A kit for detecting prevotella tannerae and application

Abstract

This invention belongs to the field of early quantitative detection technology, specifically relating to a kit and application for detecting Prevotella rumeniformis, including fluorescent reaction solution A, fluorescent reaction solution B, internal standard, negative control, nucleic acid release agent, and quantitative reference. Fluorescent reaction solution B contains detection primers, including a forward primer and a reverse primer. The sequence of the forward primer is 5'-GGGACTCAAGGAGTTCGTTC-3', and the sequence of the reverse primer is 5'-CTTCAGGCAGATAGGATCGC-3'. This kit can effectively detect biological indicator bacteria, evaluate early nutritional iron deficiency in sows, and provides better monitoring accuracy and specificity.

Description

Technical Field

[0001] This invention belongs to the field of early quantitative detection technology, specifically relating to a kit for detecting Prevotella rumenella and its application. Background Technology

[0002] The amount of iron in an animal's body directly affects its health. Currently, the common method for measuring iron is to collect serum and measure the iron content in the serum to characterize the iron content. However, this method has two limitations. First, it is outdated, as a low iron content already indicates a severe iron deficiency in the animal, making it difficult to apply in practice. Second, this method requires blood sampling, making it difficult to conduct large-scale and widespread monitoring. Summary of the Invention

[0003] The technical problem to be solved by the present invention is to provide a kit and application for detecting Prevotella rumenella, which can effectively detect early nutritional iron deficiency in sows with better monitoring accuracy and specificity.

[0004] This invention provides a kit for detecting Prevotella rumeni, comprising a fluorescent reaction solution A, a fluorescent reaction solution B, an internal standard, a negative control, a nucleic acid release agent, and a quantitative reference. The fluorescent reaction solution B contains detection primers, which include a forward primer and a reverse primer. The sequence of the forward primer is 5'-GGGACTCAAGGAGTTCGTTC-3' (SEQ ID NO.1), and the sequence of the reverse primer is 5'-CTTCAGGCAGATAGGATCGC-3' (SEQ ID NO.2).

[0005] This invention employs a fluorescent PCR quantitative detection method for the gyrB gene of *Protella ruminicola*, which can detect and quantify biological targets in samples, thus providing a simple and easy method for assessing nutritional iron deficiency in sows during pregnancy.

[0006] The fluorescent reaction solution B also contains primers and probes, the sequence of which is 5'-TCGATCGTCACCGCACCTCA-3' (SEQ ID NO.3), with a reporter fluorescent group labeled at the 5' end and a quencher fluorescent group labeled at the 3' end;

[0007] The fluorescent reaction solution B also contains internal standard primers and internal standard probes. The internal standard primers include a forward internal standard primer and a reverse internal standard primer. The sequence of the forward internal standard primer is 5'-CATAGTTGGACCGCTAGGA-3' (SEQ ID NO.4), the sequence of the reverse internal standard primer is 5'-GAAAGGTCCCGCAAAGAGT-3' (SEQ ID NO.5), and the sequence of the internal standard probe is 5'-CCGGTGATAAACCTTTGGACCCT-3' (SEQ ID NO.6). The 5' end is labeled with a reporter fluorescent group, and the 3' end is labeled with a quencher fluorescent group.

[0008] It also contains an internal standard recombinant plasmid, designated pUC-IPC, with a working concentration of 10. 6 The recombinant plasmid contains a random internal standard sequence, 455 bp in length, with the following nucleotide sequence:

[0009] CTGGAGACTGAGGGTTGACGCGCATTCGTCATTGAACGCAGACACGGCTGAGAGAACATGGAGCGACTGCACTTGGTCGATCTGATTAGGAGTGGGGTTTATGCCCGCGGCTTATCCCCCTATCCTTGCGACACGGGAGAAGACAGATTGTCATCGATTTCGCAAGCCATGATATGTTTTGGCCCGACCAACCGCGTTTTTCTCGCGCTTGGATAACGACCTATG GTGTGGACAGTGGCTTAGAGGACATGACACGACGGGCTGAAAGTATGTGGTGCTGGGGCCCTTAGATAGCTGCATAGTTGGACCGCTAGGAATTATATCAATTCGAGATCTCCAGCCGACAAAGTAGGCTCCTAACTAACAGGGTCCAAAGGTTTATCACCGGTCCTTACTCTTTGCGGGACCTTTCTACCCATACAATATCGTCCTCCGATGATGGATCACGGAG(SEQ ID NO.7).

