A mutant of the cbh i signal peptide of trichoderma reesei and its application in promoting efficient expression and secretion of heterologous proteins

Abstract

The present application relates to a Trichoderma reesei CBHI signal peptide mutant and its application in promoting efficient expression and secretion of heterologous proteins. The amino acid sequence of the Trichoderma reesei CBHI signal peptide mutant SPM1 is shown as SEQ ID NO. 1, and the nucleotide sequence is shown as SEQ ID NO. 2. The present application increases two leucines after the fourth lysine of the Trichoderma reesei CBHI signal peptide to obtain the Trichoderma reesei CBHI signal peptide mutant SPM1. The mutant enhances the guiding ability of heterologous proteins and can effectively promote the expression and secretion of the heterologous protein XynST11. In the process of expression and secretion of the heterologous protein XynST11, the introduction of the Trichoderma reesei CBHI signal peptide mutant SPM1 can greatly improve the secretion amount of XynST11 in the extracellular medium and the average xylanase enzyme activity produced by XynST11 in the fermentation broth, reaching 25 U / mL, which is much higher than that of the CBHI signal peptide. Therefore, the Trichoderma reesei CBHI signal peptide mutant SPM1 has great application value in promoting the expression and secretion of heterologous proteins and preparing xylanase.

Description

Technical Field

[0001] This invention relates to a Trichoderma reesei CBHI signal peptide mutant and its application in promoting the efficient expression and secretion of heterologous proteins, belonging to the field of bioengineering technology. Background Technology

[0002] Lignocellulose is a major component of biomass resources, and its development and utilization are of significant strategic importance to my country's economic development, environmental protection, and other core social issues. The filamentous fungus *Trichoderma reesei* is an outstanding representative of highly efficient cellulose degradation in nature. *Trichoderma reesei* possesses a powerful capacity for cellulase synthesis and secretion, with an extremely high content of the exonuclease CBHI in its extracellular cellulase system, accounting for over 60% of the total secreted proteins. Due to its highly efficient protein synthesis and secretion capabilities, high safety, and availability of inexpensive raw materials, *Trichoderma reesei* has also been developed as a chassis cell for the expression and secretion of heterologous proteins.

[0003] The secretion of proteins facilitates downstream purification and scale-up of target protein products. In the protein expression and secretion processes of eukaryotes, the N-terminal signal peptide sequence plays a crucial role. The signal peptide mediates the smooth entry of newly secreted proteins into the endoplasmic reticulum (ER), completing ER translocation. Only then can the newly secreted proteins fold, undergo processing and modification within the ER, and proceed to subsequent transport stages. Therefore, an efficient signal peptide sequence can effectively promote the production level of secreted proteins. Since CBHI is the endogenous protein with the highest secretion level in *Trichoderma reesei*, its efficient signal peptide sequence (17 amino acids at the N-terminus) is currently commonly used to guide the secretion synthesis of heterologous proteins. However, the low secretion production level of heterologous recombinant proteins is frequently encountered. Therefore, it is necessary to develop more efficient mutant sequences based on the efficient signal peptide sequence of CBHI to further promote the efficient secretion production of heterologous proteins and drive the development and upgrading of *Trichoderma reesei* chassis cells. Currently, however, there is no corresponding technology. Summary of the Invention

[0004] To address the problems existing in the prior art, this invention provides a Trichoderma reesei CBHI signal peptide mutant and its application in promoting the efficient expression and secretion of heterologous proteins.

[0005] The technical solution of this invention is as follows:

[0006] A Trichoderma reesei CBHI signal peptide mutant, SPM1, has the following mutation relative to the Trichoderma reesei CBHI signal peptide: the addition of two leucines after the fourth lysine.

[0007] The amino acid sequence of the Trichoderma reesei CBHI signal peptide is: MYRKLAVISAFLATARA.

[0008] According to a preferred embodiment of the present invention, the amino acid sequence of the Trichoderma reesei CBHI signal peptide mutant SPM1 is shown in SEQ ID NO. 1.

