Methods for detecting transgenic components based on CRISPR-Cas enzyme gene editing technology
Patent Information
- Application Number
- CN202211644474.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-04-09
- Publication Date
- 2026-09-11
- Estimated Expiration
- 2041-04-09
AI Technical Summary
目前,以Cas13a为基础的体外核酸检测技术已初步在医学和植物检测上运用,显示高度敏感性、准确性;以Cas12a为基础的体外核酸检测技术已初步在医学上运用,但还没有在植物基因检测上应用;无论是CRISPR DNA内切酶还是CRISPR RNA内切酶都还没有在植物转基因成分检测上的应用报道
Smart Images

Figure CN116411113B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of gene editing technology, specifically to a method for detecting transgenic components based on CRISPR Cas enzyme gene editing technology. Background Technology
[0002] The emergence of DETECTR, a DNA detection technology based on Cas12a (CRISPR DNA endonuclease), and SHERLOCK RNA detection technology based on Cas13a (CRISPR RNA endonuclease), between 2017 and 2019, pioneered the use of gene editing technology as a high-throughput, rapid, accurate, sensitive, and easy-to-use detection technology based on nucleic acids. Gene editing detection technology, built upon efficient nucleic acid detection, offers unparalleled advantages over traditional monoclonal antibody protein detection technologies, enabling efficient and rapid monitoring of diverse plant viruses and genetically modified plants. Currently, Cas13a-based in vitro nucleic acid detection technology has been preliminarily applied in medicine and plant detection, demonstrating high sensitivity and accuracy; Cas12a-based in vitro nucleic acid detection technology has also been preliminarily applied in medicine, but has not yet been applied to plant gene detection; neither CRISPR DNA endonuclease nor CRISPR RNA endonuclease has been reported to be used in the detection of transgenic components in plants. Because the CRISPR DNA endonuclease reporter assay detects DNA sequences, its reaction system has higher stability, making it easier to integrate with traditional PCR, isothermal amplification, and other detection techniques in plant gene detection. Summary of the Invention
[0003] To fully utilize the advantages of CRISPR DNA endonuclease detection technology and fill the gap in plant gene detection using Cas12a-based in vitro nucleic acid detection technology, this invention utilizes the Cas12a enzyme to detect DNA components in transgenic plants, providing a new technology and method for the detection of transgenic plants.
[0004] Specifically, this invention provides a method for detecting transgenic components based on CRISPR Cas enzyme gene editing technology, comprising the following steps:
[0005] Step S1: Extract plant DNA using the CTAB method;
[0006] Step S2: Prepare RPA isothermal amplification primers for DNA;
[0007] Step S3: Construct the reaction system as follows: Each part of the reaction system includes the following components by volume: 2 parts of 10xNE buffer 2.1, 1 part of 1uM guide and folding sequence, 1 part of 1uM Lba Cas12a, 1 part of RNase inhibitor, 1 part of RPA isothermal amplification product of transgenic plant DNA extract, 1 part of reaction marker and 13 parts of water;
[0008] Step S4: Detect the plant transgenic component using methods including but not limited to microplate readers, quantitative PCR instruments, or colorimetric strip techniques; this method is used to detect the plant transgenic component HPT gene, and the primers are as follows:
[0009] RPA-HPT2-F GTCTGCTGCTCCATACAAGCCAACCACGG RPA-HPT2-R CTGGCAAACTGTGATGGACGACACCGTCAG
[0010] The guiding and folding sequences are as follows: The bolded sequence is the guiding sequence;
[0011] LbCas12a-HPT2 5-UAAUUUCUACUAAGUGUAGAUGGCUCCAACAAUGUCCUGACGGA-3 LbCas12a-HPT1 5-UAAUUUCUACUAAGUGUAGAUAGCUUCGAUGUAGGAGGGCGUGG-3
[0012] The guide and folding sequences were thiolated, as detailed below:
[0013]
[0014] Step S2 includes the following steps:
[0015] Step S21: Mix the following components by volume: 2.2-2.5 parts first primer, 2.2-2.5 parts second primer, 29-20 parts primer-free rehydration buffer, 2 parts DNA extracted in step S1, and 11-12 parts water.
[0016] Step S22: Mix all the components from step S21 and centrifuge briefly;
[0017] Step S23: Add the obtained mixture to the TwistAmp Basic reaction mixture and mix well;
[0018] Step S24: Add 2.5 parts by volume of 280mM MgOAc and mix well.
[0019] Step S25: React at 38-40 degrees Celsius for 20 minutes;
[0020] Step S26: Store at -20 degrees Celsius for later use.
[0021] Among them, the reaction markers detected by the ELISA reader are selected from S2 or S4. The labeling method is: single-stranded DNA molecules containing TAT base sequences with FAM and BHQ1 groups at both ends, respectively. S2 is 5`6-FAM-TTAT-3`BHQ1, and S4 is 5`6-FAM-TAT-3`BHQ1.
