A method for synthesizing AMA and its derivatives by using two enzymes in combination

Abstract

The present application relates to the field of genetic engineering technology and drug synthesis, and in particular to a preparation method of AMA and derivatives thereof by double-enzyme combination synthesis. AMA is an effective inhibitor of metal-beta-lactamase (such as NDM-1), and has synergistic activity against drug-resistant gram-negative bacteria with beta-lactam antibiotics, especially carbapenems. The two-step synthesis method by double-enzyme combination provided in the present application can simply and economically synthesize AMA and derivatives thereof in a single stereoisomer, and is expected to be applied to the enzyme synthesis of other similar AMA derivatives and complex amino polycarboxylic acid compounds, and provides a new method for the development of antibiotic adjuvants.

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering technology and drug synthesis, specifically to a method for synthesizing AMA and its derivatives using a dual-enzyme combination. Background Technology

[0002] AMA is a natural product derived from fungi. In 1965, Haenni et al. first extracted this compound from Aspergillus oryzae and discovered that it possessed toxic activities that caused plant leaves to wilt or develop spots. Subsequently, AMA has been extracted and discovered as a secondary metabolite from fungi such as Aspergillus flavus, anthracnose fungi, Fusarium fungi, and net blotch fungi.

[0003] In 2014, Wright et al. screened AMA as an effective metallo-β-lactamase inhibitor from natural product extracts of over 500 environmental microorganisms. Metallo-β-lactamases (MBLs) are bacterial enzymes that rely on zinc ions to hydrolyze β-lactam antibiotics and are a major cause of drug resistance in Gram-negative bacteria. Currently used β-lactamase inhibitors are ineffective against MBLs. Studies showed that AMA has low to micromole inhibitory activity against NDM-1 and VIM-2. Antimicrobial assays against 229 clinically isolated pathogenic bacteria showed that AMA effectively restored the antimicrobial activity of meropenem against various Gram-negative bacteria (such as Enterobacter, Acinetobacter, and Pseudomonas) carrying NDM-1 and VIM-2. The mechanism of action of AMA is speculated to be through selective chelation of the Zn atom in MBLs. 2+ This leads to the Zn active center of MBL 2+ The loss of [agent] further leads to the degradation of MBL, thus exerting its inhibitory activity. AMA and its derivatives have shown potential in the development of antibiotic adjuvants.

[0004]

[0005] Synthetic methods for AMA include total chemical synthesis, chemical-enzymatic coupling synthesis, and biosynthesis. Chemical synthesis was the first to be reported, but it suffers from limitations such as cumbersome steps, difficult product separation, and harsh conditions. Key methods include: a modular synthesis strategy based on late-stage oxidation developed by Professor Lei Xiaoguang's research group at Peking University, yielding (S,S,S)-AMA in 14 steps with a 4% yield; a synthetic route using aziridine as a substrate provided by Wright, synthesizing (S,S,S)-AMA in 9 steps with a 1% yield; an improved method based on the sulfamidate strategy, shortening the synthesis to 6 steps with a 19% yield; and a synthetic route using the Mitsunobu reaction, achieving a 28% yield in 6 steps. A chemical-enzyme coupling method was introduced to introduce a biocatalyst with high stereo, regio, and chemoselectivity, ethylenediamine-N,N'-disuccinate (EDDS) lyase. This enzyme catalyzes a one-step asymmetric hydroamination reaction between chemically synthesized amino acid substrates and fumaric acid to synthesize (S,S,S)-AMA, shortening the route to 4 steps with a yield of 10%.

[0006] Literature reports (Guo, Q., Wu, D., Gao, L., Bai, Y., Liu, Y., Guo, N., Du, X., Yang, J., Wang, X., Lei, Catalysis, 10, 6291–6298. https: / / doi.org / 10.1021 / acscatal.0c01187) A biosynthesis of AMA utilizes an AMA synthase (AMAS) as a biocatalyst. This enzyme, first isolated and identified from *Aspergillus oryzae* in 2020, catalyzes a single-enzyme, two-step synthesis of (S,S,S)-AMA from O-phosphoserine (OPS) and L-aspartic acid as substrates, with a conversion rate of 85% and a yield of 17%. The reaction formula is shown below. This enzyme and a mutant also exhibit a broad substrate spectrum, accepting L-Asp (L-aspartic acid) and 19 other natural amino acids, as well as some amines, as substrates for the synthesis of a series of intermediate toxinA derivatives and AMA derivatives. All of these compounds are AMA derivatives with L-Asp fragments substituted.

[0007]

[0008] However, the conversion rate and yield of this AMA synthase (AMAS) are unsatisfactory and cannot meet production requirements. A more efficient AMA synthase needs to be found. Summary of the Invention

[0009] Purpose of the invention:

[0010] The purpose of this invention is to provide a highly efficient synthetic method for AMA and its derivatives via a two-enzyme cascade. This invention first provides two CN-bond ligases, utilizing a two-enzyme cascade to synthesize AMA and its derivatives with high efficiency and high stereoselectivity.

[0011] Technical solution

[0012] An AMA synthase, characterized in that the amino acid sequence of the AMA synthase is shown in SEQ ID NO.1, and the nucleotide sequence of the encoding gene of the AMA synthase is shown in SEQ ID NO.2. The substrate profile of this wild-type AMA synthase is shown below, exhibiting structural selectivity.