[0009] According to a preferred embodiment of the present invention, the nucleotide sequence of the Trichoderma reesei CBHI signal peptide mutant SPM1 is shown in SEQ ID NO.2.

[0010] A second aspect of the invention provides an expression cassette and a recombinant vector containing the coding gene of the Trichoderma reesei CBHI signal peptide mutant SPM1. The recombinant vector is not particularly limited to a starting vector and can be any vector known in the art, as long as it can replicate in the host. For example, the vector includes, but is not limited to, plasmids and bacteriophages. Once transformed into a suitable host, the vector can replicate and function independently of the host genome, or in some cases, integrate into the genome itself.

[0011] According to a preferred embodiment of the present invention, the recombinant vector is obtained by ligating the coding gene of the Trichoderma reesei CBHI signal peptide mutant SPM1 with an expression vector, wherein the expression vector is a plasmid.

[0012] More preferably, the plasmid is pUC19-Ptcu1-pyr4site.

[0013] A third aspect of the invention provides a recombinant host cell containing the coding gene of the *Trichoderma reesei* CBHI signal peptide mutant SPM1. The term "host cell" has the meaning commonly understood in the art; it refers to a host cell capable of receiving the coding gene of the mutant of the present invention, and is thus called a recombinant host cell. The strain of the present invention may be *Trichoderma reesei* QM9414.

[0014] In a fourth aspect, the present invention provides the application of the above-mentioned Trichoderma reesei CBHI signal peptide mutant SPM1 in promoting the efficient expression and secretion of heterologous proteins.

[0015] According to a preferred embodiment of the present invention, the heterologous protein is a heteroxylanase.

[0016] Experimental procedures not described in detail in this invention can be performed according to conventional experimental procedures in this technical field.

[0017] Beneficial effects

[0018] This invention uses the *Trichoderma reesei* CBHI signal peptide as a base and adds two leucine residues after the fourth lysine residue to obtain the *Trichoderma reesei* CBHI signal peptide mutant SPM1. This mutant enhances the ability to guide heterologous proteins and can effectively promote the expression and secretion of the heterologous protein XynST11. After introducing the *Trichoderma reesei* CBHI signal peptide mutant SPM1 into the expression and secretion process of the heterologous protein XynST11, the secretion amount of XynST11 in the extracellular culture medium and the activity level of xylanase produced by XynST11 in the fermentation broth were significantly increased, reaching 25 U / mL, which is much higher than that of the CBHI signal peptide. Therefore, the *Trichoderma reesei* CBHI signal peptide mutant SPM1 has great application value in promoting the expression and secretion of heterologous proteins and preparing xylanase. Attached Figure Description

[0019] Figure 1 This is a schematic diagram comparing the original sequence of the CBHI signal peptide and the sequence of the CBHI signal peptide mutant SPM1.

[0020] Figure 2 This is a schematic diagram of the strains constructed to guide the expression and secretion of heteroxylanase XynST11 using the CBHI signal peptide and the CBHI signal peptide mutant SPM1, respectively.

[0021] Figure 3 Agarose gel electrophoresis images showing successful construction of xylanase XynST11 expression strains guided by CBHI signal peptide and CBHI signal peptide mutant SPM1, respectively.

[0022] Figure 4 A comparison of the expression and secretion levels of heteroxylanase XynST11 induced by CBHI signal peptide and CBHI signal peptide mutant SPM1, respectively.

[0023] Figure A shows the activity level of xylanase produced by XynST11 in the extracellular fermentation broth; Figure B shows the Western blot analysis of XynST11 in the extracellular fermentation broth. Detailed Implementation

[0024] The present invention will be further described below with reference to embodiments and accompanying drawings, but the scope of protection of the present invention is not limited thereto. Unless otherwise specified, the drugs and reagents involved in the embodiments are all commercially available products; unless otherwise specified, the experimental operations involved in the embodiments are all conventional operations in the art. The primers in the embodiments were all synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0025] The starting strain in the examples, Trichoderma reesei QM9414, is an existing strain that can be purchased from the American Culture Collection Center (ATCC) with accession number ATCC 26921.

