High affinity vibrio parahaemolyticus aptamer based on clipping and evolutionary screening

Abstract

The application discloses a high-affinity Vibrio parahaemolyticus aptamer based on cutting and evolution screening, and comprises the following steps: (1) obtaining a short Vibrio parahaemolyticus aptamer with high binding performance based on cutting; (2) an aptamer evolution screening method; and (3) obtaining a high-affinity and high-specificity Vibrio parahaemolyticus aptamer based on evolution screening. Firstly, the aptamer is cut based on truncation, stem-loop cutting and step-by-step shortening, and the result is verified by using qPCR, so that a short Vibrio parahaemolyticus aptamer sequence with more excellent binding performance is obtained; in order to further improve the performance of the aptamer, the short aptamer sequence after cutting is introduced into a library for innovative evolution screening, so that a high-affinity and high-specificity Vibrio parahaemolyticus aptamer is obtained. The aptamer has a potential application prospect in rapid detection of Vibrio parahaemolyticus.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology and relates to a high-affinity Vibrio parahaemolyticus aptamer based on trimming and evolutionary screening. Background Technology

[0002] Since its initial discovery in Japan in 1950, Vibrio parahaemolyticus has become a global public health concern. In my country, Vibrio parahaemolyticus has surpassed Salmonella as the leading cause of bacterial poisoning. With the improvement of living standards in my country, the consumption of aquatic products is constantly increasing, leading to a year-on-year increase in foodborne illnesses caused by Vibrio parahaemolyticus. Outbreaks of Vibrio parahaemolyticus can kill large numbers of farmed aquatic animals in a short period, causing huge economic losses. Contaminated food can also cause outbreaks of epidemic diarrhea. Highly sensitive and specific detection in the early stages of infection can effectively suppress transmission and disease outbreaks. Traditional microbial culture and identification methods are no longer sufficient for the rapid detection of foodborne pathogens due to their time-consuming nature; therefore, faster and more efficient detection methods have become a key research focus. Currently, molecular techniques using aptamers as recognition elements have been extensively studied due to their rapid, efficient, and sensitive characteristics.

[0003] Nucleic acid aptamers are oligonucleotide sequences that can specifically bind to target substances. Aptamers are primarily screened using systematic evolution of ligands by exponential enrichment (SELEX). Aptamers containing more than 10 random oligonucleotides are selected. 14 RNA or DNA libraries of multiple powers are incubated with target material. After a certain reaction time, nucleic acids that can bind to the target are separated from those that do not. The target-binding nucleic acids are amplified using PCR or other methods to generate new oligonucleotide libraries. After repeating the above steps 5-15 times, the enriched library is sequenced, and the sequences are analyzed for affinity and specificity using various techniques. The nucleic acid sequences with better results are the aptamers for the target.

[0004] After a series of rigorous SELEX procedures, some promising aptamer sequences were finally identified. However, not every nucleotide in the sequence plays a positive role in binding to the target. As artificially synthesized oligonucleotide sequences, each nucleotide in the aptamer can be replaced or removed to improve the aptamer's performance, including affinity, sensitivity, allosteric ability, and luminescent properties.

[0005] This invention is based on the 40nt proaptor sequence of Vibrio parahaemolyticus. Through mfold structure prediction and qPCR verification, redundant sequences were gradually removed to obtain the 15nt short aptamer sequence F-15 (SEQ ID NO.1) of Vibrio parahaemolyticus. Based on this, an evolutionary screening library was designed, and the high-affinity and high-specificity aptamer F-28-10 (SEQ ID NO.2) was obtained. Summary of the Invention

[0006] Based on this, the present invention provides a high-affinity Vibrio parahaemolyticus aptamer based on trimming and evolutionary screening.

[0007] On the one hand, this application proposes a tailored, high-affinity short aptamer sequence for Vibrio parahaemolyticus.

[0008] Obtaining the short sequence of the Vibrio parahaemolyticus aptamer with high binding capacity mainly includes the following steps:

[0009] (1) The secondary structure of aptamer F1 (SEQ ID NO.3) was predicted by the online structural prediction element mfold to explore its special structure;

[0010] (2) The aptamers were optimized by means of intermediate truncation, stem-loop trimming and stepwise shortening, and their aptamer sequences are shown in SEQ ID NO.5-10;

[0011] (3) The optimized sequence was used as a template for qPCR after co-incubation with the target bacteria to separate the binding sequence.

[0012] (4) Amplification and verification of sequence optimization results using qPCR. qPCR result determination: The stronger the aptamer's ability to bind to the target, the more aptamers bind to the target, and the smaller the Ct value of qPCR.

[0013] On the other hand, this application provides a high-affinity, high-specificity Vibrio parahaemolyticus aptamer obtained based on evolutionary screening.