[0013] A mutant of AMA synthase, characterized in that the amino acid sequence of the mutant AMA synthase is shown in SEQ ID NO.3, which is based on the SEQ ID NO.1 of claim 1, where R at position 234 is mutated to A, i.e., R234A;

[0014] The mutant R234A alters the substrate spectrum compared to the wild-type AMA synthase. Mutant R234A recognizes p-phenylenediamine, m-phenylenediamine, and (2-aminoethyl)-L-aspartic acid, while the wild-type AMA synthase cannot recognize these two substrates. However, although the mutant changes the substrate spectrum, it also reduces the activity of the AMA synthase. Other mutation sites also affect the catalytic activity of the AMA synthase, such as the S mutation at position 86, the Y mutation at position 166, the T mutation at position 199, and the R mutation at position 229, i.e., S86A, Y166A, T199A, and R229T. The main manifestation is that all mutants reduce the enzyme activity to varying degrees; that is, they possess the catalytic ability of AMA synthase, but the mutated enzymes are less active than the wild-type AMA synthase in catalyzing the AMA synthesis reaction. The mutant Y166A completely loses its ability to catalyze AMA synthesis.

[0015] The following are the corresponding substrate spectra:

[0016] wild type:

[0017]

[0018] R234A mutant:

[0019]

[0020] A method for synthesizing AMA and its derivatives using a dual-enzyme combination, characterized in that,

[0021] It is prepared by two methods:

[0022] Method 1:

[0023] The first step reaction uses compounds A and B as initial reactants, where A is fumaric acid and B is a diamine compound, and CN lyase is used as a catalyst to synthesize an optically pure aspartic acid derivative.

[0024] The second step reaction uses serine donor and the product separated in the first step reaction as substrates, and the AMA synthase described in claim 1 as a catalyst to synthesize AMA and its derivatives; wherein the general formula of AMA and its derivatives is as follows:

[0025]

[0026] Where X represents NH, R represents H or COOH, and m = 1 or 2;

[0027] Or method 2:

[0028] The first step reaction uses serine donor and cysteine ​​as substrates and the AMA synthase described in claim 1 or biological material containing the AMA synthase encoding gene as catalyst to synthesize S-substituted L-cysteine.

[0029] The second step reaction uses fumaric acid and the product separated in the first step as substrates, and CN lyase as a catalyst to synthesize AMA derivatives; the resulting AMA derivatives have the following general structural formula:

[0030]

[0031] Where X represents S, R represents H, and m = 1.

[0032] B is ethylenediamine, 2,3-diaminopropionic acid, or 2,4-diaminobutyric acid; the serine donor is O-phosphoserine; and the CN bond lyase is EDDS lyase or a 3-methylaspartate amino acid lyase Q73A mutant.

[0033] In Method 1, the concentration ratio of fumaric acid to diamine compounds in the first step of the reaction is 10:1-1:35, the initial substrate concentration is 10-100 mM, and the concentration of CN lyase is 0.05-0.5 mol%. In the second step of the reaction, the concentration ratio of aspartic acid derivative to oxyphosphoserine is 1:3-1:10, the initial substrate concentration is 10-100 mM, and the concentration of AMA synthase is 0.05-0.5 mol%.

[0034] The synthetic method is characterized in that the AMA and its derivatives are selected from compounds with the following structures:

[0035]

[0036] Specifically:

[0037] I. This invention provides a highly efficient method for synthesizing AMA using a two-enzyme-level combination, characterized by comprising the following steps:

[0038]

[0039] (1) Synthesis of Toxin A:

[0040] 1) Add fumaric acid, L-Dap (S-(+)-2,3-diaminopropionic acid), and the EDDS lysin required for the reaction to the reaction solution to prepare the reaction system:

[0041] The reaction solution is a NaH2PO4-NaOH buffer solution with a pH of 8.5.

[0042] The molar ratio of fumaric acid to L-Dap (S-(+)-2,3-diaminopropionic acid) substrate is 10:1-1:35.

[0043] The concentration of the EDDS lysin is 0.05 mol% to 0.15 mol% (relative to L-Dap):

[0044] In the above technical solution, except for the EDDS lysin being added last, the order in which the reagents are added is arbitrary and random, with no strict requirements.

[0045] 2) After obtaining the reaction system in step 1), place it at room temperature and let it stand. After the reaction is complete, remove the protein by heating in a water bath.

[0046] Step 3) The reaction solution obtained in step 2) is purified using anion and cation exchange resins.

[0047] (2) Synthesizing AMA:

[0048] 1) Add the synthesized ToxinA, OPS (O-phosphoserine), and the AMA synthase required for the reaction to the reaction solution to prepare the reaction system:

[0049] The reaction solution is a buffer solution with a pH of 7.0–9.0.

[0050] The molar ratio of ToxinA to OPS substrate is 1:3 to 1:10.

[0051] The concentration of the AMA synthase is 0.2 mol% to 0.5 mol% (relative to Toxin A):

[0052] In the above technical solution, except for the EDDS lysin being added last, the order in which the reagents are added is arbitrary and random, with no strict requirements.

[0053] 2) After obtaining the reaction system in step 1), place it at room temperature and let it stand. After the reaction is complete, remove the protein by heating in a water bath.

[0054] Step 3) The reaction solution obtained in step 2) is purified using anion and cation exchange resins.