[0026] Trichoderma reesei QM9414-Δpyr4 is obtained by knocking out the pyr4 gene in Trichoderma reesei QM9414. The construction method can be found in the literature: A novel transcriptional regulator RXE1 modulates theessential transactivator XYR1 and cellulase gene expression in Trichoderma reesei.

[0027] Example 1: Construction of a vector for the expression and secretion of the heterologous protein XynST11 guided by CBHI signal peptide and its mutant SPM1

[0028] 1. Construction of a vector for the expression and secretion of heteroxylanase XynST11 guided by the CBHI signal peptide.

[0029] (1) Primers xynST11F / xynST11R were designed. Using a plasmid containing the full-length sequence of the xylanase gene xynST11 from Streptomyces (see the article Biochemical Characterization of Xylanases from Streptomyces sp.B6 and Their Application in the Xylooligosaccharide Production from Viscose Fiber Production Waste. Liu L, Xu M, Cao Y, Wang H, Shao J, Xu M, Zhang Y, Wang Y, Zhang W, Meng X, Liu WJ Agric Food Chem. 2020 Mar 11; 68(10):3184-3194.) as a template, the cDNA coding fragment of xylanase XynST11 (Asp42-Ser331, excluding its own signal peptide coding sequence and stop codon) was amplified by PCR. The fragment was about 0.7kb in length. Simultaneously, primers xynST11-GFPF / xynST11-GFPR were designed to amplify the full-length cDNA coding sequence of green fluorescent protein sfGFP. The two fragments were then ligated using conventional overlap extension PCR to obtain the xynST11-sfGFP fragment, approximately 1.6 kb in length. Further primers cbh1-SPF1 / cbh1-SPF2 were designed, and nested PCR was used to load the coding sequence of the CBHI signal peptide (ATGTATCGGAAGTTGGCCGTCATCTCGGCCTTCTTGGCCACAGCTCGTGCT) into the 5' end of the xynST11-sfGFP fragment, generating the cbh1SP-xynST11-sfGFP fragment sequence.

[0030] The primer sequences are as follows:

[0031] xynST11F:5'-CCTTTCTTGGCCACAGCTCGTGCTGACACCTACGTCGATACGAACCAGA T-3';

[0032] xynST11R:5'-GTATCGACGTAGGTGTCAGCGGTTCCCGATCC-3';

[0033] xynST11-GFPF:5'-CTCGTGCTCGACCTCGGGTGGAGGTGGAGGTTCTATGGTGAGCA AGGGCGA-3';

[0034] xynST11-GFPR:5'-TGATTTCAGTAACGTTAAGTCTTAAGTTACTTGTACAGCTCGTCCA TGCCG-3';

[0035] cbh1-SPF1:5'-ACGACCTGGTTGATACGACAGGCGCGCCATGTATCGGAAGTTGGCCG TCATCT-3';

[0036] cbh1-SPF2:5'-CGGAAGTTGGCCGTCATCTCGGCCTTCTTGGCCACAGCTCGTGCT-3'.

[0037] The PCR amplification system was as follows: 2 μL of 10 μM upstream primer, 2 μL of 10 μM downstream primer, 10 ng of genomic DNA, 5 μL of 2.5 mM dNTP mixture, 10 μL of 5× TransStart FastPfu buffer, 1 μL of TransStartFastPfu DNA polymerase, and ddH2O to a final volume of 50 μL.

[0038] The PCR amplification program was as follows: 98℃ pre-denaturation for 5 min; 95℃ denaturation for 30 sec, 58℃ annealing for 30 sec, 72℃ extension for 3 min, 30 cycles; 72℃ final extension for 10 min; after PCR, 1% agarose gel electrophoresis was performed, and the DNA fragments were recovered.

[0039] (2) Primers upF / upR and downF / downR were designed and amplified by PCR to obtain downstream homologous arm fragments of the Trichoderma reesei pyr4 gene, which were approximately 2kb and 1.5kb, respectively.