[0022] The reaction marker detected by the test strip is selected from S3. The labeling method is: a single-stranded DNA molecule containing a TAT base sequence 5`6-FAM-TAT-Biotin-3` with FAM and Biotin groups at both ends, respectively.
[0023] The reaction markers detected by the quantitative PCR instrument were selected from S5. The labeling method was: a single-stranded DNA molecule containing the TAT base sequence 5`6-FAM-TTATT-3`BHQ1 with FAM and Biotin groups at both ends.
[0024] The transgenic component detection method based on CRISPR Cas enzyme gene editing technology provided by this invention offers a new technology and method for nucleic acid detection in transgenic plants, which will surely promote the application research of gene editing detection technology in plant nucleic acid detection and has important practical significance. Attached Figure Description
[0025] Figure 1 Comparison of the detection efficiency of the Cas12a fluorescence detection system for the hygromycin gene in transgenic plants using the HPT1 and HPT2 splicing sites and the labeling methods S2 and S4;
[0026] Figure 2 The graph shows the difference in reaction intensity at different times for the detection efficiency of the Cas12a fluorescence detection system against the hygromycin gene in transgenic plants at the splicing sites HPT1 and HPT2 and the labeling methods S2 and S4.
[0027] Figure 3 Results of detection of CaMV 35S initiation factor in transgenic plants using the Cas12a fluorescence detection system;
[0028] Figure 4 : Graph showing the difference in reaction intensity of CaMV35S initiator factor between positive plant expression vectors and DNA amplification products at different time points detected by the Cas12a fluorescence detection system;
[0029] Figure 5 Results of detection of Bar gene components in transgenic plants using the Cas12a fluorescence detection system;
[0030] Figure 6 : Graph showing the difference in reaction intensity of the Bar gene in positive plant expression vectors and DNA amplification products at different time points detected by the Cas12a fluorescence detection system;
[0031] Figure 7 Results of HPT gene component detection in transgenic plants using the Cas12a fluorescence detection system;
[0032] Figure 8 : Graph showing the difference in reaction intensity of HPT gene between positive plant expression vector and DNA amplification product at different time points detected by Cas12a fluorescence detection system;
[0033] Figure 9 Results of NPTⅡ gene component detection in transgenic plants using the Cas12a fluorescence detection system;
[0034] Figure 10 : Graph showing the difference in reaction intensity of NPTⅡ gene between positive plant expression vector and DNA amplification product at different time points detected by Cas12a fluorescence detection system;
[0035] Figure 11 Comparative results of the effects of thio-modification and methylation modification on the efficiency of hygromycin gene detection in the Cas12a fluorescence detection system;
[0036] Figure 12 The Cas12a fluorescence detection system was used to detect the color development of test strips for the CaMV 35S promoter factor in transgenic plants.
[0037] Figure 13 The Cas12a fluorescence detection system was used to detect the color development of test strips for the Bar gene in transgenic plants.
[0038] Figure 14 The Cas12a fluorescence detection system was used to detect the color development of test strips for the HPT gene in transgenic plants.
[0039] Figure 15 The Cas12a fluorescence detection system was used to detect the color development of test strips for the NPTⅡ gene in transgenic plants.
[0040] Figure 16 The results of quantitative real-time PCR detection of CaMV 35S promoter, Bar gene, HPT gene and NPTⅡ gene in transgenic plants using the Cas12a fluorescence detection system. Detailed Implementation
[0041] To gain a better understanding of the technical solution and beneficial effects of the present invention, the technical solution of the present invention and its beneficial effects are described in detail below with reference to the accompanying drawings.
[0042] The purpose of this invention is to provide highly efficient RPA isothermal amplification primers and corresponding highly efficient detection sites for Cas12a enzyme gene editing detection technology in plant materials containing transgenic components such as CaMV35S promoter, hygromycin gene, Bar gene, and NPT II gene. The invention utilizes ELISA readers, quantitative PCR instruments, and colorimetric strip technology to detect the target transgenic components, thus establishing a new detection system for the detection of transgenic components in plants.
[0043] I. Construction of the reaction system
[0044] To achieve the above objectives, the technical solution of the present invention is as follows: providing RPA isothermal amplification primers and reaction systems for plant materials containing plant transgenic components such as CaMV 35S promoter, HPT gene, Bar gene, and NPTII gene, as well as high-efficiency detection sites and reaction systems for the corresponding amplification segments of Cas12a enzyme. The sequence information of the RPA isothermal amplification primers and high-efficiency detection sites has the nucleotide sequences shown in Sequence Listing 1 and Table 2, respectively.
[0045] Table 1: Primers for isothermal amplification of target genes
[0046]
[0047]
[0048] Table 2: LbCas12a crRNA-Target guide and folding sequences, with the bolded sequence being the guide sequence.
