Phytophthora capsici growth and development regulatory protein pcago1 and coding gene and application thereof

Abstract

The application discloses a growth and development regulating protein PcAGO1 containing ArgoN, PAZ, MID and Piwi domains from Phytophthora capsici and an encoding gene and application thereof. The growth and development regulating protein PcAGO1 has an amino acid sequence shown in SEQ ID No. 2, and the encoding gene has a nucleotide sequence shown in SEQ ID No. 1. The main role of the PcAGO1 protein of the application is necessary for the growth and development of Phytophthora capsici, and after the deletion of the PcAGO1 protein, the mycelium growth speed of Phytophthora capsici is reduced, no sporangium, zoospore and oospore is produced, and the pathogenicity is lost. The gene of the application has high application value in the control of the blight caused by Phytophthora capsici, and the bactericide developed by taking the protein as a target has important practical significance in the control of the occurrence and prevalence of the blight caused by Phytophthora capsici.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the growth and development regulatory protein PcAGO1, containing ArgoN, PAZ, MID and Piwi domains, from Phytophthora capsici, and its encoding gene and applications. Background Technology

[0002] *Phytophthora capsici* is a typical oomycete pathogen belonging to the genus *Phytophthora* in the family Pythaceae, with a wide global distribution. As an important soil-borne pathogen, it has a broad host range, infecting over 70 types of vegetable crops from 26 families, including peppers and tobacco in the Solanaceae family, as well as legumes and cucurbits. *Phytophthora capsici* causes disease in plants from the seedling to fruiting stages, leading to root and stem rot and fruit rot. In severe cases, it causes wilting and even damping-off, significantly impacting crop yield and quality, resulting in substantial economic losses. Zoospores produced by *Phytophthora capsici* sporangia are a crucial source of reinfection, spreading via rainwater, soil, and air currents. After attaching to the host plant surface, zoospores become resting spores, which then germinate and produce mycelium to infect the host. When two mating types are present in the field, heterothallic mating can occur, producing oospores. These oospores are resistant to adverse conditions and, under suitable environmental conditions, can germinate and produce mycelium to infect the host.

[0003] RNA interference (RNAi) is a widespread gene silencing phenomenon induced by double-stranded RNA in organisms, and it can be divided into transcriptional and post-transcriptional levels. Hairpin-structured or double-stranded RNA can be processed by enzymes to form 20-30 bp small RNAs. These small RNAs then form a gene silencing complex with the protein Argonaute (AGO), thereby exercising gene silencing function. RNAi is crucial for the growth and development of organisms; therefore, the core protein AGO, which forms the gene silencing complex, plays a vital role. Furthermore, AGO proteins have been found in the exosomes of plants and pathogens, revealing their key biological functions in plant immunity and pathogenicity. If the production of zoospores and oospores of *Phytophthora capsici* can be disrupted, and the mycelial growth rate reduced, further inhibiting the pathogenicity of the pathogen, the normal disease cycle of *Phytophthora capsici* can be blocked, thereby controlling the spread of plant diseases caused by *Phytophthora capsici*. Summary of the Invention

[0004] Based on this, the inventors' research revealed the existence of a growth and development regulatory protein, PcAGO1, in *Phytophthora capsici*, containing the conserved AGO protein domains ArgoN, PAZ, MID, and Piwi. This growth and development regulatory protein is closely related to the mycelial growth rate, sporangium production and morphology, and the number of zoospores and oospores in *Phytophthora capsici*, and is also associated with its pathogenicity. Therefore, by controlling the growth and development regulatory protein PcAGO1, normal infection of *Phytophthora capsici* can be blocked, thereby controlling (inhibiting or blocking) the large-scale spread and epidemic of *Phytophthora capsici* disease.

[0005] Therefore, the present invention provides a growth and development regulatory protein containing ArgoN, PAZ, MID and Piwi domains from *Phytophthora capsici*, named PcAGO1, which is as follows: A1) or A2) or A3) or A4):

[0006] A1) The amino acid sequence is that of the protein shown in SEQ ID NO.2;

[0007] A2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of a protein as shown in SEQ ID NO.2;

[0008] A3) Proteins derived from the protein shown in SEQ ID NO.2 that have the same function, obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO.2;

[0009] A4) An amino acid sequence that has a similarity of 75% or more, preferably 85% or more, and more preferably 95% or more to the amino acid sequence shown in SEQ ID NO.2, and has the same function as the amino acid sequence shown in SEQ ID NO.2.

[0010] To facilitate the purification of the protein in A1), a fusion protein can also be obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID No. 2; the tag can be a Poly-Arg (RRRRR), Poly-His (HHHHHH), FLAG (DYKDDDDK), Strep-tag II (WSHPQFEK), c-myc (EQKLISEEDL), etc.

[0011] The growth and development regulatory proteins in A1)-A4) above are generally derived from Phytophthora capsici, the pathogen of capsici, in nature. In other words, they are generally natural products, but can also be artificially expressed or synthesized. Alternatively, their encoding genes can be synthesized first, followed by biological expression. The encoding genes for the proteins in A2)-A4) above can be obtained by deleting one or more amino acid residues from the codons in the DNA sequence shown in SEQ ID NO. 2 of the sequence listing, and / or by performing a missense mutation on one or more nucleotide pairs, and / or by attaching the coding sequence of the aforementioned tag to its 5' end and / or 3' end. SEQ ID NO. 2 (PcAGO1) in the sequence listing consists of 933 amino acid residues.

