Exosome loaded with vegf-mrna and a method of preparing the same

Abstract

The application discloses an exosome loaded with VEGF-mRNA and a preparation method thereof, and the preparation method comprises the following steps: screening a single-stranded nucleotide sequence for VEGF-mRNA by using SELEX technology; selecting an MS2 nucleotide sequence with a neck ring structure according to the RNA-protein interaction principle; linking the single-stranded nucleotide sequence and the MS2 nucleotide sequence to obtain a composite nucleotide aptamer which can specifically recognize VEGF-mRNA and MCP protein sites in two directions; constructing a lentivirus plasmid carrier containing the composite nucleotide aptamer sequence and a CD9-MCP fusion protein translation sequence, and then performing cell transfection, culture, supernatant collection and extraction to obtain the exosome loaded with VEGF-mRNA; and the preparation method can load VEGF-mRNA in the exosome, so that the prepared exosome can promote HUVEC cell proliferation and migration, and can better induce HUVEC cells to form blood vessels.

Description

Technical Field

[0001] This invention relates to the field of bioengineering technology, specifically to an exosome loaded with VEGF-mRNA and its preparation method. Background Technology

[0002] Angiogenesis and revascularization play a crucial role in improving the survival rate of skin grafts and arbitrary flap transfers, as well as promoting wound healing. One of the common complications after plastic surgery is partial or even complete necrosis of the graft due to impaired blood supply. However, currently, there is no effective drug or method in clinical practice that can promote angiogenesis or revascularization of transplanted tissues after surgery, thereby improving the survival rate of skin grafts and flaps.

[0003] Exosomes are nanoscale vesicles discovered in recent years that can be secreted by all cell types and possess intercellular communication functions. As a natural drug carrier, exosomes can carry small molecules with biological functions, such as DNA, mRNA, miRNA, and lncRNA. Therefore, through engineering, exosomes can be designed to carry specific target molecules, thereby directly delivering these molecules into target cells or tissues to achieve certain therapeutic effects. Currently, there is no publicly available research on engineered stem cell exosomes with enhanced angiogenesis-promoting functions. Summary of the Invention

[0004] The purpose of this invention is to provide an exosome loaded with VEGF-mRNA and a method for preparing the same. This method can load VEGF-mRNA into exosomes, enabling the exosomes to promote the proliferation and migration of HUVEC cells, and to better induce HUVEC cells to form blood vessels.

[0005] In order to achieve the above-mentioned objectives of the present invention, the following technical solution is adopted:

[0006] The first aspect of this invention provides a method for preparing exosomes loaded with VEGF-mRNA, the method comprising the following steps:

[0007] (a) The SELEX technique was used to screen for single-stranded nucleotide sequences targeting VEGF-mRNA, wherein the AUG terminus of the single-stranded nucleotide sequence is capable of specifically binding to the target mRNA;

[0008] (b) Select an MS2 nucleotide sequence with a neck-loop structure based on the principle of RNA-protein interaction, wherein the stem-loop structure can recognize the MCP site linked by the exosome transmembrane protein CD9;

[0009] (c) Link the single-stranded nucleotide sequence and the MS2 nucleotide sequence to obtain a complex nucleotide aptamer that specifically bidirectionally recognizes VEGF-mRNA and MCP protein sites;

[0010] (d) Construct a lentiviral plasmid vector containing the complex nucleotide aptamer sequence and the translation sequence of the CD9-MCP fusion protein, and then transfect, culture, collect the supernatant, and extract the VEGF-mRNA-loaded exosomes.

[0011] The inventors of this application have discovered that the method of using nucleic acid aptamers to bind to the transmembrane protein of exosomes can specifically bind to a certain mRNA in the cell, thereby loading the target mRNA into the exosome. The exosome membrane protects the mRNA from being degraded by other enzymes. After the target cell endocytoses the exosomes, the mRNA can directly enter the target cell and perform translation function.

[0012] mRNA delivery is the most direct and effective means of altering the expression of a certain functional protein in a target tissue. It is currently used primarily in vaccine development. Theoretically, an exosome vesicle (radius = 10-70 nm) can carry more than one mRNA with a molecular weight of about 2000 nt (radius = 16.5-58.3 nm). However, due to its large molecular weight and the ease with which it forms a composite structure with proteins such as ribosomes, it is difficult to load into exosomes naturally. Therefore, it is necessary to use Aptamer to transfer it into exosomes.

