arms used in this invention are approximately 2.5 kb in length and are located upstream and downstream of the target gene, respectively. In addition, the length, sequence, and position of the homologous arms can be easily adjusted as needed to achieve editing results such as knockout, insertion, and single-base mutation of the target gene.

[0042] To facilitate the replacement of the target sequence in the target plasmid pWT-J23119-Repeat-Target-Repeat, this application also constructed a helper plasmid pWT-J23119-Repeat-2xBbsI-Repeat. The linearized pWT-J23119-Repeat-2xBbsI-Repeat plasmid was digested with the type II-S restriction endonuclease BbsI, and then the target sequence for different genes was quickly and easily replaced using the Golden Gate method.

[0043] Example 1: Knocking out the spnR2 gene using an endogenous CRISPR-Cas system

[0044] SpnR2 is a regulatory protein of the GntR family and may have an important impact on spinosad biosynthesis. To investigate its specific function, the spnR2 gene was knocked out using the genome editing method based on the endogenous CRISPR-Cas system of *Saccharomyces cerevisiae* as described in this invention. The specific implementation method is as follows:

[0045] Step 1: The nucleotide sequence of the spnR2 gene is T SpnR2 The sequence “cggtcatgactcggtctcggacgcagacct” has a 5' PAM sequence of “CCG”. Two primers T were designed and synthesized. SpnR2 -F and T SpnR2 -R. Take 10 μl of each primer and mix them in a PCR tube. Then place the tube in a PCR instrument and run the annealing program: 95℃ for 5 min, 16℃ for 10 min. Anneal the two single-stranded PCR primers to form double-stranded DNA fragments with sticky CAAC and GGAC ends at the 5' end, respectively.

[0046] Step 2: The helper plasmid pWT-J23119-Repeat-2xBbsI-Repeat was digested with BbsI enzyme, and the linearized vector was recovered. The annealed DNA fragment and the linearized vector were ligated using Solution I (Takara DNA Ligation Kit). The ligation system was transformed into Top10 competent cells, plated on LB plates supplemented with apramycin, cultured overnight, and transformants were selected for expansion culture to extract plasmids. Finally, the target plasmid pWT-J23119-Repeat-TSpnR2-Repeat was obtained by Sanger sequencing.

[0047] Step 3: Digest the pWT-J23119-Repeat-TSpnR2-Repeat target plasmid with EcoRV enzyme and recover the linearized vector. Perform PCR amplification using the *Saccharomyces cerevisiae* genome as a template, using primer pairs SpnR-HU-F / R and SpnR-HD-F / R, respectively, to obtain the upstream and downstream homologous arms for knocking out the spnR2 gene. Recombinantly ligate the upstream and downstream homologous arms with the linearized target plasmid to obtain the spnR2 knockout plasmid pWT-J23119-Repeat-TSpnR2-Repeat-HA.

[0048] Step 4: Transform the knockout plasmid pWT-J23119-Repeat-TSpnR2-Repeat-HA into Escherichia coli S17-1 competent cells, and then transform the knockout plasmid into the starting strain NRRL 18395 of Polysporus spp. via conjugation transfer. Culture on 2cmc plates at 30°C for 8–10 days. (Note: 2cmc medium formulation: 10 g / L soluble starch, 2 g / L tryptone, 1 g / L sodium chloride, 2 g / L (NH4)2SO4, 1 g / L dipotassium hydrogen phosphate, 2 g / L MgSO4·7H2O, 2 g / L Casamino acid, 1 ml trace element solution, 2 g / L...) CaCO3, 20 g / L agar, adjust pH to 7.2 (Note: Trace element solution (g / L): 1 g / L ferrous sulfate heptahydrate, 1.55 g / L manganese chloride tetrahydrate, 1.75 g / L zinc sulfate heptahydrate).

[0049] Step 5: Select conjugates and transfer them to new 2cm² plates containing Apra (ampramycin) and Nd (naphthylpyridinol) antibiotics. Incubate at 30°C for 2–3 days. Perform colony PCR on the grown conjugates using primers spnR-GF and spnR-GR, with the starting strain NRRL 18395 as a control. Preliminary assessment of spnR2 gene knockout success is made by observing changes in the amplified band size. If spnR2 is successfully knocked out (approximately 260 bp), the PCR amplified band will be shorter than the band amplified using the starting strain as a template.

[0050] In this invention, 10 conjugates were randomly selected for PCR verification, and the results are as follows: Figure 3 The results showed that when using spnR-GF / GR as primers for PCR, the target band could be amplified by both the Sas001 control strain and all 10 conjugates. Furthermore, the band amplified using the conjugates as templates was slightly smaller than the band amplified using the starting strain NRRL18395 as templates. This indicates that the validated conjugates all achieved 100% knockout of the spnR2 gene. The knockout results were further confirmed by Sanger sequencing.