[0012] A second objective of this invention is to provide a nucleic acid molecule encoding the PcAGO1 protein containing ArgoN, PAZ, MID, and Piwi domains. The nucleic acid molecule may be DNA, such as cDNA, genomic DNA, or recombinant DNA; or it may be RNA, such as mRNA, hnRNA, or tRNA.

[0013] The gene encoding the PcAGO1 protein is either B1) or B2) or B3):

[0014] B1) The DNA molecule represented by the nucleotide sequence described in SEQ ID NO.1 of the sequence listing;

[0015] B2) has 75% or more, 85% or more, or 95% or more identity with the nucleotide sequence shown in B1) and encodes the above-mentioned PcAGO1 protein cDNA molecule or DNA molecule.

[0016] B3) hybridizes under stringent conditions with the nucleotide sequence defined by B1) or B2) and encodes the aforementioned PcAGO1 protein as a cDNA molecule or DNA molecule. For example, in this invention, the DNA sequence of the growth and development regulatory protein includes the DNA sequence of growth and development regulatory proteins present in different strains of Phytophthora capsici (e.g., Phytophthora capsici LT1534 strain).

[0017] In this invention, the DNA sequence (encoding gene and cDNA) of the pathogenic regulatory protein can be specifically shown as SEQ ID No. 2. SEQ ID NO. 1 in the sequence listing consists of 2799 nucleotides, and nucleotides 1-2799 from the 5' end of sequence 1 are the coding sequence, encoding the protein (PcAGO1) shown in SEQ ID NO. 2 in the sequence listing.

[0018] The third aspect of this invention provides an RNA sequence transcribed from any of the above DNA sequences. Preferably, the sequence of the RNA molecule is as follows (C1) or (C2):

[0019] C1) An RNA sequence transcribed from a DNA sequence as shown in SEQ ID NO.1 has a similarity of 75% or more, more preferably 85% or more, and more preferably 95% or more, and has the same function as an RNA sequence transcribed from a DNA sequence as shown in SEQ ID NO.1 or SEQ ID NO.1.

[0020] C2) The most preferred RNA sequence is an RNA sequence transcribed from the DNA sequence shown in SEQ ID NO.1.

[0021] The fourth invention provides biological materials related to the above-mentioned growth and development regulatory proteins, encoding genes, or RNA molecules, which are any one of the following D1) to D10):

[0022] D1) An expression cassette containing the gene encoding as described in claim 2;

[0023] D2) A recombinant vector containing the encoding gene of claim 2, or a recombinant vector containing the expression cassette of D1);

[0024] D3) A recombinant microorganism containing the encoding gene of claim 2, or a recombinant microorganism containing the expression cassette of D1), or a recombinant microorganism containing the recombinant vector of D2;

[0025] D4) A transgenic plant cell line containing the encoding gene of claim 2, or a transgenic plant cell line containing the expression cassette of D1);

[0026] D5) Transgenic plant tissue containing the encoding gene of claim 2, or transgenic plant tissue containing the expression cassette of claim 2;

[0027] D6) A transgenic plant organ containing the encoding gene of claim 2, or a transgenic plant organ containing the expression cassette of claim 2;

[0028] D7) A nucleic acid molecule that inhibits the expression of the gene encoding the claim 2; preferably, the nucleic acid molecule is a nucleic acid molecule that knocks out the gene encoding the claim 2, or a nucleic acid molecule that silences the gene encoding the claim 2, or it may be an sgRNA fragment that encodes the gene to be knocked out, such as the sgRNA sequence (coding sequence) GAATTTGAAGGACATGGTGG targeting the PcAGO1 gene.

[0029] D8) Expression cassettes, recombinant vectors, recombinant microorganisms, or transgenic plant cell lines containing or expressing the nucleic acid molecules described in D7). The recombinant vector may include a CRISPR / Cas9-based gene knockout method, which uses a Donor vector for the target gene and an sgRNA and Cas9 protein expression plasmid. The Donor vector is a recombinant vector containing, sequentially linked, an 800-1500 bp sequence upstream of the target gene to be knocked out, a Doodor DNA sequence (which may be an NPTII, GFP, or RFP gene sequence, etc.), and an 800-1500 bp sequence downstream of the target gene to be knocked out. The sgRNA and Cas9 protein co-expression plasmid is a vector encoding an sgRNA fragment targeting the target gene to be knocked out and a DNA sequence expressing the Cas9 protein. The target gene to be knocked out is the PcAGO1 gene, and the sgRNA sequence (coding sequence) targeting the PcAGO1 gene is GAATTTGAAGGACATGGTGG. Preferably, the sgRNA and Cas9 co-expression plasmid is obtained by using the pYF515 vector as the starting vector, inserting the double-stranded sgRNA coding sequence obtained by annealing the sgRNA of the PcAGO1 gene between the Nhe I and Bsa I enzyme recognition sites of the pYF515 vector.