[0013] Aptamer is a nucleotide sequence of approximately 20-70 bases selected from a nucleotide library, exhibiting high specificity and affinity for specific ions, molecules, proteins, and cells. It binds to its target by folding into a tertiary structure. Similar to biological antibodies, it possesses strong affinity and specificity for target molecules, hence its designation as a "chemical antibody." Aptamers capable of binding to many targets, such as metal ions, small molecules, proteins, viruses, and cells, have been identified. Compared to biological antibodies, Aptamer exhibits several advantages: First, Aptamer is a chemically synthesized molecule, resulting in low synthesis costs, a simple process, and minimal batch-to-batch variation. Second, its chemical properties allow for simple and controllable chemical modification at different sites and functional groups, enabling molecular diagnostics and treatment for various purposes. Third, because recognition is based on its higher-order structure, and the reversibility between different structures in nucleic acid sequences, it possesses acid, alkali, and heat resistance properties; the screening, design, and synthesis of aptamers are now commercialized.

[0014] The preparation method of this invention first uses the systematic evolution of ligands by exponential enrichment (SELEX) technology to screen for single-stranded nucleotide sequences targeting VEGF-mRNA. This single-stranded portion specifically binds to VEGF-mRNA at the AUG end through base pairing. In addition, based on the principle of RNA-protein interaction, a stem-loop structure MS2 nucleotide sequence is selected. This structure can recognize the MCP site linked to the exosome transmembrane protein CD9. The combined suitable ligand formed by the two sequences can load VEGF-mRNA into exosomes through bidirectional recognition.

[0015] Preferably, the single-stranded nucleotide sequence is as shown in SEQ ID NO:1.

[0016] Preferably, the MS2 nucleotide sequence is as shown in SEQ ID NO:2.

[0017] Preferably, the coding sequence of the CD9-MCP fusion protein is shown in SEQ ID NO:3.

[0018] A second aspect of the present invention provides an exosome loaded with VEGF-mRNA prepared by the above preparation method.

[0019] A third aspect of the present invention provides the use of exosomes loaded with VEGF-mRNA prepared by the above-described method in the preparation of products that promote the proliferation and / or migration of HUVEC cells.

[0020] The fourth aspect of the present invention provides the use of exosomes loaded with VEGF-mRNA prepared by the above-described preparation method in the preparation of products that induce angiogenesis in HUVEC cells.

[0021] Compared with the prior art, the beneficial effects of the present invention include at least the following:

[0022] The preparation method of this invention can load VEGF-mRNA into exosomes, so that the prepared exosomes can promote the proliferation and migration of HUVEC cells, and at the same time better induce HUVEC cells to form blood vessels. Attached Figure Description

[0023] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the accompanying drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. In all the drawings, similar elements or parts are generally identified by similar reference numerals. In the drawings, the elements or parts are not necessarily drawn to scale.

[0024] Figure 1 This is a schematic diagram illustrating the preparation principle of VEGF-mRNA-loaded exosomes according to the present invention.

[0025] Figure 2 This is a schematic diagram of the structure in Example 3 of the present invention showing the specific binding of the complex nucleotide aptamer sequence to VEGF-mRNA;

[0026] Figure 3 The results of Western blot analysis of CD9-MCP expression in ADSC cells and ADSC exosomes in Example 3 of this invention;

[0027] Figure 4 The results of VEGF-mRNA expression detection in ADSC cells and ADSC exosomes in Example 3 of this invention;

[0028] Figure 5 This is a fluorescence microscopy image of exosomes and target cells HUVECs co-cultured in Example 4 of the present invention.

[0029] Figure 6 The expression of VEGF-mRNA in HUVCEC target cells in Example 4 of this invention;

[0030] Figure 7 The results of the wound healing cell scratch test in Example 4 of this invention;

[0031] Figure 8 The results are from the Matrigel tube formation test in Example 4 of this invention. Detailed Implementation

[0032] The embodiments of the technical solution of the present invention will be described in detail below with reference to the examples. The following embodiments are only used to illustrate the technical solution of the present invention more clearly, and are therefore only examples, and should not be used to limit the scope of protection of the present invention.

[0033] It should be noted that, unless otherwise stated, the technical or scientific terms used in this application should have the ordinary meaning as understood by one of ordinary skill in the art to which this invention pertains.

[0034] The preparation method of this invention first uses SELEX technology to screen for single-stranded nucleotide sequences targeting VEGF-mRNA. This single-stranded portion specifically binds to VEGF-mRNA at the AUG terminus through base pairing. Secondly, based on the principle of RNA-protein interactions, an MS2 nucleotide sequence with a stem-loop structure is selected. This structure can recognize the MCP site linked to the exosome transmembrane protein CD9. The combined suitable ligand formed by these two sequences, through bidirectional recognition, can load VEGF-mRNA into exosomes. The principle diagram for exosome preparation of this invention is shown below. Figure 1.

[0035] The technical solution of the present invention will be further described in detail below through specific embodiments.