[0055] II. This invention provides a highly efficient synthetic method for AMA derivatives using a dual-enzyme-level combination, characterized by comprising the following steps:

[0056]

[0057] (1) Synthesis of optically pure aspartic acid derivatives:

[0058] 1) Add fumaric acid, 2,4-diaminobutyric acid, and the required EDDS lyase or methylaspartate lyase to the reaction solution to prepare the reaction system:

[0059] The reaction solution is a buffer solution with a pH of 8.5–9.0.

[0060] The molar ratio of fumaric acid to the different diamine substrates mentioned above is 10:1-1:35:

[0061] The concentration of the EDDS lyase or methylaspartate lyase is 0.05 mol% to 0.15 mol% (relative to diamine):

[0062] In the above technical solution, except for EDDS lyase or methylaspartate lyase which is added last, the order in which the reagents are added is arbitrary and random, with no strict requirements.

[0063] 2) After obtaining the reaction system in step 1), place it at room temperature and let it stand. After the reaction is complete, remove the protein by heating in a water bath.

[0064] Step 3) The reaction solution obtained in step 2) is purified using anion and cation exchange resins.

[0065] (2) Synthesis of AMA derivatives:

[0066] 1) The synthesized aspartic acid derivative, OPS (O-phosphoserine), and AMA synthase required for the reaction were added to the reaction solution to prepare the reaction system:

[0067] The reaction solution is a buffer solution with a pH of 7.0–9.0.

[0068] The molar ratio of the aspartic acid derivative (A1) to the OPS substrate is 1:7.

[0069] The concentration of the AMA synthase is 0.2 mol% to 0.5 mol% (relative to A1):

[0070] In the above technical solution, except for the AMA synthase which is added last, the order in which the reagents are added is arbitrary and random, with no strict requirements.

[0071] 2) After obtaining the reaction system in step 1), place it at room temperature and let it stand. After the reaction is complete, remove the protein by heating in a water bath.

[0072] Step 3) The reaction solution obtained in step 2) is purified using anion and cation exchange resins.

[0073] III. This invention provides a highly efficient synthesis method for AMA derivatives through a two-enzyme-level combination. In this invention, the substrate spectrum of the AMA synthase was analyzed, and it was found that compounds containing thiols can also be accepted by the enzyme. In this invention, A2 synthesized from cysteine ​​and OPS under the catalysis of AMA synthase can be accepted by EDDS lyase and synthesized into B2.

[0074]

[0075] Its reaction characteristics are:

[0076] 1) Add cysteine, OPS, and the AMA synthase required for the reaction to the reaction solution to prepare the reaction system:

[0077] The reaction solution is a phosphate buffer solution with a pH of 7.0.

[0078] The molar ratio of cysteine ​​to OPS is 1:7.

[0079] The concentration of the AMA synthase was 0.125 mol% (relative to cysteine):

[0080] In the above technical solution, except for the AMA synthase which is added last, the order in which the reagents are added is arbitrary and random, with no strict requirements.

[0081] 2) After obtaining the reaction system in step 1), place it at room temperature and let it stand. After the reaction is complete, remove the protein by heating in a water bath.

[0082] Step 3) The reaction solution obtained in step 2) is purified using anion and cation exchange resins.

[0083] Fourth, it was also discovered in this invention that the AMA synthase mutant R234A can further accept (2-aminoethyl)-L-aspartic acid, which is not acceptable to the wild type. Therefore, this mutant can be enzymatically linked with EDDS lyase, using ethylenediamine as a substrate, to synthesize AMA derivatives in a two-step enzymatic process.

[0084]

[0085] The first step of the reaction is consistent with the above-mentioned asymmetric synthesis of aspartic acid derivatives. The characteristics of the second step are as follows:

[0086] 1) Add (2-aminoethyl)-L-aspartic acid, OPS (O-phosphoserine), and the AMA synthase required for the reaction to the reaction solution to prepare the reaction system:

[0087] The reaction solution is a phosphate buffer solution with a pH of 7.0.

[0088] The molar ratio of (2-aminoethyl)-L-aspartic acid to OPS substrate is 1:7.

[0089] The concentration of the AMA synthase is 0.5 mol% (relative to A3):

[0090] In the above technical solution, except for the AMA synthase which is added last, the order in which the reagents are added is arbitrary and random, with no strict requirements.

[0091] 2) After obtaining the reaction system in step 1), place it at room temperature and let it stand. After the reaction is complete, remove the protein by heating in a water bath.

[0092] Step 3) The reaction solution obtained in step 2) is purified using anion and cation exchange resins.

[0093] Beneficial effects

[0094] 1. This invention provides a novel AMA synthase derived from the fungus (Pyrenophorateres f. teres 0-1). The enzyme sequence is novel. AMA is synthesized through a two-enzyme series with a conversion rate of 98% and an overall yield of 38%, which is higher than the reported conversion rate of 85% and yield of 17% for AMA synthase (AorAMAS) in the literature.