[0030] D9) Nucleic acid molecules that inhibit the translation of the RNA molecule as described in claim 3;

[0031] D10) Expression cassettes, recombinant vectors, recombinant microorganisms, or transgenic plant cell lines containing or expressing the nucleic acid molecules described in D9).

[0032] The fifth objective of this invention is to provide the application of the aforementioned growth and development regulatory protein and its encoding gene, or the RNA molecule of claim 3, or the biological material of claim 4, in controlling the complete pathogenicity of oomycetes; preferably, the oomycete is Phytophthora capsici, most preferably Phytophthora capsici LT1534.

[0033] The application is any one or more of the following E1)-E6):

[0034] E1) Application in regulating (reducing) the growth rate of Phytophthora capsici mycelium;

[0035] E2) regulates (inhibits) the production of sporangia of Phytophthora capsici;

[0036] Application of E3 in regulating (inhibiting) zoospore production;

[0037] E4) Application in regulating (reducing) the pathogenicity of Phytophthora capsici to the host;

[0038] E5) Application in regulating (reducing) the ability of Phytophthora capsici to infect hosts;

[0039] E6) Application in inhibiting and / or killing Phytophthora capsici.

[0040] Preferably, the application includes the application described in E1)-E6) by inhibiting or inactivating the transcription of the encoding gene described in SEQ ID NO.1, or inhibiting the translation of the RNA molecule, or inhibiting and / or inactivating the activity of the PcAGO1 growth and development regulatory protein in SEQ ID NO.2 of the sequence listing.

[0041] In the aforementioned applications, the production of sporangia and zoospores of Phytophthora capsici is regulated (reduced) by inhibiting the transcription of the coding genes described above, or inhibiting the translation of the RNA sequences described above, or inhibiting and / or inactivating the activity of the PcAGO1 growth and development regulatory protein described above, and / or reducing the mycelial growth rate, and / or reducing the infectivity and / or pathogenicity of the host, thereby inhibiting or killing Phytophthora capsici.

[0042] Preferably, the application involves deleting the PcAGO1 protein shown in Phytophthora capsici SEQ ID NO.2, thereby altering the colony morphology of Phytophthora capsici, and / or slowing down hyphal growth, and / or preventing the production of sporangia and zoospores, and / or reducing pathogenicity.

[0043] The sixth objective of this invention is to provide the application of the PcAGO1 growth and development regulatory protein shown in SEQ ID NO.2 of the sequence listing, the encoding gene shown in SEQ ID NO.1 of the sequence listing, or the aforementioned RNA molecule, or the aforementioned biological material, or the protein or DNA as described in claim 5, as a target for screening antibacterial and / or fungicidal agents against *Phytophthora capsici*. The antibacterial or fungicidal agent can inhibit or inactivate the PcAGO1 growth and development regulatory protein shown in SEQ ID NO.2 of *Phytophthora capsici*, thereby altering the colony morphology of *Phytophthora capsici*, and / or slowing down hyphal growth, inhibiting sporangium production, inhibiting zoospore production, and / or reducing hyphal growth rate, and / or reducing the infectivity and / or pathogenicity to the host, thereby inhibiting or killing *Phytophthora capsici*. Preferably, the cDNA sequence of the pathogenicity regulatory protein is the DNA sequence shown in SEQ ID NO.1. Preferably, the method is used to inhibit and / or kill oomycete diseases caused by *Phytophthora capsici* in production.

[0044] The seventh objective of this invention is to provide a method for screening or assisting in the screening of antibacterial and / or fungicidal agents against Phytophthora capsici. The method includes applying a test substance to the Phytophthora capsici pathogen. When the test substance can inhibit the transcription of the DNA sequence as shown above, or inhibit the translation of the RNA sequence as shown above, or inhibit and / or inactivate the activity of the PcAGO1 growth and development regulatory protein as shown above, the test substance is a candidate antibacterial and / or fungicidal agent against Phytophthora capsici.

[0045] The eighth objective of this invention is to provide a method for controlling (inhibiting or blocking) the complete pathogenicity of oomycetes, comprising the following steps: inhibiting the transcription of the coding gene as described above, or inhibiting the translation of the RNA molecule described above, or inhibiting and / or inactivating the activity of the PcAGO1 growth and development regulatory protein as described above;

[0046] The control (inhibition or blocking) of the complete pathogenicity of oomycetes is to inhibit (reduce) the production of zoospores of Phytophthora capsici, and / or reduce the mycelial growth rate of Phytophthora capsici, and / or reduce the mycelial growth rate of Phytophthora capsici, thereby reducing the ability of Phytophthora capsici to infect the host and / or its pathogenicity to the host.

[0047] The present invention also provides a method for reducing the ability of oomycetes to infect a host, which reduces the ability of oomycetes to infect a host by controlling complete pathogenicity as described in the claims.

[0048] The above-described method for controlling the complete pathogenicity of *Phytophthora capsici* involves knocking out any of the aforementioned DNA sequences to control the formation of complete pathogenicity in the *Phytophthora capsici*. The *Phytophthora capsici* includes strain LT1534.

[0049] In one embodiment of the present invention, the gene knockout method described above employs a CRISPR / Cas9-based gene knockout method.