[0040] The upstream and downstream homologous arm fragments of the pyr4 gene were ligated into the vector pUC19-hph, which contains the hph expression cassette of the hygromycin resistance gene. The upstream and downstream homologous arm fragments were located on either side of the hph expression cassette. Then, the Trichoderma reesei constitutive promoter tcu1 and terminator TrpC were sequentially introduced between the upstream homologous arm and the hph expression cassette, thus successfully constructing the recombinant expression vector pUC19-Ptcu1-pyr4site driven by promoter tcu1 and pyr4 site-directed. Finally, the amplified fragment cbh1SP-xynST11-sfGFP was ligated into this recombinant expression vector, located between the promoter and terminator, resulting in the recombinant expression vector Ptcu1-cbh1SP-xynST11.

[0041] The primer sequences are as follows:

[0042] upF:5'-GAATTCGAGCTCGGTACCCGGGATGATAATGGACTGGACCG-3';

[0043] upR: 5'-ATTCTTATAATCTCTAGAGGATCCTACCCGATATTGCGACTTT-3';

[0044] downF: 5'-AGACTAGTCCAATCGTCGACGGGAGGGAAGGGAAGAAAGAAGTAA-3';

[0045] downR: 5'-ACCATGATTACGCCAAGCTTCTCGTAGGCGCAGTGGGCTT-3'.

[0046] The PCR amplification system and amplification procedure are the same as above.

[0047] 2. Construction of a vector for the expression and secretion of heteroxylanase XynST11 guided by the CBHI signal peptide mutant SPM1

[0048] Primer SPM1F was designed to insert two codon sequences encoding lysine between the codon sequences corresponding to the fifth and sixth amino acids of the CBHI signal peptide, resulting in the *Trichoderma reesei* CBHI signal peptide mutant SPM1. The amino acid sequence of the *Trichoderma reesei* CBHI signal peptide mutant SPM1 is shown in SEQ ID NO.1, and the nucleotide sequence is shown in SEQ ID NO.2. Then, using SPM1F / xynST11-GFPR as primers and the obtained cbh1SP-xynST11-sfGFP fragment as a template, the fragment SPM1-xynST11-sfGFP was amplified by PCR.

[0049] The primer sequences are as follows:

[0050] SPM1F:5'-ACGACCTGGTTGATACGACAGGCGCGCCATGTATCGGAAGTTGTTGTTGG CCG-3';

[0051] xynST11-GFPR:5'-TGATTTCAGTAACGTTAAGTCTTAAGTTACTTGTACAGCTCGTCCA TGCCG-3'.

[0052] The constructed SPM1-xynST11-sfGFP fragment was ligated into the recombinant expression vector pUC19-Ptcu1-pyr4site to construct the recombinant expression vector Ptcu1-SPM1-xynST11.

[0053] In this embodiment, the original sequence of the CBHI signal peptide and the amino acid sequence of the CBHI signal peptide mutant SPM1 are compared as follows: Figure 1 As shown.

[0054] Example 2: Construction of strains for the expression and secretion of heteroxylanase XynST11 guided by CBHI signal peptide and CBHI signal peptide mutant SPM1

[0055] 1. Preparation of Trichoderma reesei protoplasts

[0056] The preparation concentration is 5×10 7 ~5×10 8 A suspension of *Trichoderma reesei* QM9414-Δpyr4 spores per mL was inoculated (1 mL) into 50 mL of MM liquid medium and cultured at 28°C and 160 rpm for 16 h to obtain mycelial culture. The mycelial culture was centrifuged at 4000 rpm for 5 min, the supernatant was discarded, and cell wall lysis enzyme solution was added. The culture was resuspended and enzymatically digested at 30°C and 60 rpm for 2.5–3 h. Microscopic observation was performed. When a large number of free protoplasts appeared, the culture was filtered using a G2 funnel. The filtrate was centrifuged at 4°C and 3500 rpm for 5 min to collect the protoplasts. The collected protoplasts were washed twice with 15 mL of pre-chilled STC solution and then resuspended in pre-chilled STC solution to achieve a protoplast concentration of 5 × 10⁻⁶. 7 ~5×10 8 The number of samples per mL was measured; all of the above procedures were performed on ice.