[0010] The reporting fluorescent group is Fam or Hex, and the quenching fluorescent group is BHQ1.

[0011] The fluorescent reaction solution A contains 1250 μL / tube, 1 tube / kit. It includes PCR-Buffer, dNTPs, hot-start Taq enzyme, and UNG enzyme. The Tris-HCl concentration in the PCR-Buffer is 125–200 mM, higher than the commonly used 10 mM concentration. This ensures that the PCR reaction is not affected by the alkaline nucleic acid releasing agent, which is one of the core components enabling the nucleic acid extraction-free process of this kit.

[0012] The dNTPs include four deoxyribonucleosides: dATP, dUTP, dGTP, and dCTP. dUTP is used instead of the commonly used dTTP, resulting in amplified bands containing U bases in the DNA. This double-stranded structure is hydrolyzed in the presence of UNG enzymes, thus reducing contamination from residual amplification products (a major source of PCR contamination).

[0013] The final concentration of hot-start Taq enzyme in fluorescent reaction solution A is 0.2–0.3 U / μL. This enzyme needs to be activated at approximately 95°C to exercise its amplification activity.

[0014] UNG enzyme, short for uracil-N-glycosylation enzyme, can selectively hydrolyze and break uracil glycosidic bonds in DNA containing U bases, thereby eliminating residual amplification products and aerosol contamination. The optimal activity temperature of this enzyme is 50 degrees Celsius, and it is inactivated at 95 degrees Celsius. Together with hot-start Taq enzyme, it can inhibit false positives.

[0015] Fluorescent reaction solution B: 650 μL / tube, 1 tube / box. The concentrations of upstream and downstream primers are 500–750 nM, and the concentrations of primers and probes are 250–500 nM; the concentrations of internal standard primers and internal standard probes are 250–500 nM, respectively.

[0016] The internal standard contains the recombinant plasmid pUC-IPC, which is diluted to a working concentration of 10. 6 The values ​​are per copy / ml, used as an internal standard. The negative control is a TE buffer solution. The nucleic acid release agent comprises 25–100 mM NaOH, 1–5% PEG6000, and 0.5–1 mM EDTA. In this nucleic acid release agent, NaOH can effectively lyse cells or viruses, release their contents, and denature and inactivate them. The non-ionic detergent PEG6000 further disperses proteins and nucleic acids, and EDTA can effectively inhibit the hydrolysis of DNA by nucleases.

[0017] The concentration of the cloned plasmid pUC-LR-gyrB in the quantitative reference standard was 1.37 × 10⁻⁶. 7 ~1.37×10 4 copies / ml, within this range, showed a linear correlation, with a correlation coefficient R. 2=0.99, within this linear amplification range, the amplification efficiency is above 94%.

[0018] This invention provides the application of the aforementioned kit in the preparation of a formulation for detecting nutritional iron deficiency in sows. The detection method includes the following steps:

[0019] Add the internal standard to the sample, heat at 85℃~95℃ for a period of time, centrifuge, take the supernatant, add PCR-Mix, the PCR-Mix is ​​a mixture of fluorescent reaction solution A and fluorescent reaction solution B, to obtain the sample to be tested; amplify the negative control, quantitative reference and the sample to be tested respectively, measure the Ct value, and determine whether the sow has nutritional iron deficiency.

[0020] The amplification cycle parameters are set as follows:

[0021]

[0022] The beneficial effects of this invention are that it aims to develop an early monitoring and diagnostic technology that can detect nutritional iron deficiency in sows earlier. Combined with timely administration of highly effective iron supplements to high-producing sows, and by seizing the optimal window for iron supplementation, it can effectively meet the iron nutritional needs of piglets, preventing poor development and growth restriction in piglets, increasing birth weight and litter weight, reducing the frequency of weak piglets, and improving the health and growth performance of both sows and piglets. The application of this technology makes iron deficiency in sows "visible," ensures adequate iron supplementation for sows, and ensures adequate growth for piglets, achieving precise and personalized prevention and control of iron deficiency in sows and piglets. This significantly improves the economic benefits for farmers, and the product has a promising market prospect, providing technical support for the precise regulation of iron nutrition in sows.