[0050] Specifically, the CRISPR / Cas9-based gene knockout method involves transfecting the Donor vector of the target gene, sgRNA, and Cas9 co-expression plasmid into Phytophthora capsici and screening for recombinant bacteria with inactivated target knockout proteins.

[0051] The Donor vector is a recombinant vector containing a sequence of 800-1500 bp upstream of the gene to be knocked out, a Doodor DNA sequence (which can be a gene sequence such as NPTII, GFP, or RFP), and a sequence of 800-1500 bp downstream of the gene to be knocked out, connected in sequence.

[0052] The sgRNA and Cas9 protein co-expression plasmid is a vector encoding an sgRNA fragment targeting the gene to be knocked out and a DNA sequence expressing the Cas9 protein. The target gene to be knocked out is the PcAGO1 gene, and the sgRNA sequence (coding sequence) targeting the PcAGO1 gene is GAATTTGAAGGACATGGTGG.

[0053] Preferably, the sgRNA and Cas9 co-expression plasmid is obtained by using the pYF515 vector as the starting vector, inserting the double-stranded sgRNA coding sequence obtained by annealing the sgRNA of the PcAGO1 gene between the Nhe I and Bsa I enzyme recognition sites of the pYF515 vector.

[0054] The application of substances that inhibit the growth and development of PcAGO1 and regulate protein expression and / or activity in the preparation of antibacterial or fungicidal agents against Phytophthora capsici, the causal agent of plant diseases, is also within the scope of protection of this invention.

[0055] In the above applications, the substance that regulates the expression and / or activity of PcAGO1 growth and development protein is a substance that inhibits the expression of PcAGO1 growth and development protein and / or inhibits the transcription of the gene encoding cellulose synthase protein and / or inhibits the translation of RNA molecules obtained from the transcription of the gene encoding PcAGO1 growth and development protein.

[0056] This invention also provides a primer sequence for amplifying the PcAGO1 growth and development regulatory protein in *Phytophthora capsici*, i.e., a primer sequence for amplifying the target sequence, preferably as shown in SEQ ID No. 1. The *Phytophthora capsici* strain includes *Phytophthora capsici* LT1534.

[0057] A primer and / or primer pair that amplifies the full-length DNA sequence encoding the above-mentioned growth and development regulatory proteins or any segment of the DNA sequence thereof also falls within the scope of protection of this invention.

[0058] Experiments have demonstrated that the PcAGO1 growth and development regulatory protein provided in this invention plays a role in the growth and development of *Phytophthora capsici*. Knockout mutants obtained using PEG-CaCl2-mediated protoplast transformation combined with CRISPR / Cas9 gene editing technology exhibit significant changes in growth and development compared to the wild-type parent strain. These changes primarily include: altered colony morphology, slower hyphal growth, absence of sporangia, zoospores, and oospores, and inability to cause disease in tobacco leaves after PcAGO1 protein deletion. Therefore, the PcAGO1 growth and development regulatory protein in *Phytophthora capsici* plays a crucial role in its asexual reproduction, sexual reproduction, and infection processes. This invention provides technical support for further research into the growth and development processes and pathogenic mechanisms of *Phytophthora capsici*, and lays a technical foundation for the control of plant diseases caused by *Phytophthora capsici* and the development of novel fungicides. Attached Figure Description

[0059] Figure 1 This is a schematic diagram of the PcAGO1 domain structure of Phytophthora capsici, which includes the ArgoN, PAZ, MID, and Piwi domains.

[0060] Figure 2 Colony morphology of wild-type Phytophthora capsici strain LT1534 and the PcAGO1 gene knockout mutant ΔPcAGO1.

[0061] Figure 3 Pathogenicity map of tobacco leaves inoculated with wild-type Phytophthora capsici strain LT1534 and the PcAGO1 gene knockout mutant ΔPcAGO1 (photographed 4 days after inoculation). Detailed Implementation

[0062] The following examples are provided to better understand the present invention, but do not limit the invention. Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0063] The wild-type strain of *Phytophthora capsici*, LT1534, was donated by Professor Kurt Lammour of Tennessee State University, USA. Information on strain LT1534 was disclosed in the literature “Jason ES, Andrea LV, Howard SJ, Gregory MV, Michael AG, Maryn OC, Nicholas D., Jennifer J., Joann M., Kurt H.L., and Christine DS (2021). High-Quality Reference Genome Sequence for the Oomycete Vegetable Pathogen *Phytophthora capsici* Strain LT1534. *Plant Microbiol.* 10, 21.” The above strain is only the material used in the embodiments of this invention. In fact, when applying the screening markers described in this invention, *Phytophthora capsici* strains can be obtained through any commercially available means.

[0064] All of the above strains have been identified using existing morphological and molecular biological methods.

[0065] The culture medium and reagent formulations used in this study are as follows:

[0066] Commonly used V8 medium: 340mL V8, 4.76g CaCO3, deionized water to a final volume of 3.4L, then add 51g agar to prepare a solid medium, autoclave at 121℃ for 20min.

[0067] PM medium (Pea Mannitol): Add 125g of peas to 1L of deionized water and sterilize at 121℃ for 20min. Filter the mixture through gauze to obtain pea soup. Add 91.1g of Mannitol, 2g of CaCO3, and 1g of CaCl2 to the soup. Make up the volume to 1L with distilled water. For solid medium, add 15g of agar powder and sterilize at 121℃ for 20min.