[0049] LbCas12a-HPT2 5-UAAUUUCUACUAAGUGUAGAUGGCUCCAACAAUGUCCUGACGGA-3 LbCas12a-HPT1 5-UAAUUUCUACUAAGUGUAGAUAGCUUCGAUGUAGGAGGGCGUGG-3 LbCas12a-Bar 5-UAAUUUCUACUAAGUGUAGAUUggcagcUggacUUcagccUgcc-3 LbCas12a-35s 5-UAAUUUCUACUAAGUGUAGAUcUUUaUcgcaaUgaUggcaUUUg-3 LbCas12a-NPTII 5'-UAAUUUCUACUAAGUGUAGAUGCUUGGUGGUCGAAUGGGCAGGU-3'
[0050] The specific reaction method is as follows:
[0051] 1. Plasmids were extracted using the alkaline lysis method, and plant DNA was extracted using the CTAB method.
[0052] 2. RPA isothermal amplification primers were designed before and after the target detection sites of genes such as CaMV 35S promoter, HPT, Bar gene, and NPTII. Primer pairs are shown in Table 1.
[0053] RPA method (TwisAmp™ Basic Kit TwistDx reagent):
[0054] (1) Add to a 1.5ml centrifuge tube
[0055]
[0056] (2) Mix well and centrifuge briefly;
[0057] (3) Add the mixture to the TwistAmp Basic reaction mixture and mix well.
[0058] (4) Add 2.5 μl of 280 mM MgOAc and mix well.
[0059] (5) 39℃, 20min
[0060] (6) Store at -20℃ for further testing.
[0061] 3. Enzyme detection reaction system [EnGen Lba Cas12a(Cpf1) (BioLabs) enzyme reaction system]:
[0062] Add to a 20 μl centrifuge tube
[0063]
[0064] The differences between the reaction systems of ELISA reader, quantitative PCR instrument, and test strip are mainly in the selection of reaction markers and the different labeling methods, which will be detailed below.
[0065] 4. Detection methods and result analysis
[0066] (1) ELISA reader detection
[0067] The Synergy H1 multi-functional microplate analyzer, manufactured by BioTek Instruments, Inc., was used. The reaction was carried out at 37°C for 1 hour, and the fluorescence value was measured every 5 minutes.
[0068] Detection and statistical methods: The ratio of fluorescence values at 0 min for each reaction was used to calculate the ratio of fluorescence values every 5 min. The reaction design had 3 replicates. The detection reaction curve was plotted using Excel software, and the significance of differences was analyzed using the Duncan multiple range method of the DPS data analysis system.
[0069] The reaction markers are selected from S2 or S4. The labeling method is as follows: single-stranded DNA molecules containing TAT base sequences with FAM and BHQ1 groups at both ends, respectively. S2 is 5`6-FAM-TTAT-3`BHQ1, and S4 is 5`6-FAM-TAT-3`BHQ1.
[0070] (2) Test strip detection
[0071] The test strip reaction system was incubated at 37℃ for 5, 15, and 30 minutes. 5 μl of the reaction solution was then diluted with 100 μl of purified water for color development of the test strip (Shunfeng Gene Editing Company product). The color development of the test strip was observed after 3 minutes.
[0072] The reaction marker was selected from S3, and the labeling method was: a single-stranded DNA molecule containing a TAT base sequence 5`6-FAM-TAT-Biotin-3 with FAM and Biotin groups at both ends.
[0073] (3) Quantitative PCR instrument detection
[0074] The fluorescence PCR instrument used was an ABI QuantStudio 6 with the FAM channel, and fluorescence was collected every 1 minute. The reaction label was selected from S5, and the labeling method was: a single-stranded DNA molecule containing the TAT base sequence 5`6-FAM-TTATT-3`BHQ1 with FAM and Biotin groups at both ends, respectively.
[0075] II. ELISA reader detection methods
[0076] 1. Selection of reaction markers
[0077] In this embodiment, the effects of different report sequences and different labeling methods S2 and S4 on the detection efficiency of the microplate reader are verified.
[0078] Using hygromycin-positive rice DNA amplification products as the detection target, four detection reaction combinations were formed by two different cleavage sites of hygromycin (HPT1, HPT2) and two reporter reaction markers (S2, S4): HPT1+S2, HPT1+S4, HPT2+S2, and HPT2+S4. The detection results showed that... Figure 1 In the Cas12a fluorescence detection system, different marker methods for the detection report sequence have a significant impact on the intensity of the detection response. The S4 marker method is superior to the S2 marker method, especially for high-efficiency cleavage sites, where the S4 marker method has a very significant advantage.
[0079] Figure 1 In the middle, the four curves from top to bottom represent the mean results of the following combinations: HPT2+S4 positive, HPT1+S4 positive, HPT1+S2 positive, and HPT2+S2 positive; the four curves below represent the mean results of HPT2+S4 negative, HPT1+S4 negative, HPT1+S2 negative, and HPT2+S2 negative.