[0057] The components of MM liquid culture medium are as follows (all are mass percentages): 1% glucose, 0.5% (NH4)2SO4, 1.5% KH2PO4, 0.1% peptone, adjust the pH to 5.0-5.5 with NaOH, add 0.6 g / L MgSO4 and 0.4 g / L CaCl2 before use, and add trace elements (final concentration 1×, stock solution 1000×) and 10 mM uridine.

[0058] The 1000× trace element mother liquor formula is as follows: FeSO4·7H2O 0.5g, MnSO4·H2O 0.16g, ZnSO4·7H2O 0.14g, CoC l2 • 0.2g of 2H2O, diluted to 100mL with ddH2O, and filtered for sterilization;

[0059] The components of the cell wall lysin solution are as follows: 0.24 g of cell wall lysin is dissolved in 5.7 mL of 0.7 M NaCl solution, filtered for sterilization, and 0.3 mL of pH 5.8 PBS buffer is added.

[0060] The STC solution consists of the following components: 0.7M D-sorbitol, 0.05M CaCl2, 10mM Tris-HCl, pH 7.5.

[0061] 2. Transformation of recombinant expression vectors and regeneration of transformants

[0062] Take 150 μL of the recombinant expression vectors Ptcu1-cbh1SP-xynST11 and Ptcu1-SPM1-xynST11 obtained in Example 1, linearize the vectors using the restriction endonuclease MssI, and purify and recover the fragments. Mix them with 150 μL of Trichoderma reesei QM9414-Δpyr4 protoplasts prepared in step 1, and add them to the bottom of a 10 mL centrifuge tube. After incubating on ice for 20 min, add 1.5 mL of pre-cooled PTC solution dropwise, incubate on ice for 20 min, and then place at room temperature for 20 min. Add 2 mL of STC solution and mix well to obtain the transformation solution. Spread the transformation solution on a regeneration medium plate that does not contain uridine and incubate at 28 °C for 5-7 days.

[0063] The PTC solution consists of the following components: 60% PEG 4000 (polyethylene glycol 4000) by mass / volume ratio (w / v), 10 mM Tris-HCl, 10 mM CaCl2, and pH 7.5.

[0064] The regeneration medium consists of the following components (all by mass percentage): 1% glucose, 0.5% (NH4)2SO4, 1.5% KH2PO4, 1M D-sorbitol, and 1.5% agar powder. Adjust the pH to 5.0-5.5 with NaOH. Before use, add 0.6 g / L MgSO4 and 0.4 g / L CaCl2 to a final concentration, and add trace elements (final concentration 1×, stock solution 1000×). The 1000× trace element stock solution formula is the same as above.

[0065] The colonies grown on the above regeneration medium were transferred to a selection medium that does not contain uridine and cultured at 28°C for 5–7 days to obtain transformants.

[0066] The screening medium consists of the following components (all by weight percentage): 1% glucose, 0.5% (NH4)2SO4, 1.5% KH2PO4, and 1.5% agar powder. The pH is adjusted to 5.0-5.5 with NaOH. Before use, MgSO4 and CaCl2 are added to a final concentration of 0.6 g / L and 0.4 g / L respectively, along with trace elements (final concentration 1×, stock solution 1000×). The 1000× trace element stock solution formula is the same as above.

[0067] After transforming the recombinant expression vectors Ptcu1-cbh1SP-xynST11 and Ptcu1-SPM1-xynST11 into Trichoderma reesei protoplasts, the upstream and downstream homologous arm sequences of the pyr4 gene carried on the recombinant expression vectors undergo homologous recombination with the upstream and downstream regions of the pyr4 gene in the genome. The signal peptide-guided XynST11 expression cassette and the selection marker hph are integrated into the site between the upstream and downstream homologous arms of pyr4, thereby achieving the purpose of obtaining the corresponding expression strain.

[0068] In this embodiment, a schematic diagram of the strains constructing the heteroxylanase XynST11 expression and secretion guided by the CBHI signal peptide and the CBHI signal peptide mutant SPM1 is shown below. Figure 2 .