[0095] Specifically, the advantage of this invention lies in its use of two highly stereoselective and regioselective enzyme catalysts to construct a modular, highly selective synthetic method. This invention utilizes readily available precursors, particularly the prochiral compound fumaric acid, to synthesize structurally complex aminopolycarboxylic acid compounds. Compared to chemical synthesis methods, this method offers advantages such as being environmentally friendly, operating under mild conditions, and avoiding repeated protection / deprotection of active groups, effectively shortening the synthetic route. This invention holds promise for the enzymatic synthesis of other similar AMA derivatives and structurally complex aminopolycarboxylic acid compounds, providing a new approach for the development of antibiotic adjuvants and other physiological metalloenzyme inhibitors.

[0096] 2. This invention provides an AMA synthase mutant R234A. Compared with the wild-type AMA synthase, mutant R234A alters the substrate spectrum. Mutant R234A can recognize p-phenylenediamine, m-phenylenediamine, and (2-aminoethyl)-L-aspartic acid, while the wild-type AMA synthase cannot recognize these two substrates. AMA derivatives can be synthesized using the AMA synthase mutant R234A.

[0097] 3. This invention yields compounds B2 and B3, which are novel compounds not previously reported in the literature.

[0098]

[0099] Attached Figure Description

[0100] Figure 1 The image shows the SDS-PAGE electrophoresis result of the expression and purification of AMA synthase in Example 3.

[0101] Figure 2 The image shows the SDS-PAGE electrophoresis result of the expression and purification of the EDDS lysin in Example 4.

[0102] Figure 3 The SDS-PAGE electrophoresis image of the expression and purification of methylaspartate lyase in Example 4 is shown.

[0103] Figure 4 The image shows the NMR results of the product synthesized from Toxin A in Example 5.

[0104] Figure 5 The image shows the NMR results of the product synthesized in Example 7 for AMA.

[0105] Figure 6 The image shows the NMR results of the product synthesized from A1 in Example 9;

[0106] Figure 7The NMR results for the synthesis of (S)-3-((S)-2-amino-2-carboxyethyl)amino)-3-carboxypropyl)-L-aspartic acid in Example 11 are shown.

[0107] Figure 8 This is the NMR result of the product synthesized from A2 in Example 13;

[0108] Figure 9 The NMR results for the synthesis of (2-amino-2-carboxyethyl)thioethyl)-L-aspartic acid in Example 15 are shown.

[0109] Figure 10 This is the NMR result of the product synthesized from A3 in Example 18;

[0110] Figure 11 The NMR results for the synthesis of (2-(S)-2-amino-2-carboxyethyl)amino)ethyl)-L-aspartic acid in Example 20 are shown. Detailed Implementation

[0111] The molecular biological operations in the examples, such as the construction of recombinant vectors and the transformation methods of Escherichia coli, were all performed in accordance with the second edition of "Molecular Cloning" (Maniatis Cold Spring Harbor Laboratory, Cold Spring Harbor, New York (1989)).

[0112] Example 1: Construction of AMA synthase expression strain

[0113] The AMA synthase gene from *Pyrenophora teresf. teres* 0-1 (GenBank: EFQ91126.1, as shown in SEQ ID NO.1) was synthesized by Shanghai Sangon Biotech Co., Ltd. The sequence was optimized using *Escherichia coli* codons, and 5'Nde I and 3'Hind III restriction enzyme sites were added. The synthesized gene was digested with the appropriate restriction endonucleases and ligated into the pET-28a(+) vector to construct the recombinant expression vector (pET-28a_PteAMAS). The vector was transformed into *E. coli* BL21(DE3) to construct the recombinant expression strain.

[0114] Example 2: Construction of strains expressing EDDS lyase and methylaspartate lyase

[0115] EDDS lyase (GenBank ID: ABG61966) and the methylaspartate lyase mutant (Q73A variant of GenBank ID AAB24070.1; the Q73A mutant is active against ethylenediamine, while the wild type does not have the corresponding activity; EDDS lyase is also active against ethylenediamine, but it reacts with two molecules of fumarate and cannot directly yield A3, hence the use of the methylaspartate lyase mutant); the codons of Escherichia coli were optimized and the whole genome was synthesized by Shanghai Sangon Biotech Co., Ltd., avoiding the Nde I, Hind III and Xho I restriction sites, adding 5' Nde I and 3' Hind III restriction sites, constructing it into the pBADN / Myc-HisA vector and transforming it into E. coli TOP10.

[0116] Example 3: Expression and purification of AMA synthase

[0117] At a 1% inoculum rate, *E. coli* BL21(DE3) strain carrying pET-28a_PteAMAS was inoculated into 50 mL of LB broth containing 50 μg / mL kanamycin as a seed culture and incubated overnight at 37°C and 220 rpm on a shaker. The seed culture was then transferred at a 1% inoculum rate to 200 mL of fresh LB broth and incubated at 37°C and 220 rpm for 2 h. The OD600 of the bacterial culture was measured to be 0.8 ± 0.1. IPTG was added to a final concentration of 0.3 mM, and the culture was further incubated at 20°C and 220 rpm for 18 h. The bacterial cells were obtained by centrifugation at 5000 rpm for 10 min at 4°C and washed twice with 50 mM Tris-HCl buffer (pH 8.0). 5.7 g of bacterial cells were obtained per 1 L of culture medium.

[0118] The harvested bacterial cells were resuspended in Buffer A1 (50 mM Tris-HCl, 100 mM NaCl, 10 mM imidazole, pH 8.0) (at a ratio of 6 mL / g of bacterial cells) and sonicated on ice to lyse the bacteria. The sonicated bacterial solution was centrifuged at 15,000 rpm for 15 min at 4 °C, and the supernatant was separated and centrifuged again, repeating this process four times. The supernatant from the last centrifugation was filtered through a 0.22 μm aqueous filter membrane and then stored on ice for later use.