[0080] The significance of differences was analyzed at 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, and 60 min to determine the strength of positive detection reactions in different combinations. The results showed ( Figure 2(Table 3) After 5 min of reaction, the reaction of the S4 marker (HPT1+S4, HPT2+S4) was significantly higher than that of the S2 marker (HPT1+S2, HPT2+S2). For the S4 reaction, the reaction at the HPT2 cleavage point was significantly higher than that at the HPT1 cleavage point. For the S2 reaction, there was no significant difference between the HPT1 and HPT2 cleavage points. After 10 min of reaction, the HPT2+S4 reaction was significantly higher than that of HPT1+S4, and significantly higher than that of HPT1+S2 and HPT2+S2. There was no significant difference between PT1+S2 and HPT2+S2, nor between HPT1+S4 and HPT2+S2. At 15 and 20 min of reaction time, the HPT2+S4 reaction was significantly higher than other reactions, and HPT1+S4 was significantly higher than HPT1+S2, while there was no significant difference between HPT1+S2 and HPT2+S2. After 25 min of reaction time, the HPT2+S4 reaction was significantly higher than other reactions, while there was no significant difference between HPT1+S4, HPT1+S2, and HPT2+S2. Overall, the HPT2+S4 reaction showed the highest detection level. HPT2 is a more efficient detection site than HPT1, and S4 is a more efficient reporter reaction labeling method than S2. Furthermore, S4 has a greater advantage in detecting efficient cleavage sites.
[0081] Figure 2 In the figure, the bar charts at each time point correspond to the experimental results of HPT1+S2, HPT1+S4, HPT2+S2, and HPT2+S4 from left to right.
[0082] Therefore, in sections 2-5 below, when using an ELISA reader to edit and detect transgenic materials, the S4 detection report reaction labeling method should be selected as the reaction system.
[0083] Table 3. Analysis of reaction intensity differences in the detection of hygromycin-positive rice DNA amplification products using the Cas12a fluorescence detection system at 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, and 60 min, when different splicing sites (HPT-1 and HPT-2) were combined with different reporter sequence marker methods (S2 and S4).
[0084]
[0085]
[0086]
[0087] Note: Data were analyzed using Duncan's new complex range method. a, b, c represent significant differences between reaction systems, and A, B, C represent highly significant differences between reaction systems.
[0088] 2. Microplate reader detection of CaMV 35S promoter in transgenic plants
[0089] Using non-GMO maize and papaya DNA as negative controls and plant expression vectors with the CaMV 35S promoter as positive controls, detection experiments were conducted using 5% positive maize DNA, 100% positive maize DNA, isothermal amplification of maize positive DNA, 5% positive papaya DNA, 100% positive papaya DNA, and isothermal amplification products of papaya positive DNA as detection targets. The results showed that under the Cas12a fluorescence detection system, only positive plant expression vectors, isothermal amplification of maize positive DNA, and isothermal amplification products of papaya positive DNA produced detectable fluorescent reporter reactions within the detection time. Water, blank, negative, 5% positive maize DNA, 100% positive maize DNA, 5% positive papaya DNA, and 100% positive papaya DNA did not directly induce detectable fluorescent reporter reactions. Figure 3 (Where, 5% and 100% represent the mass content of positive samples in the tested samples, and the same applies below.)
[0090] Specifically, Figure 3 In the graph, the horizontal axis represents the detection time (min), and the vertical axis represents the fluorescence ratio. The top three curves, from top to bottom, represent the detection curves of papaya DNA isothermal amplification products, maize DNA isothermal amplification products, and plant expression vectors with CaMV 35S promoters (i.e., positive plasmids), respectively. The remaining seven curves represent maize 5% positive DNA, maize 100% positive DNA, papaya 5% positive DNA, papaya 100% positive DNA, negative control, blank control, and water control, respectively. Furthermore, no detection values were found on the remaining seven curves throughout the entire detection period.
[0091] The isothermal amplification products of positive plant expression vectors, maize positive DNA, and papaya positive DNA that elicited detection responses were analyzed for significant differences at 0, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, and 60 min. The results showed that ( Figure 4(Table 4) At 5 min of reaction, there was no significant difference among the three. At 10 and 15 min of reaction, the papaya isothermal amplification products showed a 10% significant difference and an extremely significant difference, respectively. After 20 min of reaction, the isothermal amplification products showed extremely significant differences compared with the plasmid, and the isothermal amplification products showed a stronger reaction than the plasmid. During 20 and 25 min of reaction, the three reactions showed extremely significant differences, with the reaction strength in the order of papaya positive isothermal amplification products > maize positive isothermal amplification products > positive plant expression vector. At 30, 35, and 40 min of reaction, the significance of the difference between papaya positive isothermal amplification products and maize positive isothermal amplification products decreased, with a 5% significant difference, a 10% significant difference, and no significant difference, respectively. After 40 min of reaction, there was no significant difference in the reaction strength among the isothermal amplification products.