[0069] 3. Validation and acquisition of recombinant Trichoderma reesei strains

[0070] Genomic DNA was extracted from the transformants. Using the genomic DNA as a template, PCR was employed to verify the upstream and downstream homologous arm sequences. The upstream homologous arm sequence verification primers were AnUp-F and An-R, with a target band length of approximately 2.5 kb; the downstream homologous arm sequence verification primers were An-F / AnUp-R, with a target band length of approximately 1.5 kb. The primer sequences are as follows:

[0071] AnUp-F:5'-TCAAGGGTTCACGAAAGACG-3';

[0072] An-R:5'-CTCACGCCTCTGTCTGTAAT-3';

[0073] An-F:5'-GAAACCGACGCCCCAGCACT-3';

[0074] AnDown-R:5'-CCGTAGCCGTGGCGGTCATT-3'.

[0075] Transformants with correctly anchored upstream and downstream homologous arms were purified using a single-spore isolation method. PCR was then performed using In-F and In-R primers to verify the internal gene between the upstream and downstream homologous arms of pyr4. No target band was observed, indicating that the internal gene was successfully replaced by the expression cassette and the selection marker hph, confirming successful construction of the expression strain. The verification results are as follows: Figure 3 As shown.

[0076] The primer sequences are as follows:

[0077] In-F:5'-GACCTCGCCGGGACGTGCAA-3',

[0078] In-R:5'-TCTTTAGCTTTGACCGGTGAGCCGG-3'.

[0079] The above verification PCR reaction system was 20 μL. For specific reaction system and reaction conditions, please refer to the GenStar2×TaqPCR StarMix (purchased from Wuhan Feiyi Technology Co., Ltd.) instruction manual.

[0080] Depend on Figure 3 It was found that in the upstream and downstream homologous arm sequence anchoring verification, the starting strain *Trichoderma* QM9414-Δpyr4 showed no target band, while the recombinant protein expression strain showed a bright target band in both upstream and downstream homologous arm sequence verification. The upstream homologous arm band was approximately 2.5 kb in size, and the downstream homologous arm band was approximately 1.5 kb in size, both consistent with the expected band sizes. In the internal gene verification, the starting strain *Trichoderma* QM9414-Δpyr4 showed a bright target band with a band size of approximately 1.5 kb, while the recombinant strain did not show this band, indicating that the target recombinant strains cbh1SP-xynST11 and SPM1-xynST11 were successfully obtained. This demonstrates that the CBHI signal peptide-guided XynST11 expression strain and the CBHI mutant signal peptide SPM1-guided XynST11 expression strain were both successfully constructed and named recombinant *Trichoderma reesei* cbh1SP-xynST11 and SPM1-xynST11, respectively.

[0081] Example 3: Analysis of the expression and secretion levels of CBHI signal peptide and its mutant SPM1-guided heteroxylanase XynST11

[0082] The spores of recombinant Trichoderma reesei cbh1SP-xynST11, SPM1-xynST11 and the starting strain QM9414-Δpyr4 obtained in Example 2 were inoculated into MA liquid medium containing 0.2% peptone and 1% glycerol, respectively, and cultured in a shaker at 30°C and 200 rpm for 36 h. An equal amount of wet weight mycelium (about 2 g) was then transferred to MA liquid medium containing 2% glucose, and the extracellular fermentation broth was collected at 48 h, 72 h and 96 h, respectively.

[0083] The MA liquid culture medium formula is as follows: Add 17.907g Na2HPO4·12H2O, 1.4g (NH4)2SO4, 2.0g KH2PO4, 0.3g urea, and 0.5mL Tween-80 per 1L of medium, and adjust the pH to 5.0 with anhydrous citric acid. Before use, add 0.6g / L MgSO4, 0.4g / L CaCl2, and trace elements (final concentration 1×, stock solution 1000×), and 10mM uridine. The 1000× trace element stock solution formula is: 0.5g FeSO4·7H2O, 0.16g MnSO4·H2O, 0.14g ZnSO4·7H2O, and CoC. l2 · 0.2g of 2H2O, bring the volume to 100mL with ddH2O, and filter to sterilize.