[0119] Place 2 mL of Ni Sepharose™ 6FastFlow packing material into a 12 mL empty column tube. Wash with 10 column volumes (CV, 20 mL) of deionized water to remove the 20% ethanol solution used for packing material storage. Equilibrate the column with 10 CV Buffer A1. Suspend the equilibrated nickel column in the crude extract and incubate at 4°C for 2 hours by rotation. Pour the suspension back into a 12 mL empty column tube, allow the column to settle, and collect the eluent. Wash the nickel column sequentially with 10 CV Buffer A1 and 10 CV Buffer B1 (50 mM Tris-HCl, 100 mM NaCl, 40 mM imidazole), collecting the eluent (containing contaminating proteins). Finally, wash the nickel column with 2.5 CV Buffer C1 (50 mM Tris-HCl, 100 mM NaCl, 300 mM imidazole) to elute and collect the target protein. Store all collected fractions on ice. The target protein was then desalted using a PD-10 desalting column and used immediately or flash-frozen in liquid nitrogen and stored at -20°C. The protein purification process was monitored using SDS-PAGE, and the results are shown below. Figure 1 .

[0120] Example 4: Expression and purification of EDDS lyase and methylaspartate lyase

[0121] At a 1% inoculum size, the monoclonal strain with correct enzyme digestion results was inoculated into 50 mL of LB liquid medium containing 50 μg / mL ampicillin as a seed culture and incubated on a shaker at 37°C and 220 rpm for at least 12 h. The seed culture was then transferred at 1% of the medium volume to 200 mL of fresh LB liquid medium and incubated on a shaker at 37°C and 220 rpm for 2 h. The OD600 of the bacterial culture was measured to be 0.8 ± 0.1. L-arabinose, the inducer, was added to a final concentration of 0.5 mg / mL, and the bacterial culture was further incubated at 20°C and 220 rpm for 18 h. The expressed bacterial cells were centrifuged at 5000 rpm for 10 min at 4°C to obtain the cells, and washed twice with 50 mM Tris-HCl buffer (pH 8.0).

[0122] Protein purification was performed using 7g of harvested bacterial cells as an example. The bacterial cells were resuspended in 40mL Buffer A2 (50mM Tris-HCl, 100mM NaCl, 20mM imidazole), and the cells were sonicated on ice to break the bacteria. The sonicated bacterial solution was centrifuged at 4℃ and 15000rpm for 15min to separate the supernatant and precipitate. The supernatant was centrifuged again, and the process was repeated 4 times. The supernatant was filtered through a 0.22μm aqueous filter membrane after the last centrifugation and then placed on ice for later use.

[0123] Place 2 mL of Ni Sepharose™ 6Fast Flow packing material into a 12 mL affinity chromatography empty column. Wash the column with 10 column packing volume (CV, 20 mL) of deionized water to remove the 20% ethanol solution used for storage. Equilibrate the column with 10 CV Buffer A2. Transfer the equilibrated nickel column to the treated crude extract and incubate at 4°C for 2 hours. Pour the crude extract back into the 12 mL affinity chromatography empty column and collect the eluent that flows down naturally due to gravity. Wash the nickel column sequentially with 10 CV Buffer A2 and 10 CV Buffer B2 (50 mM Tris-HCl, 100 mM NaCl, 30 mM imidazole) and collect the eluent. Finally, wash the nickel column with 2.5 CV Buffer C2 (50 mM Tris-HCl, 100 mM NaCl, 500 mM imidazole) to elute and collect the target protein. Store on ice for subsequent desalting. All collected eluents were subjected to SDS-PAGE protein validation. The purification results are shown below. Figure 2 ,3.

[0124] Example 5: The reaction of EDDS lyase-catalyzed synthesis of ToxinA from fumaric acid and (S)-2,3-diaminopropionic acid (L-Dap) to ToxinA.

[0125] Using the EDDS lysin obtained in Example 4, fumaric acid (final concentration 60 mM) and L-Dap (final concentration 10 mM) solids were weighed into a 50 mL round-bottom flask. Approximately 30 mL of 20 mM NaH₂PO₄-NaOH buffer (pH 8.5) was added to adjust the pH to approximately 8.5. Then, 15 μM of EDDS lysin was added, and the volume was brought to 100 mL with 20 mM NaH₂PO₄-NaOH buffer (pH 8.5). The mixture was incubated at 25°C for 24 h, and the reaction was terminated by incubating in a 70°C water bath for 10 min. The conversion rate was monitored using 1H NMR spectroscopy. Specifically, 500 μL of the reaction solution was lyophilized, reconstituted with 500 μL of heavy water, centrifuged, and the supernatant was analyzed by 1H NMR. The conversion rate after 24 hours of reaction was 93%.