[0092] Figure 4 In the bar charts at each time point, from left to right, they correspond to: positive plant expression vectors, positive isothermal amplification products of maize, and positive isothermal amplification products of papaya.
[0093] Experimental results show that plasmids extracted by alkaline lysis can directly induce a detection reaction, while plant DNA extracted by CTAB method cannot induce a detection reaction, but the target amplification product of plant DNA can induce a detection reaction. In terms of the overall reaction, the detection reaction intensity induced by the amplification product is significantly greater than that induced by the plasmid. There are some differences in the reaction intensity among the amplification products, but as the reaction time is extended, the differences become insignificant after 40 minutes.
[0094] Table 4. Analysis of the difference in reaction intensity between positive plant expression vectors and positive DNA amplification products from maize and papaya at 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, and 60 min using the CaMV 35S promoter component Cas12a fluorescence detection system.
[0095]
[0096]
[0097]
[0098] Note: Data were analyzed using Duncan's new complex range method. a, b, c represent significant differences between reaction systems, and A, B, C represent highly significant differences between reaction systems.
[0099] 3. ELISA reader detection of Bar gene loci in transgenic plants
[0100] Using non-GMO maize, soybean, and rice DNA as negative controls and a plant expression vector containing the Bar gene as a positive control, detection experiments were conducted using 100% positive maize DNA, isothermal amplification of maize positive DNA, 100% positive soybean DNA, isothermal amplification products of soybean positive DNA, 100% positive rice DNA, and isothermal amplification products of rice positive DNA as detection targets. The results show that under the Cas12a fluorescence detection system, only positive plant expression vectors and isothermal amplification products of positive maize, soybean, and rice DNA produced detectable fluorescent reporter reactions within a short time. Water, blank, negative, and 100% positive maize, 100% positive soybean, and 100% positive rice DNA did not directly induce detectable fluorescent reporter reactions. Figure 5 ).
[0101] Specifically, Figure 5 In the graph, the horizontal axis represents the detection time (min), and the vertical axis represents the fluorescence ratio. The top four curves, from top to bottom, represent the detection curves of maize DNA isothermal amplification products, rice DNA isothermal amplification products, soybean DNA isothermal amplification products, and plant expression vectors containing the Bar gene (i.e., positive plasmids), respectively. The remaining six curves represent 100% positive DNA from maize, 100% positive DNA from rice, 100% positive DNA from soybean, negative control, blank control, and water control, respectively. Furthermore, the remaining four curves did not show any detection values throughout the entire detection period.
[0102] The isothermal amplification products of positive plant expression vectors, maize, rice, and soybean DNA that induced detection reactions were analyzed for significant differences at 0, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, and 60 min. The results showed that... Figure 6 (Table 5) Before 50 min, there were no highly significant differences in the reaction intensity of the four reactions; at 55 and 60 min, only the reaction intensity between the positive isothermal amplification product and the positive plasmid in maize reached a highly significant difference, while the reaction intensity between the positive isothermal amplification products and plasmids in rice and soybean was not significant, and the reaction intensity among the isothermal amplification products showed slight differences, but these differences were not significant. Figure 6 ).
[0103] Figure 6 In the bar charts at each time point, from left to right, they correspond to: positive plant expression vectors, maize positive isothermal amplification products, soybean positive isothermal amplification products, and rice positive isothermal amplification products, respectively.
[0104] Experimental results showed that plasmids extracted by alkaline lysis could directly induce a detection reaction, while plant DNA extracted by CTAB method could not induce a detection reaction, but the target amplification products of plant DNA could induce a detection reaction. Overall, the detection reaction induced by the amplification products was slightly stronger than that induced by the plasmids, but there was no significant or highly significant difference.
[0105] Table 5. Analysis of the difference in reaction intensity between positive plant expression vectors and positive DNA amplification products from maize, soybean, and rice at 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, and 60 min using the Cas12a fluorescence detection system for Bar gene components.
[0106]
[0107]
[0108]
[0109]
[0110] Note: Data were analyzed using Duncan's new complex range method. a, b, c represent significant differences between reaction systems, and A, B, C represent highly significant differences between reaction systems.
[0111] 4. Detection of HPT gene loci edited by microplate reader in transgenic plants
[0112] Using non-GMO rice and foxtail grass DNA as negative controls, and a plant expression vector containing the HPT gene as a positive control, detection experiments were conducted using 100% positive rice DNA, isothermal amplification products of positive rice DNA, 100% positive foxtail grass DNA, and isothermal amplification products of positive foxtail grass DNA as detection targets. The results show that under the Cas12a fluorescence detection system, only the positive plant expression vector, isothermal amplification of positive rice DNA, and isothermal amplification products of positive foxtail grass DNA produced detectable fluorescent reporter reactions within the detection time. Water, blank, negative, 100% positive rice DNA, and 100% positive foxtail grass DNA did not directly induce detectable fluorescent reporter reactions. Figure 7 ).