[0068] The culture medium used in the knockout transformation experiment is as follows:

[0069] NPB medium (Nutrient Pea Broth): Add 125g of peas to 1L of deionized water and sterilize at 121℃ for 20min. Filter through gauze to obtain pea broth. Add 2.0g Yeast Extract, 5.0g Glucose, 5.0g Mannitol, 5.0g Sorbitol, 2.0g CaCO3, 0.1g CaCl2, 0.5g MgSO4, 0.5g KNO3, 1.0g K2HPO4, and 1.0g KH2PO4. Adjust the volume to 1L with deionized water. If preparing a solid medium, add 15g agar powder and sterilize at 121℃ for 20min. After sterilization, add 2mL of Vitamin Stock (Folic Acid 6.7×10⁻⁶) filtered through a 0.22μM filter. -7 g / mL; Pyridoxine-HCl 6.0×10 -4 g / mL; Biotin 6.7×10 -7 g / mL; Thiamine-HCl 1.3×10 -3 g / mL; L-inositol 4.0×10 -5 g / mL; Nicotinic acid 4.0×10 -5 g / mL; Riboflavin 5.0×10 -5 (g / mL) and Vitamin stock 2mL (FeC6H5O7·3H2O 5.4×10 g / mL) -4 g / mL; Na₂MoO₄·H₂O 3.0×10⁻⁶ g / mL -5 g / mL; ZnSO4·7H2O 3.8×10 -4 g / mL; MgSO4·H2O 3.8×10 -5 g / mL; H3BO3 2.5×10 -5 g / mL; CuSO4·5H2O 7.5×10 -4 g / mL)

[0070] The reagents for the knockout transformation test are prepared as follows:

[0071] Enzymatic hydrolysate: Prepare fresh before use. Lysing enzyme (from Trichoderma harzianum, L1412, Sigami) 0.12g, cellulase (yakult R10) 0.12g, 0.8M Mannitol 10mL, ultrapure water 8mL, 0.5M KCl 800μL, 0.5M MES (pH 5.7) 800μL, 0.5M CaCl2 400μL, sterilized by filtration through a 0.22μM filter membrane.

[0072] W5 solution: KCl 0.1g, CaCl2·2H2O 4.6g, NaCl 2.25g, Glucose 7.8g, dissolved in ultrapure water and brought to a final volume of 250mL, then filtered through a 0.22μm filter membrane for sterilization.

[0073] PEG-CaCl2 solution (40% w / v): Prepare fresh before use. 6g PEG4000, 3.75mL 0.8M Mannitol, 3mL ultrapure water, 3mL 0.5M CaCl2, sterilized by filtration through a 0.22μm filter membrane.

[0074] MMG solution (250mL): Mannitol 18.22g, 0.5M MES (pH 5.7) 2.0mL, MgCl2·6H2O 0.76g, ultrapure water to a final volume of 250mL, sterilized by filtration through a 0.22μm filter membrane.

[0075] Example 1: Obtaining the growth and development regulatory protein PcAGO1 and its encoding gene from *Phytophthora capsici*.

[0076] In this embodiment, the growth and development regulatory protein PcAGO1 of *Phytophthora capsici* and its encoding gene (or cDNA) were obtained by amplification using the DNA (or cDNA) of *Phytophthora capsici* strain LT1534 as a template, through the primers listed in Table 1. The material from which DNA or RNA was extracted can be the mycelium of *Phytophthora capsici* strain LT1534. Using DNA from *Phytophthora capsici* strain LT1534 as a template, the coding gene PcAGO1 was amplified using PcAGO1-F and PcAGO1-R, as shown in SEQ ID NO.1 of the sequence listing. SEQ ID NO.1 consists of 2799 nucleotides, with the coding sequence being nucleotides 1-2799 from the 5' end of SEQ ID NO.1, encoding the protein (PcAGO1) shown in SEQ ID NO.2 of the sequence listing. Specifically, the ArgoN domain sequence is the sequence of amino acid residues 109-248 from the N-terminus of SEQ ID NO.2, the PAZ domain sequence is the sequence of amino acid residues 314-438 from the N-terminus of SEQ ID NO.2, the MID domain sequence is the sequence of amino acid residues 499-582 from the N-terminus of SEQ ID NO.2, and the Piwi domain sequence is the sequence of amino acid residues 593-895 from the N-terminus of SEQ ID NO.2. Using cDNA from *Phytophthora capsici* strain LT1534 as a template, cDNA of PcAGO1 was amplified using PcAGO1-F and PcAGO1-R. Its sequence is identical to the coding gene sequence, as shown in SEQ ID NO.1. The aforementioned protein or gene can also be synthesized artificially.