[0023] This technical solution establishes a monitoring and diagnostic method for "early iron deficiency" in pigs by detecting biomarkers in biological samples from sows with early iron deficiency. This method reflects the iron nutritional status of the pig herd earlier, more sensitively, and more accurately than traditional monitoring of indicators such as "serum iron" and "hemoglobin".

[0024] This invention correlates the iron content in sows with the content of Prevotella rumeniformis. Detecting the content of Prevotella rumeniformis can assess the degree of iron deficiency in sows, thereby effectively improving the convenience and accuracy of measurement. Attached Figure Description

[0025] Figure 1 The amplification curves of the primers and probes 1-P, 1-F, and 1-R of this invention are shown.

[0026] Figure 2 The amplification curves of the primers and probes 2-P, 2-F, and 2-R of this invention are shown.

[0027] Figure 3The amplification curves of the primers and probes 3-P, 3-F, and 3-R of this invention are shown.

[0028] Figure 4 This is the amplification curve of the internal standard-free system of the present invention.

[0029] Figure 5 Amplification curves with internal standard IPC01 added for this invention.

[0030] Figure 6 Amplification curves with internal standard IPC02 added for this invention.

[0031] Figure 7 Amplification curves with internal standard IPC03 added for this invention.

[0032] Figure 8 The linear amplification curve and standard curve of this invention are shown. Detailed Implementation

[0033] Example 1

[0034] One detection method, the key steps of which are as follows.

[0035] (1) Sample collection: Use a flocked swab to collect fresh fecal samples from sows, place them in a sample tube containing 5 ml of nucleic acid release agent, and mix well.

[0036] (2) Internal standard setting: Add 10 μl of internal standard to each sample tube.

[0037] (3) Nucleic acid release: Place the sample tube in a metal bath or water bath and heat at 85℃~95℃ for 10 min. After a short centrifugation, take the supernatant for subsequent PCR detection.

[0038] Preparation of amplification reagents: Take out each component from the package and place at room temperature until it is completely dissolved. Shake and mix well for later use. Take the corresponding amount of reagents according to the ratio (25 μL of fluorescent reaction solution A / reaction + 15 μL of fluorescent reaction solution B / reaction), mix thoroughly to form PCR-Mix, centrifuge briefly, and add 40 μL of PCR-Mix to each reaction tube.

[0039] (4) Sample addition: Add 10 μL of negative control / quantitative reference / test sample to the corresponding PCR reaction well, cover the tube, mix well, centrifuge briefly, and transfer to the amplification area.

[0040] (5) Amplification: Place the PCR reaction tubes into the sample slots of the amplification instrument, and set the negative control, quantitative reference, and sample name in the corresponding order; select the FAM channel to detect Lactobacillus reuteri nucleic acid; select the HEX channel to detect the internal standard; set the reaction volume to 50 μL; set the cycling parameters as follows:

[0041]

[0042] Once the settings are complete, save the file and run the reaction program.

[0043] (6) Quality control: The negative control HEX channel Ct value ≤ 35, and the FAM channel has no Ct value or a typical amplification curve; the quantitative reference A to DFAM channels are all positive, and the correlation coefficient of the standard curve is R. 2 ≥0.98.

[0044] (7) Result determination: The HEX channel Ct value of the sample to be tested is ≤35; otherwise, it needs to be tested again. The corresponding quantitative measurement results are reported according to the instrument calculation value, and a further assessment of nutritional iron deficiency in sows is made based on the measured value range.