[0113] Specifically, Figure 7In the graph, the horizontal axis represents the detection time (min), and the vertical axis represents the fluorescence ratio. The top three curves, from top to bottom, represent the isothermal amplification products of rice DNA, the isothermal amplification products of foxtail grass positive DNA, and the plant expression vector (i.e., positive plasmid), respectively. The remaining five curves represent 100% positive DNA of rice, 100% positive DNA of foxtail grass, negative control, blank control, and water control, respectively. Furthermore, no detection values were found on the remaining five curves throughout the entire detection period.
[0114] The isothermal amplification products of positive plant expression vectors, rice positive DNA, and foxtail grass positive DNA that elicited detection responses were analyzed for significant differences at 0, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, and 60 min. The results showed that... Figure 8 (Table 6) At 5 min of reaction, there was a highly significant difference among the three. Within the detection time range (60 min), the reaction intensity of the isothermal amplification product was consistently highly significantly higher than that of the positive plasmid. The rice amplification product was highly significantly higher than that of the foxtail grass amplification product before 20 min of reaction, but there was no significant difference after 25 min. The overall reaction intensity was: rice isothermal amplification product > foxtail grass isothermal amplification product > positive plant expression vector.
[0115] Figure 8 In the bar charts at each time point, from left to right, they correspond to: positive plant expression vectors, positive isothermal amplification products of foxtail grass, and positive isothermal amplification products of rice.
[0116] Experimental results show that plasmids extracted by alkaline lysis can directly induce a detection reaction, while plant DNA extracted by CTAB method cannot induce a detection reaction, but the target amplification product of plant DNA can induce a detection reaction. In terms of the overall reaction, the detection reaction intensity induced by the amplification product is significantly greater than that induced by the plasmid. There are some differences in the reaction intensity among the amplification products, but as the reaction time is extended, the differences become insignificant after 20 minutes.
[0117] Table 6. Analysis of the difference in reaction intensity between positive plant expression vectors and positive DNA amplification products from rice and foxtail millet at 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, and 60 min using the Cas12a fluorescence detection system (HPT2 cut site).
[0118]
[0119]
[0120]
[0121] Note: Data were analyzed using Duncan's new complex range method. a, b, c represent significant differences between reaction systems, and A, B, C represent highly significant differences between reaction systems.
[0122] 5. Detection of NPTII gene locus editing in transgenic plants using an enzyme-linked immunosorbent assay (ELISA) reader.
[0123] Using non-GMO maize and papaya DNA as negative controls, and a plant expression vector containing the NPTII gene as a positive control, detection experiments were conducted using 100% positive maize DNA, isothermal amplification products of maize DNA, 100% positive papaya DNA, and isothermal amplification products of papaya DNA as detection targets. The results show that under the Cas12a fluorescence detection system, only positive plant expression vectors, isothermal amplification of maize DNA, and isothermal amplification products of papaya DNA produced detectable fluorescent reporter reactions within the detection time. Water, blank, negative, 100% positive maize DNA, and 100% positive papaya DNA did not directly induce detectable fluorescent reporter reactions. Figure 9 ).
[0124] Specifically, Figure 9 In the graph, the horizontal axis represents the detection time (min), and the vertical axis represents the fluorescence ratio. The top three curves, from top to bottom, represent the isothermal amplification products of maize DNA, the isothermal amplification products of papaya positive DNA, and the plant expression vector (i.e., positive plasmid), respectively. The remaining five curves represent 100% positive DNA from maize, 100% positive DNA from papaya, the negative control, the blank control, and the water control, respectively. Furthermore, no detection values were found on the remaining five curves throughout the entire detection period.
[0125] The isothermal amplification products of positive plant expression vectors, maize positive DNA, and papaya positive DNA that elicited detection responses were analyzed for significant differences at 0, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, and 60 min. The results showed that... Figure 10 (Table 7) The differences among the three were not significant. Within the detection time range (60 min), only at 50 min were the positive amplification products of maize and papaya significantly higher than those of the positive plasmid; at other times, the differences among the three were not significant. Overall reaction intensity: maize isothermal amplification product > papaya isothermal amplification product > positive plant expression vector.
[0126] Figure 10 In the bar charts at each time point, from left to right, they correspond to: maize positive isothermal amplification products, papaya positive isothermal amplification products, and positive plant expression vectors, respectively.
[0127] Experimental results show that plasmids extracted by alkaline lysis can directly induce a detection reaction, while plant DNA extracted by CTAB method cannot induce a detection reaction, but the target amplification product of plant DNA can induce a detection reaction. In terms of overall reaction, the detection reaction intensity induced by the amplification product is slightly higher than that induced by the plasmid, but the difference is not significant. There are some differences in reaction intensity among the amplification products, but the difference becomes insignificant as the reaction time increases.