[0126] Example 6: Purification of Toxin A

[0127] The reaction solution from Example 5 was filtered through a 0.45 μm aqueous filter membrane, and the remaining L-Dap was removed using an anion exchange column: 15 g of acetic acid anion exchange resin (AG 1-X8 resin, 100-200 mesh) was weighed and allowed to stand overnight to fully swell; after packing the column (column volume approximately 20 mL), impurities were washed away with 5 Vc of deionized water until the pH of the effluent was neutral; the reaction solution was loaded onto the column, first eluting L-Dap with 5 Vc of deionized water, then eluting with 2 M acetic acid until the product eluted. The collected components were spotted onto a silica gel plate and monitored using the ninhydrin colorimetric method. The colorimetrically positive components were combined and loaded onto a cation exchange column to remove the remaining fumaric acid.

[0128] The cation exchange column was pretreated first: 15g of ammonia-form cation exchange resin (Dowex 50WX8 resin, 100-200 mesh) was weighed and allowed to swell completely overnight; it was then packed into a clean glass column with a column volume of approximately 20mL. The column was first washed with 5CV of 2M ammonia solution, then 3CV of 1M hydrochloric acid was added to convert it to the hydrogen form (until the pH of the effluent was 1); finally, 5CV of deionized water was added to rinse until the pH of the effluent was 7, indicating the conversion was complete.

[0129] The fractions purified by the anion exchange column were collected and loaded onto the cation exchange column. The remaining fumaric acid was first eluted with 5V deionized water, followed by elution with 2M ammonia until all product was eluted. The collected fractions were spotted onto a silica gel plate and monitored using the ninhydrin colorimetric method. The positively colored fractions were combined, rotary evaporated, and freeze-dried overnight. A total of 190.5 mg of the obtained solid was collected (yield 87%). NMR results are shown below. Figure 4 .

[0130] Example 7: The reaction of AMA synthase catalyzing the synthesis of (S,S,S)-AMA from Toxin A and OPS.

[0131] Using the AMA synthase obtained in Example 3, ToxinA (final concentration 5 mM) and OPS (final concentration 15 mM) solids obtained in Example 5 were weighed into a 50 mL round-bottom flask. Approximately 30 mL of 100 mM KH₂PO₄-K₂HPO₄ buffer (pH 7) was added to adjust the pH to approximately 7.0. Then, 15 μL of AMA synthase was added, and the volume was brought up to 40 mL with 100 mM KH₂PO₄-K₂HPO₄ (pH 7) buffer. The flask was incubated at 25°C for 3 hours. After the reaction was complete, the reaction was terminated by a 70°C water bath. 500 μL of the reaction supernatant was rapidly frozen in liquid nitrogen and freeze-dried for 12 hours. 500 μL of heavy water was added to the freeze-dried system to dissolve the AMA, and NMR spectroscopy showed a conversion rate of 98%.

[0132] Example 8: Purification of AMA

[0133] The reaction solution from Example 7 was used for purification using cation exchange resin: the treated AMA reaction solution was loaded onto the hydrogen-form cation exchange resin after conversion, and 5 column volumes of deionized water were added to wash away impurities; 5 column volumes of 0.5M or 2M ammonia water were added for elution; the collected solutions were spotted onto a TLC plate, immersed in ninhydrin reagent, and heated for color development to determine the tube containing the product. The ninhydrin-positive fractions obtained by ammonia elution were collected, evaporated to dryness, and the resulting solid was collected. The obtained crude AMA was recrystallized to obtain AMA with higher purity: 25 mg of the purified crude AMA was taken and gradually added to 75% methanol solution until it was completely dissolved; acetic acid with a final concentration of 1% was added to the solution, and the mixture was placed on ice and crystallized overnight at 4°C; the mixture was centrifuged at 12000 rpm and 4°C for 10 min, the supernatant precipitate was separated, and the supernatant was discarded; the precipitate was washed twice, resuspended in 500 μL of deionized water, flash-frozen in liquid nitrogen, freeze-dried overnight, and the resulting solid, 27.2 mg (yield 44.3%), was collected. MRI results as follows Figure 5 .

[0134] Example 9: EDDS lyase-catalyzed reaction of fumaric acid and (S)-2,4-diaminobutyric acid

[0135] The EDDS lysin obtained in Example 4 was used, with fumaric acid and 2,4-diaminobutyric acid as substrates. The substrate concentration, reaction conditions, and detection methods were the same as in Example 5. The product was named A1, and NMR showed a conversion rate of 93.4%.

[0136] Example 10: Purification of ((S)-3-amino-3-carboxypropyl)-L-aspartic acid (A1)

[0137] Using the reaction solution obtained in Example 9, excess 2,4-diaminobutyric acid was removed from the reaction using anion exchange resin: 15g of acetic acid-type anion exchange resin (AG 1-X8 resin, acetate form, 100-200 mesh) was weighed and allowed to stand overnight to fully swell; it was poured into a clean glass chromatography column, and the column volume was recorded as 20mL. 5CV of deionized water was added to wash the column material until the pH of the effluent was neutral; the treated reaction solution was loaded onto the column; 5CV of deionized water was added to wash away impurities; 3CV of 2M acetic acid was added to elute; the collected solutions were spotted onto a TLC plate, immersed in ninhydrin reagent, and heated for color development to determine the tube containing the product. The fraction showing ninhydrin was used to remove unreacted fumaric acid using a cation exchange resin: Weigh 15g of ammonium anion exchange resin (Dowex 50WX8 resin, 100-200 mesh), let it stand overnight to allow it to fully swell; pour it into a clean glass chromatography column, record the column volume as 20mL, add 5CV 2M ammonia to wash the column material; add 3CV 1M hydrochloric acid for conversion until the pH of the effluent solution is 1; then add 5CV deionized water to remove excess hydrochloric acid until the pH of the effluent solution is 7, indicating that the conversion is complete.