[0045] Example 2

[0046] Metagenomic studies have shown that nutritional iron deficiency in sows during gestation is closely related to the levels of characteristic gut microbiota such as *Lactobacillus johsonii*, *Lactobacillus reuteri*, and *Protella ruminicola*, and these characteristic bacterial species can be used as indicators. Bacterial 16S rRNA, gyrB, recA, pepC, and gdh genes are commonly used for species identification and bacterial detection. In this study, we established a fluorescent PCR quantitative detection method for the *Lactobacillus reuteri* gyrB gene, which can detect and quantify biological targets in samples, thus providing a simple and easy-to-use method for assessing nutritional iron deficiency in sows during gestation.

[0047] 1. Materials and Methods

[0048] 1.1 Reagents and Instruments

[0049] HotStart Taq enzyme (5 U / μL) was purchased from Tiangen Biotech Co., Ltd.; DEPC-treated water was purchased from Shanghai Bioengineering Co., Ltd.; primers, probes, and sequences were synthesized by Shanghai Jierui Bioengineering Co., Ltd.; 2×PCR Buffer (containing Mg) 2+ (such as dNTPs) are prepared by ourselves.

[0050] Eppendorf BioPhotometer D30 Nucleic Acid and Protein Analyzer; Hongshi SLAN-96S Real-Time PCR Instrument; ABI 7500 Real-Time PCR Instrument.

[0051] 1.2 Samples and Processing

[0052] Positive plasmid: Based on the full-length sequences of the gdh, recA, and gyrB genes of Prevotella rumeniformis KHP1 strain in NCBI, the cloning plasmid pUC-PR-3 was synthesized. The concentration of pUC-PR-3 plasmid was determined using a nucleic acid protein analyzer. Based on the actual concentration measured, pUC-PR-3 was serially diluted with TE buffer to approximately 10. 9 Gradient concentrations of up to 100 copies / ml.

[0053] Internal standard plasmid: A cloned plasmid pUC-IPC containing a random internal standard sequence was synthesized. The concentration of pUC-IPC plasmid was determined using a nucleic acid protein analyzer. Based on the actual concentration measured, pUC-IPC was diluted to approximately 10⁻⁶ with TE buffer. 6 copies / ml.

[0054] Specificity test plasmids: Lactobacillus rhamnosus gyrB clone plasmid pUC-LRh-gyrB; Lactobacillus reuteri gyrB clone plasmid pUC-LR-gyrB; Lactobacillus johsonii gyrB clone plasmid pUC-LJ-gyrB; Lactobacillus gasseri gyrB clone plasmid pUC-LG-gyrB; Lactobacillus plantarum gyrB clone plasmid pUC-LP-gyrB; Lactobacillus vaginalis gyrB clone plasmid pUC-LV-gyrB; Lactobacillus jensenii gyrB clone plasmid pUC-LJe-gyrB.

[0055] 1.3 Primer and probe system testing

[0056] Bioinformatics analysis was used to compare the gdh, recA, and gyrB gene sequences of *Prevotella rumeniformis* registered in NCBI. Sequences of conserved intraspecific and species-specific regions were selected, and multiple sets of specific primers and probes were designed using OLIGO 7 software. Multiple sets of internal control primers and probes were also designed based on random internal control sequences. Specific sequence information is shown in Table 1. The amplification performance of each set of gyrB primers and probes for the target gene was tested using dye-based and probe-based fluorescent PCR experiments, and the best-matched internal control system was selected.

[0057] Table 1 provides primer and probe sequence information for testing.

[0058]

[0059]

[0060] 1.4 Linear Amplification Assay

[0061] Prepare the reaction system by adding 1.20 × 10⁻⁶ ppm. 7 copies / ml ~ 1.20 × 10 2 pUC-PR-3 positive plasmids at a concentration of copies / ml (1:10 dilution) were amplified. After amplification, the linear amplification range was determined based on the amplification standard curve.

[0062] 1.5 Analytical Sensitivity Test

[0063] Prepare the reaction system by adding 2.40 × 10⁻⁶ ppm. 3 copies / ml, 1.20×10 3 Positive plasmids at concentrations of 600 copies / ml, 600 copies / ml, and 300 copies / ml were amplified, with each concentration repeated 21 times. The limit of detection (LOD) (analytical sensitivity) was determined based on the detection rate (≥95%). The positive / negative determination interval (gray zone) was calculated based on the Ct value detected at the LOD.