[0128] Table 7. Analysis of the difference in reaction intensity between positive plant expression vectors and positive DNA amplification products from maize and papaya at 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, and 60 min using the Cas12a fluorescence detection system for NPTII gene components.
[0129]
[0130]
[0131]
[0132] Note: Data were analyzed using Duncan's new complex range method. a, b, c represent significant differences between reaction systems, and A, B, C represent highly significant differences between reaction systems.
[0133] 6. The effect of guide and folding sequence modifications on detection response
[0134] Since both crRNA and sgRNA are RNA, their in vitro stability is not strong. To improve the stability of the detection reaction, the study attempted to modify the crRNA-target RNA sequence by methylation and thiolation (Table 8). The experimental results showed that the methylated complex structure could not function properly, and the thiolation modification did not significantly differ from the unmodified one in detection efficiency in the initial detection. Figure 11 ).
[0135] Specifically, Figure 11 In the diagram, the two upper curves represent unmodified crRNA-Target RNA sequences and thiolated crRNA-Target RNA sequences, while the lower curve represents methylated crRNA-Target RNA sequences.
[0136] Table 8. Specific details regarding the use of thio-modified or methylated crRNA-Target sequences in the Cas12a fluorescence detection system.
[0137]
[0138] The thiolated crRNA-target RNA and unmodified crRNA-target RNA sequences were stored at 4℃ and detected after 1, 2, 3, 5, 7, 9, 11, 13, 15, 17, 19, 23, and 30 days, with a reaction time of 60 min. The results showed that there was no significant difference in reaction strength between thiolated and unmodified crRNAs from 1 to 9 days, but there were significant differences in reaction strength between thiolated and unmodified crRNAs from 11 to 30 days, and the thiolated crRNAs showed greater reaction strength than the unmodified crRNAs. This indicates that thiolation has a good promoting effect on improving the stability of the editing detection.
[0139] Table 9. Analysis of the difference in reaction intensity detected by the Cas12a fluorescence detection system when using thiomodified sgRNA and unmodified sgRNA for 1, 2, 3, 5, 7, 9, 11, 13, 15, 17, 19, 23, and 30 days.
[0140]
[0141]
[0142] Note: Data were analyzed using Duncan's new complex range method. a, b, c represent significant differences between reaction systems, and A, B, C represent highly significant differences between reaction systems.
[0143] III. Colorimetric Detection Method Using Test Strips
[0144] As described above, after incubating the test strip reaction system at 37℃ for 5, 15, and 30 minutes, take 5 μl of the reaction solution and dilute it with 100 μl of purified water to develop the color of the test strip (a product of Shunfeng Gene Editing Company). Observe the color development of the test strip after 3 minutes.
[0145] The test strip is selected from flow immunochromatographic test strips. The flow immunochromatographic test strip has, in sequence, a sample loading area, a Gold-NP anti-FITC antibody zone, a strepavidin band (i.e., a control band), and an anti-antibody band (i.e., a detection band). In the reaction system, the S sequence binds to the antibody via the Gold-NP anti-FITC antibody zone. The control band binds to the biotin at the 3' end of the S sequence, resulting in color development. In positive samples, the cleaved FAM at the 5' end of the S sequence continues to ascend and binds to the anti-antibody, resulting in color development of the detection band. In negative samples, the S sequence is intercepted by the control band, and the detection band does not develop.
[0146] Figure 12In the middle, from left to right, are the negative control and the color development of the transgenic plant DNA isothermal amplification products with CaMV 35S promoter at 5 minutes, 15 minutes, and 30 minutes.
[0147] Figure 13 In the middle, from left to right, are the negative control and the color development of the transgenic plant DNA isothermal amplification products with the Bar gene at 5 minutes, 15 minutes, and 30 minutes.
[0148] Figure 14 In the middle, from left to right, are the negative control and the color development of the transgenic plant DNA isothermal amplification products with HPT gene at 5 minutes, 15 minutes, and 30 minutes.
[0149] Figure 15 In the middle, from left to right, are the negative control and the color development of the transgenic plant DNA isothermal amplification products with the NPTⅡ gene at 5 minutes, 15 minutes, and 30 minutes.
[0150] In this invention, the sample corresponding to the fluorescence color development is the DNA isothermal amplification product.
[0151] IV. PCR Quantitative Detection Method
[0152] As mentioned above, the fluorescence PCR instrument uses the ABI QuantStudio6 FAM channel, and fluorescence is sampled every 1 minute.
[0153] The reaction marker was selected from S5, and the labeling method was 5`6-FAM-TTATT-3`BHQ1.
[0154] The results are as follows Figure 16 As shown: Consistent with the results of the ELISA reader, the selected transgenic originals all exhibited high crRNA target activity.