[0138] The ninhydrin-positive fractions obtained from elution with 2M acetic acid during anion exchange resin purification were collected and loaded onto the plate. Impurities were washed away with 5CV of deionized water. Elution with 3CV of 2M ammonia was then performed. The collected solutions were spotted onto a TLC plate, immersed in ninhydrin reagent, and heated for color development to identify the product in the tube. The ninhydrin-positive fractions eluted with 2M ammonia were collected, rotary evaporated at 45°C, flash-frozen in liquid nitrogen, and freeze-dried overnight. The resulting solid was collected (yield 60%). NMR results are shown below. Figure 6 .

[0139] Example 11: AMA synthase catalyzes the reaction of A1 and OPS

[0140] The AMA synthase obtained in Example 3 was used, with substrates A1 (final concentration 5 mM) and OPS (final concentration 35 mM) obtained in Example 9. The solid was placed in a 50 mL round-bottom flask, and approximately 30 mL of 100 mM NaH2PO4-NaOH buffer (pH 8.5) was added to adjust the pH to approximately 8.5. Then, 25 μM of AMA synthase was added, and the volume was brought up to 40 mL with 100 mM NaH2PO4-NaOH buffer (pH 8.5). The flask was incubated at 25°C for 4 hours. After the reaction was complete, the round-bottom flask was removed and the reaction was terminated by incubating in a 70°C water bath for 10 minutes. The detection method was the same as in Example 5. The product was named B1.

[0141] Example 12: Purification of ((S)-3-(((S)-2-amino-2-carboxyethyl)amino)-3-carboxypropyl)-L-aspartic acid

[0142] The reaction solution obtained in Example 11 was used for product purification using anion exchange resin: the reaction solution was loaded into a pre-treated acetic acid-based anion exchange resin; 5 column volumes of deionized water were added to wash away impurities, 5 column volumes of 0.5M acetic acid were used to remove substrate A1, and 5 column volumes of 1M acetic acid were added. The collected solutions were spotted onto a TLC plate, immersed in ninhydrin reagent, and heated for color development to identify the tube containing the product. The ninhydrin-positive fractions eluted with 1M acetic acid were collected, lyophilized by rotary evaporation, and the resulting solids were collected, with a yield of 22%. NMR results are shown below. Figure 7 .

[0143] Example 13: AMA synthase-catalyzed reaction of cysteine ​​and OPS

[0144] The AMA synthase obtained in Example 3 was used, with cysteine ​​(final concentration 5 mM) and OPS (final concentration 35 mM) as substrates. The solid was placed in a 50 mL round-bottom flask, and approximately 30 mL of 100 mM KH₂PO₄-K₂HPO₄ buffer (pH 7.0) was added to adjust the pH to approximately 7. Then, 6.25 μL of AMA synthase was added, and the volume was brought up to 40 mL with 100 mM KH₂PO₄-K₂HPO₄ buffer. The flask was incubated at 25°C for 4 hours. After the reaction was complete, the round-bottom flask was removed, and the reaction was terminated by bathing in a 70°C water bath. The detection method was the same as in Example 5. The product was named A2, and NMR showed a conversion rate of 99%.

[0145] Example 14: Purification of S-(2-aminoethyl)-L-cysteine

[0146] The reaction solution obtained in Example 13 was used, and the purification method was the same as in Example 6, except that the anion exchange resin was replaced with a hydroxyl-type anion exchange resin. The final product yield was 65%. NMR results are as follows: Figure 8 .

[0147] Example 15: EDDS lyase-catalyzed reaction of S-(2-aminoethyl)-L-cysteine ​​with fumarate

[0148] The EDDS lysin obtained in Example 4 was used, with A2 obtained in Example 14 and fumaric acid as substrates. The substrate concentration, reaction conditions, and detection methods were the same as in Example 5. The product was named B2, and NMR showed a conversion rate of 85%.

[0149] Example 16: Purification of 2-((S)-1-carboxypropylthio)ethyl)-L-aspartic acid

[0150] The reaction solution obtained in Example 15 was used, and the purification method was the same as that in Example 6. The final product yield was 29%. NMR results are as follows: Figure 9 .

[0151] Example 17: Expression and purification of AMA synthase mutant R234A

[0152] Using the constructed AMA synthase expression plasmid as a template, the corresponding DNA fragments were amplified using primers F and R, respectively, and the expression plasmid for R234A was constructed using the Quick-change method. The primer sequences used are as follows:

[0153] Pet28a-Pte-R234A-F CAGTGCCAGAGAAGCCGGACCCGGAACG

[0154] Pet28a-Pte-R234A-R CGTTCCGGGTCCGGCTTCTCTGGCACTG

[0155] The expression and purification method for the AMA synthase mutant R234A is the same as that for the AMA synthase.