[0077] Table 1. Primers for amplifying the full-length PcAGO1 coding gene

[0078]

[0079] SEQ ID NO.1 is shown below:

[0080]

[0081]

[0082] SEQ ID No. 2 is shown below:

[0083]

[0084]

[0085] Example 2: Construction of the PcAGO1 gene knockout vector for Phytophthora capsici

[0086] This embodiment describes the CRISPR / Cas9-based gene knockout vector construction method and the sequences of related vectors (including pBluescript II SK). + The sequences of PYF515 and NPT II genes have been disclosed in the literature “Fang, Y., and Tyler, BM (2016). Efficient disruption and replacement of an effector gene in the oomycete Phytophthora sojae using CRISPR / Cas9. Molecular plant pathology, 17(1), 127-139.” and “Fang, Y., Cui, L., Gu, B., Arredondo, F., and Tyler, BM (2017). Efficient genome editing in the oomycete Phytophthora sojae using CRISPR / Cas9. Curr. Protoc. Microbiol. 44, 21A.1.1-21A.1.26.”. The pBluescript II SK used in this embodiment + The homologous arm vector plasmid (Donor vector), sgRNA and Cas9 co-expression plasmid PYF515 were all donated by Professor Brett M. Tyler of Oregon State University.

[0087] The specific construction method of the Donor vector pBS-NPTII-AGO1, sgRNA and Cas9 co-expression plasmid pYF515-AGO1 used in this embodiment is as follows:

[0088] 1) Construction of pBS-NPTII-AGO1: Using DNA from Phytophthora capsici strain LT1534 as a template, primers were designed using the TaKaRa-In-Fusion Tools online website (http: / / www.clontech.com / US / Products / Cloning_and_Competent_Cells / Cloning_Resources / Online_In-Fusion_Tools) to amplify the 1000bp upstream sequence of the target gene PcAGO1 (as shown in Sequence 3 in the sequence listing, as shown in Table 2). The sequences included: the amplified primers pBS-NPTII-AGO1-F1 and pBS-NPTII-AGO1-R1 (obtained by amplification using primers pBS-NPTII-AGO1-F2 and pBS-NPTII-AGO1-R2 as shown in Table 2); the NPTII gene sequence (obtained by amplification using pYF515 backbone plasmid as template with primer sequences pBS-NPTII-AGO1-F2 and pBS-NPTII-AGO1-R2 as shown in Table 2); and the 1000bp downstream sequence of PcAGO1 (sequence 4 in the sequence listing, obtained by amplification using primers pBS-NPTII-AGO1-F3 and pBS-NPTII-AGO1-R3 as shown in Table 2). The HD Cloning Kit sequentially fuses and ligates three amplified fragments into the cloning vector pBluescript II SK. + After digestion with EcoR V, the ligation product was transformed into E. coli DH5α competent cells and cultured overnight at 37°C. Single clones were picked and amplified and sequenced using universal primers M13F (sequence: 5'-TGTAAAACGACGGCCAGT-3') / M13R (sequence: 5'-CAGGAAACAGCTATGACC-3'). The recombinant expression vector containing the sequentially linked 1000bp upstream sequence of PcAGO1, the NPTII gene sequence, and the 1000bp downstream sequence of PcAGO1 was named pBS-NPTII-AGO1.

[0089] 2) Construction of pYF515-AGO1: Using the sgRNA design website EuPaGDT (http: / / grna.ctegd.uga.edu / ) and the online RNA structure analysis tool (http: / / rna.urmc.rochester.edu / RNAstructureWeb / Servers / Predict1 / Predict1.htmL), an sgRNA sequence specifically targeting the PcAGO1 gene and forming a weak secondary structure was selected (sgAGO1: GAATTTGAAGGACATGGTGG, nucleotide sequence 2154-2173 of SEQ ID No. 1 of the PcAGO1 gene). This sequence was then sent to a company to synthesize forward and reverse sgRNA primers containing Nhe I and Bsa I restriction sites and HHribozyme. The primers were dissolved in sterile water to prepare a 100 μM solution. The double-stranded sgRNA sequence was synthesized by annealing reaction. The reaction system consisted of 3 μl of sense strand solution, 3 μl of antisense strand solution, 3 μl of 10×T4 DNA Ligase Buffer (NEB), 4 μl of 0.5M NaCl, and 21 μl of ultrapure sterile water. The mixture was pipetted and stirred, and reacted at 100℃ for 2 min. The mixture was then allowed to cool naturally at room temperature for 4 h. After that, the reaction solution was diluted 500 times. Take 2 μl of 10×T4 DNA Ligase Buffer (NEB), 50 ng of pYF515 vector (double digested with Nhe I / Bsa I), 4 μl of diluted double-stranded sgRNA solution, 1 μl of T4 DNA Ligase, and sterile ultrapure water to bring the total volume to 20 μl. Incubate at room temperature for 30 min. Transform 5 μl of the ligation product into E. coli DH5α competent cells and incubate overnight at 37°C. Then, use primer pair RPL41_Pseq_F (sequence: 5'-CAAGCCTCACTTTCTGCTGACTG-3') / M13F (sequence: 5'-TGTAAAACGACGGCCAGT-3') for colony PCR verification and sequence to verify positive clones. The recombinant vector that is verified to express the above sgRNA is named pYF515-AGO1.