[0155] Our results show that the Cas12a fluorescence detection system can successfully detect plant DNA in vitro. However, conventionally extracted plant DNA is difficult to directly induce a detection reaction for transgenic components, requiring isothermal amplification or PCR before the detection reaction. The main factors affecting the efficiency of the detection system include: the amplification reaction system, enzyme stability and activity, and the selection of editing sites. Different editing sites have significantly different efficiencies. Establishing an efficient detection system requires designing multiple splicing sites and selecting efficient splicing sites to establish specific detection reactions. The detection report sequence labeling method also affects the detection reaction. For example, the S4 (5`6-FAM-TAT-3`BHQ1) labeling method is superior to the S2 (5`6-FAM-TATT-3`BHQ1) labeling method, especially for the efficient splicing site S4, which has a significant advantage. The stability of the guide RNA also significantly affects the stability of the reaction. Methylation and thiolation of the crRNA-Target RNA sequence can prevent the methylated complex from functioning properly. In the initial detection, thiolation shows no significant difference in detection efficiency compared to the unmodified sequence. However, as the crRNA-Target RNA sequence is stored at 4°C for longer periods, the thiolated reaction is significantly higher than the unmodified reaction in less than two weeks. Therefore, thiolation of the guide RNA can enhance the stability and detection capability of the detection reaction. This study provides new technologies and methods for nucleic acid detection in transgenic plants, which will undoubtedly advance the application of gene editing detection technology in plant nucleic acid detection and has significant practical implications.
[0156] In this invention, the so-called CaMV35S promoter refers to the cauliflower mosaic virus 35S promoter; the so-called HPT gene refers to the hygromycin gene; the so-called Bar gene refers to the dialanylphosphoside resistance gene; and the so-called NPTⅡ gene refers to the neomycin phosphotransferase gene.
[0157] In this invention, CTAB refers to hexadecyltrimethylammonium bromide.
[0158] In this invention, the so-called Primer Free Rehydration buffer refers to RPA primer-free rehydration buffer, which is a commercially available buffer.
[0159] In this invention, the so-called TwistAmp Basic reaction refers to commercially available centrifuge tubes containing lyophilized powder, which are a common material for those skilled in the art to construct isothermal amplification reaction systems.
[0160] In this invention, the so-called Lba Cas12a refers to the Cas12a endonuclease.
[0161] In this invention, the marking methods "S2, S4, S3 and S5" have no special meaning and are merely abbreviations of the corresponding marking methods.
[0162] Although the present invention has been described using the above preferred embodiments, it is not intended to limit the scope of protection of the present invention. Any changes and modifications made by those skilled in the art to the above embodiments without departing from the spirit and scope of the present invention shall still fall within the scope of protection of the present invention. Therefore, the scope of protection of the present invention shall be defined by the claims.
Claims
1. A method for detecting transgenic components based on CRISPR Cas enzyme gene editing technology, characterized in that, Includes the following steps: Step 1): Extract plant DNA using the CTAB method; Step 2): Prepare RPA isothermal amplification primers for DNA; Step 3): Construct the reaction system as follows: Each part of the reaction system includes the following components by volume: 2 parts of 10xNE buffer 2.1, 1 part of 1uM guide and folding sequence, 1 part of 1uM Lba Cas12a, 1 part of RNase inhibitor, 1 part of RPA isothermal amplification product of transgenic plant DNA extract, 1 part of reaction marker and 13 parts of water; Step 4): Detection of plant transgenic components using an ELISA reader; this method is used to detect the HPT gene, a transgenic component of plants. The primers are as follows: , The guiding and folding sequences are as follows: , The guide and folding sequences were thiolated, as follows: ; The reaction markers detected by the ELISA reader were selected from S4. The labeling method was as follows: a single-stranded DNA molecule containing a TAT base sequence with FAM and BHQ1 groups at both ends, respectively. S4 was 5`6-FAM-TAT-3`BHQ1.
2. The method for detecting transgenic components based on CRISPR Cas enzyme gene editing technology as described in claim 1, characterized in that, Step 2) includes the following steps: Step 21): Mix the following components by volume: 2.2-2.5 parts first primer, 2.2-2.5 parts second primer, 29-20 parts primer-free rehydration buffer, 2 parts DNA extracted in step 1), and 11-12 parts water. Step 22): Mix all the components from step 21) thoroughly and centrifuge briefly; Step 23): Add the obtained mixture to the TwistAmp Basic reaction mixture and mix well; Step 24): Add 2.5 parts by volume of 280mM MgOAc and mix well. Step 25): React at 38-40 degrees Celsius for 20 minutes; Step 26): Store at -20 degrees Celsius for later use.
Citation Information
Patent Citations
Detection method based on CRISPR / Cas and nucleic acid test paper and human papilloma virus detection kit
CN111560482A