[0156] Example 18: 3-Methylaspartate amino acid lyase-catalyzed reaction of ethylenediamine with fumaric acid

[0157] The methylaspartate lyase obtained in Example 4 was used. Fumarate (final concentration 86 mM) and ethylenediamine (final concentration 3 M) solids were placed in a 50 mL round-bottom flask. Approximately 30 mL of 20 mM NaH₂PO₄-NaOH buffer (pH 8.5) was added to adjust the pH to approximately 8.5. Then, 43 μM methylaspartate lyase was added, and the volume was brought up to 100 mL with 20 mM NaH₂PO₄-NaOH buffer. The reaction mixture was placed in a 25°C incubator and allowed to stand for 24 hours. After the reaction, the round-bottom flask was removed, and the reaction was terminated by a 70°C water bath. 500 μL of the reaction supernatant was rapidly frozen in liquid nitrogen and freeze-dried for 12 hours. 500 μL of heavy water was added to the freeze-dried mixture to dissolve the lyophilized product, yielding Toxin A. NMR spectroscopy showed a conversion rate of 99%.

[0158] Example 19: Purification of (2-aminoethyl)-L-aspartic acid

[0159] The reaction solution from Example 18 was used, and the specific purification method was the same as in Example 14. The product was named A3, and the final product yield was 82.3%. NMR results are as follows: Figure 10 .

[0160] Example 20: AMA-R234A-catalyzed reaction of (2-aminoethyl)-L-aspartic acid with OPS

[0161] The R234A mutant synthase obtained in Example 17 was used as a substrate, with (2-aminoethyl)-L-aspartic acid (final concentration 5 mM) and OPS (final concentration 35 mM). The solid was placed in a 50 mL round-bottom flask, and approximately 30 mL of 100 mM KH₂PO₄-K₂HPO₄ buffer (pH 7.0) was added. Then, 25 μM MAMA synthase was added, and the volume was brought up to 40 mL with 100 mM KH₂PO₄-K₂HPO₄. The flask was incubated at 25°C for 4 hours. After the reaction was complete, the round-bottom flask was removed, and the product was named B3. The conversion rate was calculated to be 30% by HPLC.

[0162] Example 21: Purification of (2-(((S)-2-amino-2-carboxyethyl)amino)ethyl)-L-aspartic acid

[0163] The reaction solution obtained in Example 20 was loaded into a pre-treated acetic acid-based anion exchange resin. Five column volumes of deionized water were added to wash away impurities. Elution was then performed with five column volumes of 0.1 M acetic acid. The acetic acid-eluted fraction was directly added to 2 M ammonia water, with the substrate eluted preferentially and the product eluted last. The collected solutions were spotted onto a TLC plate and immersed in ninhydrin reagent. The tubes showing ninhydrin activity were verified using NMR. The fractions showing product activity on the NMR were collected, rotary evaporated, lyophilized, and the resulting solid was collected. The yield was 22.8%. The NMR results are as follows: Figure 11 .

Claims

1. A mutant of AMA synthase, characterized in that, The amino acid sequence of the mutant AMA synthase is shown in SEQ ID NO.3, which is based on SEQ ID NO.1, where R is mutated to A at position 234, i.e., R234A.

2. A method for synthesizing AMA and its derivatives using a dual-enzyme combination, characterized in that, It is prepared by two methods: Method 1: The first step reaction uses compounds A and B as initial reactants, wherein A is fumaric acid, and CN lyase is used as a catalyst to synthesize optically pure aspartic acid derivatives. The second step reaction uses serine donors and the product separated in the first step reaction as substrates, and AMA synthase with the amino acid sequence shown in SEQ ID NO. 1 as a catalyst, or biological materials containing the AMA synthase encoding gene as a catalyst, to synthesize AMA and its derivatives; wherein the general formula of AMA and its derivatives is as follows: Where X represents NH, R represents H or COOH, and m = 1 or 2; The compound B is ethylenediamine, 2,3-diaminopropionic acid, or 2,4-diaminobutyric acid; The serine donor is O-phosphoserine; the CN lyase is EDDS lyase or 3-methylaspartate amino acid lyase Q73A mutant, and the 3-methylaspartate amino acid lyase Q73A mutant is the Q73A variant of GenBank No. AAB24070.1; Or method 2: The first step reaction uses serine donor and cysteine ​​as substrates, and AMA synthase with the amino acid sequence shown in SEQ ID NO.1 as catalyst or biological material containing the AMA synthase encoding gene as catalyst to synthesize S-substituted L-cysteine. The second step reaction uses fumaric acid and the product separated in the first step as substrates, and CN lyase as a catalyst to synthesize AMA derivatives; the resulting AMA derivatives have the following general structural formula: Where X represents S, R represents H, and m = 1; Compound B is ethylenediamine, 2,3-diaminopropionic acid, or 2,4-diaminobutyric acid; the serine donor is O-phosphoserine; the CN lyase is EDDS lyase or a 3-methylaspartate amino lyase Q73A mutant; and the 3-methylaspartate amino lyase Q73A mutant is the Q73A variant of GenBank No. AAB24070.

1.

3. The method according to claim 2, characterized in that, Method 1: In the first step reaction, the concentration ratio of fumaric acid to diamine compounds is 10:1-1:35, the initial substrate concentration is 10-100 mM, and the concentration of C-N lyase is 0.05-0.5 mol; in the second enzymatic reaction, the concentration ratio of aspartic acid derivative to oxyphosphoserine is 1:3-1:10, the initial substrate concentration is 10-100 mM, and the concentration of AMA synthase is 0.05-0.5 mol.

4. The method according to claim 3, characterized in that, The AMA derivatives are selected from compounds with the following structures: ， ， ， 。

Images