[0090] Table 2. Primer sequences used for vector construction

[0091]

[0092]

[0093] Example 3: Obtaining PcAGO1 gene knockout transformants from Phytophthora capsici

[0094] PcAGO1 gene knockout transformants were prepared using a PEG-CaCl2-mediated protoplast transformation method. The method of oomycete genetic transformation was disclosed in the literature "Wang, Z., Tyler, BM, Liu, X. Protocol of Phytophthora capsici transformation using the CRISPR-Cas9 system. Plant Pathogenic Fungi and Oomycetes. Humana Press, New York, NY, 2018: 265-274."

[0095] The PcAGO1 gene knockout transformant was obtained by transforming the Donor vector, sgRNA, and Cas9 co-expression plasmids (pBS-NPTII-AGO1 and pYF515-AGO1) of the knockout gene PcAGO1 obtained in Example 1 into protoplasts of Phytophthora capsici LT1534. The transformed individuals were screened by culturing them on G418-resistant V8 solid medium plates at 25°C. Mycelia of suspected transformants were collected, and DNA was extracted for PCR sequencing verification. RNA was then extracted from positive transformants for qPCR verification. The resulting PcAGO1 knockout transformant (ΔPcAGO1) was obtained.

[0096] Example 4: Biological characteristics analysis of *Phytophthora capsici* PcAGO1 knockout transformants

[0097] I. Detection of mycelial growth rate

[0098] Wild-type Phytophthora capsici strain LT1534 and the knockout transformant PcAGO1 (ΔPcAGO1) obtained in Example 3 were inoculated into V8 solid medium (15 mL of medium was poured into a 9 cm petri dish) and cultured at 25°C in the dark for 4 days. The colony diameter of each strain was measured by the cross-cross method, and each strain was replicated 3 times.

[0099] The results showed that the mycelial growth rate of all tested PcAGO1 knockout transformants was significantly lower than that of the wild-type Phytophthora capsici strain LT1534. Figure 2 (See Table 3). The experimental results show that the growth and development regulatory protein PcAGO1 of Phytophthora capsici is involved in regulating the hyphal growth and normal colony morphology of Phytophthora capsici.

[0100] II. Sporangium Count Detection

[0101] Wild-type Phytophthora capsici strain LT1534 and the knockout transformant ΔPcAGO1 obtained in Example 3 were inoculated into V8 solid medium (15 mL of medium was poured into a 9 cm petri dish), cultured at 25°C in the dark for 4 days, and then cultured at 25°C under light for 5 days to induce sporulation. The morphology and number of sporangia on the petri dishes were observed under a microscope, and each strain was replicated 3 times.

[0102] The results showed that, compared with the wild-type Phytophthora capsici strain LT1534, the knockout transformant ΔPcAGO1 obtained in Example 3 did not produce sporangia, indicating that the growth and development regulatory protein PcAGO1 of Phytophthora capsici affected the production of sporangia (Table 3).

[0103] III. Detection of Oospore Count

[0104] The standard hybrid strain of Phytophthora capsici A2 was cultured in opposition to the wild-type Phytophthora capsici strain LT1534 and the knockout transformant ΔPcAGO1 obtained in Example 3 on V8 solid medium (15 mL of medium in a 9 cm petri dish). The cultures were cultured in the dark at 25°C for 5 days. The junction of the two colonies was then observed under a microscope, and the number of oospores was counted. Each strain was replicated 3 times.

[0105] The results showed that, compared with the wild-type Phytophthora capsici strain LT1534, the number of oospores produced by the knockout transformant ΔPcAGO1 obtained in Example 3 was significantly reduced, indicating that the growth and development regulatory protein PcAGO1 of Phytophthora capsici was involved in the sexual reproduction stage of Phytophthora capsici and affected the production of oospores of Phytophthora capsici (Table 3).

[0106] IV. Pathogenicity Detection of Transformants in Isolated Leaf Formations

[0107] The tested tobacco cultivar was *Nicotiana benthamiana*, planted in seedling trays with peat moss as the culture medium, and grown for 4–6 weeks before use. Wild-type *Phytophthora capsici* strain LT1534 and the knockout transformant ΔPcAGO1 obtained in Example 3 were inoculated into V8 solid medium (15 mL of medium in a 9 cm petri dish), and cultured at 25°C in the dark for 4 days. A 5 mm mycelial cake was then punched at the edge of the colony. Tobacco leaves from the same leaf position were collected, and a mycelial cake was inoculated at the center of the leaf near the vein. Five leaves were inoculated per mycelium. After culturing at 25°C in the dark with humidity (RH = 60%–80%) for 4 days, the diameter (mm) of the lesions infected by *Phytophthora capsici* on the pepper leaves was measured using the cross-crossing method.

[0108] The results showed that, compared with the wild-type Phytophthora capsici strain LT1534, the knockout transformant ΔPcAGO1 obtained in Example 3 lost its pathogenicity to tobacco leaves. Figure 3(and Table 3). This indicates that the growth and development regulatory protein PcAGO1 of Phytophthora capsici is involved in regulating the biological pathways by which Phytophthora capsici infects host plants.

[0109] Therefore, the growth and development regulatory protein PcAGO1 of Phytophthora capsici can regulate the virulence of Phytophthora capsici. Inhibiting the function of this protein can control the infection process of Phytophthora capsici and control the large-scale occurrence of the disease.