[0064] 1.6 Precision Test

[0065] Prepare the reaction system by adding 1.20 × 10⁻⁶ ppm. 7 1.20×10 5 1.20×10 3 Positive plasmids at a concentration of copies / ml were amplified, with each concentration repeated 10 times. The coefficient of variation (CV) was calculated based on the detection Ct value.

[0066] 1.7 Specificity Test

[0067] Prepare the reaction system, add 7 portions of specific test plasmid (diluted to a suitable concentration with TE) for amplification, and set up a positive control (pUC-PR-3) and a negative control (TE solution). Analyze the specificity of this method based on the detection results.

[0068] 2 Results and Analysis

[0069] 2.1 Primer and probe system screening

[0070] 2.1.1 Primer and probe screening

[0071] Specific primers and probes were added to each group, and probe matching was evaluated using probe-based fluorescent PCR. Based on the detection Ct values ​​of the gradient template concentrations and the amplification curve morphology, the third group of primers and probes (3-PR-F, 3-PR-R, 3-PR-P) was selected as the optimal combination. Figure 1-3 )

[0072] Amplification system: 25 μL 2×PCR Buffer, 0.5 μL each of F / R primers (40 μM), 0.25 μL Probe (20 μM), 0.5 μL HotStart Taq enzyme (5 U / μL), 5 μL template, and ddH2O to a final volume of 25 μL. The fluorescent PCR amplification program is as follows: 95℃ for 2 minutes, 1 cycle; 95℃ for 15 seconds, 60℃ for 30 seconds (fluorescence reading), 50 cycles. Unique identifiers 1-4 correspond to template concentrations of 1.20 × 10⁻⁴. 5 copies / ml, 1.20×10 4 copies / ml, 1.20×10 3 copies / ml, 1.20×10 2 copies / ml.

[0073] 2.1.2 Screening of Internal Standard System

[0074] Based on the primer and probe screening results, different internal standard systems (IPC01, IPC03, IPC05) were added to test the difference in amplification performance between each group and the group without internal standard. The results showed that the IPC05 internal standard system had little impact on the amplification of the main channel and its own curve shape was stable. Therefore, both were preferred as the matching internal standard monitoring systems. Figure 4-7 )

[0075] Amplification system: 25 μL 2×PCR Buffer, 0.5 μL each of 3-F / 3-R primers (40 μM), 0.25 μL 3-P (20 μM), IPC01 / IPPC03 / IPPC05 internal standard system, 0.5 μL HotStart Taq enzyme (5 U / μL), 5 μL template, and ddH2O to a final volume of 25 μL. The fluorescent PCR amplification program was as follows: 95℃ for 2 minutes, 1 cycle; 95℃ for 15 seconds, 60℃ for 30 seconds (fluorescence reading), 50 cycles. Template concentration was 1.20 × 10⁻⁶. 5 copies / ml ~ 1.20 × 10 2 copies / ml.

[0076] 2.2 Linear Amplification Range

[0077] like Figure 8 As shown, this method is effective for 1.20 × 10⁻⁶. 7 ~1.20×10 2 Gradient template amplification at copies / ml was normal. Among them, 1.20×10 7 ~

[0078] 1.20×10 3 A linear correlation was observed within the range of copies / ml, with a correlation coefficient R.2 =0.99, within this linear amplification range, the amplification efficiency is above 98%. Based on the above results, the quantitative range of this method can be determined to be 1.20 × 10⁻⁹. 7 ~1.20×10 4 copies / ml.

[0079] 2.3 Analytical Sensitivity

[0080] The precision test results show (Table 2) that the precision is 2.40 × 10⁻⁶. 3 The detection rate of copies / ml template (12.0 copies / reaction) was 100%.