[0036] Example 1

[0037] This example describes the design and synthesis of mRNA aptamers:

[0038] The SELEX method for aptamer screening can be used to construct a DNA library, incubate the target molecule (VEGF-mRNA) with the library, remove unbound sequences, and amplify bound sequences. After several rounds of this process, the resulting sequences are sequenced, and sequences with high homology coefficients and strong binding affinity are selected. Further, specific stem-loop and pseudo-knot structures are removed to shorten the sequence length, resulting in several (<5) desired Aptamer sequences. Then, the preliminarily screened mRNA Aptamer sequences and the MS2 nucleotide sequence with a stem-loop structure are artificially synthesized and ligated to form a complex nucleotide aptamer with specific bidirectional recognition of the target mRNA and MCP protein site. This step is completed by the nucleic acid-related bioengineering company (Shanghai Sangon Biotech).

[0039] Preliminary screening yielded the mRNA Aptamer sequence, which includes SEQ ID NO:1, specifically UACCAAUGAAGACGGU;

[0040] The MS2 nucleotide sequence is shown in SEQ ID NO:2, specifically: UGUACUCCACUAGGAGUACAGGACGUCUGUACUCCACUAGGAGUACA UGCGUCUUCGAUUCCUGUACUCCACUAGGAGUACA.

[0041] Example 2

[0042] This example illustrates the synthesis and cell transfection of a retrovirus containing a complex nucleotide aptamer sequence and a CD9-MCP fusion protein translation sequence.

[0043] We designed and constructed a master plasmid vector (GFP green fluorescence) containing several preliminarily screened complex nucleotide aptamer sequences and the translation sequence of the CD9-MCP fusion protein. We then extracted the master plasmid vector (pspax2, pMD2G) with high purity and without endotoxin using lentiviral helper packaging vectors. We then co-transfected 293T tool cells (preserved in the project team's laboratory) using lipo2000. Six hours after transfection, we replaced the medium with complete medium. After culturing for a period of time, we collected the cell supernatant rich in lentiviral particles and concentrated the virus by ultracentrifugation.

[0044] 1×10 6ADSCs were inoculated at 75cm 2 Add 5 ml of culture medium to a petri dish and transfect the cells with viruses of MOI 50, 100, and 150, respectively.

[0045]

[0046] Example 3

[0047] This example further validates and screens the mRNA loading effects mediated by different complex nucleotide aptamers:

[0048] ADSCs transfected with different complex nucleotide aptamer sequences were grouped, serum-free cell culture supernatants were collected, and Exoprotein was extracted. PLUS With the original ADSCs exosomes Exo Orig As a control group, the expression of VEGF mRNA in exosomals from different groups was detected by PCR to verify the hypothesis that the designed complex nucleotide aptamer loads the target mRNA into exosomals. Finally, the complex nucleotide aptamer sequence with the highest loading efficiency was screened for subsequent experiments.

[0049] UGUACUCCACUAGGAGUACAGGACGUCUGUACUCCACUAGGAGUACAUGCGUCUUCGAUUCCUGUACUCCACUAGGAGUACAUACCAAUGAAGACGGU; its structure that specifically binds to VEGF-mRNA is as follows Figure 2 As shown.

[0050] Western blot analysis was performed to detect CD9-MCP expression in ADSC cells and ADSC exosomes. The results are as follows: Figure 3 As shown; PCR detection of VEGF-mRNA expression in ADSC cells and ADSC exosomes, the results are as follows. Figure 4 As shown;

[0051] Depend on Figure 3 , Figure 4 It can be seen that the CD9-MCP fusion protein was successfully expressed in both ADSC cells and ADSC exosomes; the expression level of VEGF mRNA was significantly increased in both cells and engineered exosomes.

[0052] Example 4

[0053] This example verifies the effectiveness of complex nucleotide aptamers in delivering VEGF-mRNA:

[0054] (1) Replacement of exosomes Exo Dis Synthesis:

[0055] Based on the aforementioned complex nucleotide aptamer sequence, a highly paired guide RNA sequence (gRNA: AUGGUUACUUCUGCCA) was designed and synthesized. The gRNA competitively binds to the aptamer and dissociates the mRNA from the bound aptamer, thereby promoting translation. This gRNA was artificially synthesized and transfected into 293T cells using lipo2000. Cell supernatants were collected, and exosomes were extracted. PCR was used to detect the exosomes. Dis Expression of gRNA was investigated. Additionally, a sequence-similar but unpaired gRNA (CUGCAGGACGCAGAAGCUAAGG) was randomly designed and used as a control group after transfection. Dis-Control .