[0110] Table 3. Results of biological trait determination in Phytophthora capsici PcAGO1 gene knockout transformants

[0111] (mm) (indivual) (indivual) (mm) (indivual) LT1534 69.7±1.0a 291±60a 292±52a 60.1±7.2a 203.17±52.77a △PcAGO1 54.33±1.0b 0.00±0.00b 0.00±0.00b 0.00±0.00b 0.00±0.00b

Claims

1. A species derived from Phytophthora capsici ( Phytophthora capsici The growth and development regulatory protein PcAGO1, containing ArgoN, PAZ, MID, and Piwi domains, is a protein as follows (A1) or (A2): A1) A protein consisting of the amino acid sequence shown in SEQ ID No. 2; A2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of a protein as shown in SEQ ID No.

2.

2. The gene encoding the growth and development regulatory protein PcAGO1 as described in claim 1.

3. The encoding gene according to claim 2, characterized in that, The encoding gene is the DNA molecule with the nucleotide sequence shown in SEQ ID No.

1.

4. The biological material associated with the growth and development regulatory protein PcAGO1 as shown in claim 1 and the encoding gene as shown in claim 2 is any one of the following D1) to D3): D1) An expression cassette containing the gene encoding as described in claim 2; D2) A recombinant vector containing the encoding gene of claim 2, or a recombinant vector containing the expression cassette of D1); D3) A recombinant microorganism containing the encoding gene of claim 2, or a recombinant microorganism containing the expression cassette of D1), or a recombinant microorganism containing the recombinant vector of D2).

5. The application of the growth and development regulatory protein PcAGO1 as described in claim 1, the encoding gene as described in claim 2, or the biological material as described in claim 4 in inhibiting the growth and development of oomycetes or reducing the pathogenicity of oomycetes; The oomycete is Phytophthora capsici (… Phytophthora capsici The application is achieved by inhibiting or inactivating the transcription of the encoding gene as described in claim 2, or by inhibiting and / or inactivating the growth and development regulatory protein PcAGO1 as described in claim 1.

6. The use of the growth and development regulatory protein PcAGO1 of claim 1, the encoding gene of claim 2, or the biological material of claim 4 in a formulation for screening pesticides that inhibit the growth and development of oomycetes and / or their pathogenicity to the host, characterized in that... It is any one or more of the following: E1)-E3) E1) Application in reducing the pathogenicity of Phytophthora capsici to the host; E2) Application in reducing the ability of Phytophthora capsici to infect hosts; E3) Application in inhibiting and / or killing Phytophthora capsici; The applications described in E1)-E3) are achieved by inhibiting or inactivating transcription in the encoding gene as described in claim 2, or by inhibiting and / or inactivating the growth and development regulatory protein PcAGO1 as described in claim 1.

7. The application according to claim 6, characterized in that, The application is any one or more of the following F1)-F3): F1) Application in reducing the growth rate of Phytophthora capsici mycelium; Application of F2 in inhibiting the production of sporangia of Phytophthora capsici; Application of F3 in inhibiting the production of zoospores of Phytophthora capsici.

8. A method for inhibiting and / or killing the growth of oomycetes, comprising inhibiting or inactivating the expression of the gene encoding the growth and development regulatory protein PcAGO1 containing ArgoN, PAZ, MID, and Piwi domains in oomycetes, or inhibiting or inactivating the activity of the growth and development regulatory protein PcAGO1 containing ArgoN, PAZ, MID, and Piwi domains; wherein the amino acid sequence of the growth and development regulatory protein PcAGO1 containing ArgoN, PAZ, MID, and Piwi domains is the amino acid sequence shown in SEQ ID No. 2, and the oomycete is *Phytophthora capsici* (capsicum). Phytophthora capsici ); The method for inhibiting or inactivating the expression of the gene encoding the pathogenic regulatory protein PcAGO1, which contains ArgoN, PAZ, MID, and Piwi domains in oomycetes, is to knock out the gene encoding the protein. The gene encoding PcAGO1, which contains ArgoN, PAZ, MID, and Piwi domains, is the DNA shown in SEQ ID No.

1.

9. A method for inhibiting or blocking the complete pathogenicity of oomycetes, comprising inhibiting or blocking the complete pathogenicity of the oomycetes by inhibiting or inactivating the expression of the encoding gene as described in claim 2, or inhibiting or inactivating the activity of the growth and development regulatory protein PcAGO1 as described in claim 1; wherein the oomycete is *Phytophthora capsici* (…). Phytophthora capsici ); in, The method for inhibiting or blocking the complete pathogenicity of oomycetes is to inhibit the ability of Phytophthora capsici to infect the host and / or its pathogenicity to the host. The method for inhibiting or inactivating the expression of the gene described in claim 2 is to knock out the coding gene described in claim 2.

10. The method according to claim 9, characterized in that, The inhibition of the ability of *Phytophthora capsici* to infect and / or to cause pathogenicity to the host is achieved by inhibiting the sporangium production of *Phytophthora capsici*, and / or inhibiting the production of zoospores, and / or reducing the mycelial growth rate of *Phytophthora capsici*.

11. A method for reducing the ability of oomycetes to infect a host, wherein the method described in claims 9 or 10 is used to inhibit or block complete pathogenicity, thereby reducing the ability of oomycetes to infect a host; wherein the host is chili pepper or tobacco.

Images