[0051] Example 2: Knocking out the NcoI gene using an endogenous CRISPR-Cas system

[0052] The genome of *Saccharomyces cerevisiae* is rich in methylation restriction systems (RMs), and studies have shown that RM systems, especially the NcoI RM system, are a significant reason for the difficulty in genetic transformation of this bacterium. To improve the genetic transformation efficiency of this bacterium, this invention selected and knocked out the restriction endonuclease gene NcoI within the NcoI RM system.

[0053] Step 1: The target sequence of the NcoI gene is TNcoI "tccttgaagcagatgcggtcgagtggcttc", and its 5' PAM sequence is "CCG". Design and synthesize two primers T NcoI -F and T NcoI Using the same method as in Example 1, the NcoI-targeting plasmid pWT-J23119-Repeat-TNcoI-Repeat was constructed. It was then linearized using EcoRV. Using primers NcoI-HU-F / R and NcoI-HD-F / R, and with the *Saccharomyces cerevisiae* genome as a template, the upstream and downstream homologous arms for knocking out NcoI were amplified by PCR. These homologous arms were then cloned into the targeting plasmid, ultimately obtaining the NcoI-knockout editing plasmid pWT-J23119-Repeat-TNcoI-Repeat-HA.

[0054] Step 2: Using the same method as in Example 1, the edited plasmid pWT-J23119-Repeat-TNcoI-Repeat-HA was introduced into the starting strain NRRL 18395 of Polysporum oryzae via conjugation transfer, ultimately obtaining 4 conjugates.

[0055] The four conjugates were verified by PCR using primers NcoI-GF and NcoI-GR, respectively. The results are as follows: Figure 4 As shown, its amplified band was smaller than that of the NRRL 18395 control group. Sanger sequencing results indicated that the NcoI gene was knocked out. These results show that all four obtained conjugates were NcoI knockout mutant strains, with a knockout efficiency of 100%.

[0056] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A nucleic acid molecule constructed based on the endogenous CRISPR-Cas system of *Saccharomyces cerevisiae*, characterized in that, The nucleic acid molecule includes a repeat sequence and a crRNA sequence, wherein the repeat sequence is located upstream and downstream of the crRNA sequence, and: The nucleotide sequence of the Repeat sequence is shown in SEQ ID NO:1; The crRNA sequence is a sequence that targets a gene within the genome of *Saccharomyces cerevisiae*, and the upstream of the target gene includes a PAM sequence, which is one of TCA, TCG, CCA, or CCG. The nucleic acid molecule also includes a homologous arm sequence that provides a repair template, the homologous arm sequence including a first homologous arm and a second homologous arm, the first homologous arm and the second homologous arm being identical to the upstream and downstream homologous arms of the target gene in the genome of *Saccharomyces cerevisiae*.

2. An expression carrier, characterized in that, The expression vector comprises the nucleic acid molecule as described in claim 1.

3. The expression vector according to claim 2, characterized in that, The expression vector also includes promoter J23119.

4. The method for constructing the expression vector according to any one of claims 2-3, characterized in that, include: Construct a carrier template, which includes a Repeat sequence and encoding. Bbs The recognition sequence of the restriction endonuclease, wherein the Repeat sequence is located upstream and downstream of the recognition sequence; Using type II-S restriction endonucleases Bbs I cut the vector template and ligated the crRNA sequence to the cutting product of the vector template using the Golden Gate method to obtain the expression vector; Using the genome of *Saccharomyces cerevisiae* as a template, the upstream and downstream homologous arms of the target gene were amplified; The upstream and downstream homologous arms are connected to the expression vector to construct an expression vector including the homologous arm sequence.

5. The application of the expression vector according to any one of claims 2-3 in genome editing of *Saccharopolyspora*, wherein the gene editing comprises knocking out a target gene in the genome of *Saccharopolyspora*.

6. A method for genome editing of *Saccharomyces cerevisiae*, characterized in that, The gene editing includes knocking out target genes in the genome of *Saccharomyces cerevisiae*, including: The expression vector according to any one of claims 2-3 is introduced into *Saccharopolysporum spp.* to achieve knockout of the target gene in the genome of *Saccharopolysporum spp.* 7. The method according to claim 6, characterized in that, The expression vector was introduced into *Saccharomyces cerevisiae*, specifically including the following steps: The expression vector was transformed into Escherichia coli S17-1 competent cells, and then transformed into Polysporus spp. via conjugation transfer.

8. The method according to claim 7, characterized in that, The *Sacchariformis* strain introduced into the expression vector was cultured on plates, and positive transformants were selected to obtain *Sacchariformis* strains with the target gene knocked out.

Images