[0056] (2) Isolation, culture, and identification of HUVECs:

[0057] Using a sterile umbilical cord from a healthy newborn, the cord was repeatedly cleaned with sterile pre-cooled PBS solution to remove blood stains. The two ends of the umbilical vein were separated, and the blood clots inside the vein were rinsed with PBS solution. Then, 20 ml of 0.1% type I collagenase solution was slowly injected into the vein lumen, followed by digestion in a cell culture incubator for 15 minutes. The digestive fluid from the umbilical vein was aspirated and placed in a 50 ml centrifuge tube, centrifuged at 1200 rpm for 5 minutes at 4°C. The centrifuged pellet was seeded into T25 vials coated with 0.1% gelatin containing EGM-2 complete medium and cultured adherently. The cells were observed to be arranged in a cobblestone pattern, and the cell surface antigens CD31 and VEGF-R2 were verified using immunofluorescence staining and flow cytometry. The cells were identified as HUVECs.

[0058] (3)Exo PLUS and Exo Dis Characterization and exocytosis assays:

[0059] Two types of exosomes were stained using PKH67 or PKH26 fluorescent membrane dyes. Exosomes carrying fluorescent signals were co-cultured with target cells (HUVECs). HUVECs were stained with fluorescence at fixed time points (6h and 12h), and the number and aggregation of exosomes entering the cells were observed under a fluorescence microscope. The results are as follows: Figure 5 As shown;

[0060] Depend on Figure 5 It can be seen that engineered exosomes Exo PLUS and Exo Dis Both can enter target cells.

[0061] (4) Validation of the effectiveness of exosome replacement and successful mRNA expression in target cells:

[0062] The above-mentioned Exo carrying fluorescent signals PLUS+Exo Dis Co-culture with HUVECs, Exo PLUS +Exo Dis-Control And using Exo alone PLUS As a control group, after a period of time, the expression of VEGF-mRNA in target cells HUVCEC was detected by PCR; the results are as follows. Figure 6 As shown;

[0063] Depend on Figure 6 It can be seen that using dissociated exosomes containing competitive gRNA sequences can significantly increase the content of VEGF-mRNA in target cells, with highly paired sequence gRNAs showing the highest efficiency. This indicates that using Exosomes... Dis This can further improve the delivery efficiency of engineered exosome mRNA.

[0064] (5) The role of engineered exosomes in in vitro models of angiogenesis:

[0065] HUVECs were seeded in 12-well plates, 48-well plates pre-coated with rat tail collagen, 96-well plates, and transwells. Exo PLUS +Exo Dis Co-cultured with HUVECs, using only Exo orig As a control group, no exosomes were used as a blank control. Cell migration ability was assessed using the Wound Healing assay; cell angiogenesis ability was assessed using the Matrigel tubule formation assay.

[0066] Among them, the results of the Wound Healing Cell Scratch Test are as follows: Figure 7 As shown; the Matrigel tube formation test results are as follows. Figure 8 As shown:

[0067] Depend on Figure 7 , Figure 8 It can be seen that engineered exosomes carrying VEGF mRNA promote the proliferation and migration of HUVEC cells; engineered exosomes carrying VEGF mRNA can enhance the in vitro angiogenesis ability of HUVEC cells.

[0068] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features therein. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention, and they should all be covered within the scope of the claims and specification of the present invention.

Claims

1. A method for preparing exosomes loaded with VEGF-mRNA, characterized in that, Includes the following steps: (a) Using SELEX technology to screen for single-stranded nucleotide sequences targeting VEGF-mRNA, wherein the AUG terminus of the single-stranded nucleotide sequence is capable of specifically binding to the target mRNA; (b) Select an MS2 nucleotide sequence with a stem-loop structure based on the principle of RNA-protein interaction, wherein the stem-loop structure can recognize the MCP site linked by the exosome transmembrane protein CD9; (c) The single-stranded nucleotide sequence and the MS2 nucleotide sequence were ligated to obtain a complex nucleotide aptamer that specifically bidirectionally recognizes VEGF-mRNA and MCP protein sites; (d) Construct a lentiviral plasmid vector containing the complex nucleotide aptamer sequence and the translation sequence of the CD9-MCP fusion protein, then transfect the cells, culture them, collect the supernatant, and extract the VEGF-mRNA-loaded exosomes. The specific single-stranded nucleotide sequence is shown in SEQ ID NO: 1; The MS2 nucleotide sequence is shown in SEQ ID NO: 2; The coding sequence of the CD9-MCP fusion protein is shown in SEQ ID NO:

3.

2. The exosomes loaded with VEGF-mRNA prepared by the method of claim 1.

3. The use of the exosomes loaded with VEGF-mRNA prepared by the method of claim 1 in the preparation of products that promote the proliferation and / or migration of HUVEC cells.

4. The use of the exosomes loaded with VEGF-mRNA prepared by the method of claim 1 in the preparation of products that induce angiogenesis in HUVEC cells.

Images