[0084] 1. Analysis of xylanase activity in fermentation broth

[0085] The method for analyzing xylanase activity is as follows: Take 20 μL of fermentation broth diluted 10-fold and 100 μL of xylan substrate (0.5%, w / v) dissolved in acetate-sodium acetate buffer (pH 6), mix thoroughly, and react at 70℃ for 30 min. Then add 120 μL of DNS (3,5-dinnitrosalicylic acid), mix, and boil for 10 min to terminate the reaction. After cooling, take the reaction solution and read the absorbance of the product at a wavelength of 550 nm. The results are as follows. Figure 4 As shown in Figure A.

[0086] One unit of xylanase activity is defined as the amount of enzyme required to produce 1 μmol of reducing sugar per minute.

[0087] Depend on Figure 4 As shown in Figure A, the fermentation broth of recombinant *Trichoderma reesei* cbh1SP-xynST11, which expresses XynST11 guided by the CBHI signal peptide, showed no significant XynST11 activity, indicating extremely low expression and secretion levels of XynST11. Similarly, the fermentation broth of the starting strain QM9414-Δpyr4 also showed no significant XynST11 activity. However, in the fermentation broth of recombinant *Trichoderma reesei* SPM1-xynST11 guided by the CBHI signal peptide mutant SPM1, the XynST11 activity was significantly increased, reaching approximately 25 U / mL after 96 h of fermentation, indicating that the expression and secretion of XynST11 were greatly promoted under the guidance of the CBHI signal peptide mutant SPM1.

[0088] 2. Western blot analysis of extracellular fermentation broth

[0089] To further verify the above enzyme activity assay results, a sensitive Western blot method was used to quantify the secretion level of xylanase Xyn11ST in the extracellular fermentation broth of recombinant Trichoderma reesei cbh1SP-xynST11, SPM1-xynST11, and the starting strain QM9414-Δpyr4. As described in Example 1, xylanase XynST11 is terminally tagged with sfGFP; therefore, a GFP antibody was used for Western blot analysis, and the results are as follows. Figure 4 As shown in B.

[0090] Depend on Figure 4 As shown in Figure B, the molecular weight of the protein displayed by the hybridization bands is consistent with the predicted molecular weight (53.8 kDa). Furthermore, the brightness analysis of the hybridization bands indicates that the expression and secretion level of xylanase XynST11 guided by the CBHI signal peptide mutant SPM1 is significantly higher than that of the CBHI signal peptide. This further verifies that the CBHI signal peptide mutant SPM1 significantly promotes the expression and secretion level of heterologous xylanase XynST11, and has great application value in promoting the expression and secretion of heterologous proteins and preparing xylanases.

Claims

1. A type of Trichoderma reesei ( Trichoderma reesei ) CBHI signal peptide mutant SPM1, characterized in that, Its amino acid sequence differs from that of the Trichoderma reesei CBHI signal peptide only in the following mutation: the addition of two leucines after the fourth lysine. The amino acid sequence of the Trichoderma reesei CBHI signal peptide is: MYRKLAVISAFLATARA.

2. The encoding gene of the Trichoderma reesei CBHI signal peptide mutant SPM1 as described in claim 1.

3. The encoding gene as described in claim 2, characterized in that, The nucleotide sequence is shown in SEQ ID No.

2.

4. A recombinant vector containing the encoding gene of the Trichoderma reesei CBHI signal peptide mutant SPM1 as described in claim 2.

5. A recombinant host cell containing the encoding gene of the Trichoderma reesei CBHI signal peptide mutant SPM1 as described in claim 2.

6. The application of the gene encoding the Trichoderma reesei CBHI signal peptide mutant SPM1 as described in claim 1, or the Trichoderma reesei CBHI signal peptide mutant SPM1 as described in claim 2, in promoting the efficient expression and secretion of heterologous proteins in Trichoderma reesei, wherein the heterologous protein is a heteroxylanase.

Images