[0081] 1.20×10 3 The detection rate was 100% for templates with 6.0 copies / ml (6.0 copies / reaction), 7% for templates with 600 copies / ml (3.0 copies / reaction), and 23.8% for templates with 300 copies / ml (1.5 copies / reaction). 1.20×10 3 The limit of detection (LOD) is 1.20 × 10⁻⁶ copies / ml. 3 The Ct value calculated for repeated testing of copies / ml template corresponds to a gray area Ct value range of 33.03 (take 33) to 34.87 (take 35). That is, Ct value ≤ 33 is considered positive, 33 < Ct value < 35 is considered suspicious, and Ct value ≥ 35 or no Ct value is considered negative. The result can be confirmed by multiple retests of the sample.

[0082] Table 2 shows the results of sensitivity measurements.

[0083]

[0084] 2.4 Precision

[0085] The results of the precision test (Table 3) using high, medium, and low concentration templates showed that the precision (CV value) of this method was 190–2.27%, indicating good repeatability.

[0086] Table 3 Precision Test Results

[0087]

[0088] 2.5 Specificity

[0089] The results of the specificity test (Table 4) showed that Prevotella rumeni gyrB was not detected in any of the 7 specific plasmid samples under the premise of detection of internal standard, indicating that this method does not have cross-reaction with the above 7 intestinal flora.

[0090] Table 4 Results of Specificity Tests

[0091]

[0092] Those skilled in the art should understand that the discussion of any of the above embodiments is merely exemplary and is not intended to imply that the scope of protection of this application is limited to these examples; within the framework of this application, the technical features of the above embodiments or different embodiments can also be combined, the steps can be implemented in any order, and there are many other variations of different aspects of one or more embodiments of this application as described above, which are not provided in detail for the sake of brevity.

[0093] One or more embodiments in this application are intended to cover all such substitutions, modifications, and variations that fall within the broad scope of this application. Therefore, any omissions, modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of one or more embodiments in this application should be included within the protection scope of this application.

Claims

1. A kit for detecting Prevotella rumenella, characterized in that, The reagent includes fluorescent reaction solution A, fluorescent reaction solution B, internal standard, negative control, nucleic acid release agent and quantitative reference. Fluorescent reaction solution B contains detection primers, which include a forward primer and a reverse primer. The sequence of the forward primer is 5'-GGGACTCAAGGAGTTCGTTC-3', and the sequence of the reverse primer is 5'-CTTCAGGCAGATAGGATCGC-3'. The fluorescent reaction solution B also contains primers and probes with the sequence 5'-TCGATCGTCACCGCACCTCA-3', wherein the 5' end is labeled with a reporter fluorescent group and the 3' end is labeled with a quencher fluorescent group. The fluorescent reaction solution B also contains internal standard primers and internal standard probes. The internal standard primers include a forward internal standard primer and a reverse internal standard primer. The sequence of the forward internal standard primer is 5'-CATAGTTGGACCGCTAGGA-3', the sequence of the reverse internal standard primer is 5'-GAAAGGTCCCGCAAAGAGT-3', and the sequence of the internal standard probe is 5'-CCGGTGATAAACCTTTGGACCCT-3'. The 5' end is labeled with a reporter fluorescent group, and the 3' end is labeled with a quencher fluorescent group. The fluorescent reaction solution A includes PCR-Buffer, dNTPs, hot-start Taq enzyme, and UNG enzyme. The concentration of Tris-HCl in the PCR-Buffer is 125–200 mM. The dNTPs include four deoxyribonucleosides: dATP, dUTP, dGTP, and dCTP. The final concentration of the hot-start Taq enzyme in the fluorescent reaction solution A is 0.2–0.3 U / μL.

2. The kit according to claim 1, characterized in that the fluorescence... In reaction solution B, the concentrations of the forward and reverse primers are 500–750 nM, and the concentrations of the primers and probes are 250–500 nM; the concentrations of the internal standard primers and internal standard probes are 250–500 nM, respectively.

3. The kit according to claim 1, characterized in that, The reporting fluorescent group is Fam or Hex, and the quenching fluorescent group is BHQ1.

4. The kit according to claim 1 or 2, characterized in that, The negative control was a TE buffer solution.

5. The kit as described in claim 1 or 2, characterized in that, The nucleic acid releasing agent comprises 25–100 mM NaOH, 1–5% PEG6000, and 0.5–1 mM EDTA.

Images