[0014] The evolutionary screening of high-affinity, high-specificity aptamer sequences mainly includes the following steps:

[0015] (1) Library design: 15nt F-15 molecules were placed into a random library for evolutionary screening. 10nt random sequences were added to both sides of the 15nt molecules, and primers were added to the outside of the random sequences. F-lib: 5'-ATCCATTGCCACTGACTACCNNNNNNNNNNAGGTTAAGAGGCGCTNNNNNNNNNN GAAGTCAGTCGGTCGTTAGT-3', as shown in SEQ: ID NO:11;

[0016] (2) Annealing temperature optimization: Before screening, the annealing temperature used for PCR amplification was optimized. The Tm value of the primers was predicted using the NEB online website (https: / / ligasecalc.neb.com / #! / ligation). The annealing temperature is generally about 5℃ lower than the Tm value and is usually between 55 and 70℃. Therefore, gradient temperature PCR was performed with a library of 100 nM concentration. The annealing temperature was optimized between 55℃ and 65℃. The PCR products were verified by 4% agarose gel electrophoresis.

[0017] (3) Binding: Dilute the randomized library, denature it, and add 5-10 μL to the bacterial suspension after washing off the culture medium. Gradually increase the amount of competitive aptamer F1-2-2-15 and 2% BSA in each round. After mixing, incubate on a shaker at 200 rpm, decreasing the incubation time with each round.

[0018] (4) Isolation of unbound sequences: The incubated bacteria and aptamer mixture solution was centrifuged at 6000 rpm and 4℃ for 5 min. Due to the large volume of the bacteria, they settled to the bottom of the centrifuge tube after centrifugation, while the unbound sequences were in the supernatant. The supernatant was discarded using a pipette, and the bacteria were washed with 1×BB buffer to remove nucleic acid sequences with weak adsorption and binding ability. The number of washing times was gradually increased as the screening was carried out.

[0019] (5) Sequence separation: The washed bacterial pellet was reselected into 100 μL of 1×BB buffer, heated at 95°C to denature the nucleic acid sequence and detach it from the bacterial cells, and immediately placed on ice for 5 min, then centrifuged at 14000 rpm and 4°C for 15 min. The supernatant, i.e. the aptamer candidate sequence, was transferred as a PCR amplification template.

[0020] (6) Amplification: Before formal amplification, the number of PCR rounds was optimized. After selecting the optimal number of rounds by 4% agarose gel electrophoresis, large-scale PCR amplification was performed to prepare for secondary library preparation. The amplification system was the same as the primer optimization system. Subsequently, large-scale amplification was performed using the optimized number of rounds as the amplification rounds.

[0021] (7) ssDNA preparation: Take 45 μL of PCR product, add 0.8-2.5 μL of Lambda exonuclease and 5 μL of Lambda exonuclease buffer, mix well, and optimize the digestion time and enzyme dosage. The digestion is performed at 37℃. After digestion, the enzyme is inactivated by treatment at 75℃ for 10 min, and the optimization results are verified by gel electrophoresis. After optimization, the optimal dosage and digestion time are selected for large-scale digestion. After digestion, the product is collected into a 2 mL centrifuge tube, 0.1 volume of 3M sodium acetate is added and mixed well, and then 2 volume of pre-cooled anhydrous ethanol is added. The mixture is precipitated overnight at -20℃. After overnight precipitation, the mixture is centrifuged at 14000 rpm and 4℃ for 15 min, and then 70% ethanol is added to wash the precipitate. The mixture is then centrifuged at 14000 rpm and 4℃ for 15 min. After removing the supernatant, the mixture is dried at 50℃ to remove residual ethanol. After complete drying, 50 μL of ultrapure water is added to dissolve the precipitate to obtain the secondary library for the next round of screening, and the nucleic acid concentration is detected.

[0022] (8) Reverse screening: Reverse screening was performed in rounds 5, 8, and 10. The secondary library prepared in the previous round was denatured and added to the bacterial suspension for reverse screening. After incubation for 90 min, the mixture was centrifuged at 6000 rpm for 5 min at 4°C. The supernatant was used directly as the library for the next round of forward screening. Staphylococcus aureus, Listeria monocytogenes, and Salmonella were used for reverse screening.

[0023] (9) Candidate aptamer detection: The screening process was repeated 12 times, including 8 rounds of forward screening and 3 rounds of reverse screening, and the amplified products were sequenced. The binding effect of 10 candidate sequences was verified by qPCR, as shown in SEQ: ID NO:12-21. Subsequently, 2 sequences were selected for flow cytometry to detect aptamer specificity, and the affinity of aptamer sequences with good performance was determined.

[0024] Compared with the prior art, the beneficial effects of the present invention are:

[0025] 1. This invention prunes the Vibrio parahaemolyticus aptamer to obtain a short aptamer sequence with high binding performance.

[0026] 2. This invention utilizes short aptamer sequences for evolutionary screening to obtain Vibrio parahaemolyticus aptamers with better affinity and specificity than the original aptamers. Attached Figure Description

[0027] Figure 1 Predict aptamer structures for the mfold online software.

[0028] Figure 2 The results are qPCR fluorescence results for F1 and F1-2-2-15.

[0029] Figure 3The fluorescence comparison is shown between F-15 aptamer incubated with Vibrio parahaemolyticus and negative bacteria without aptamer.

[0030] Figure 4 Optimize the annealing temperature for primers used in evolutionary screening.

[0031] Figure 5 The percentage of bacteria with higher fluorescence than background fluorescence after incubation of F-3-2 and F-28-10 with different bacteria.

[0032] Figure 6 Amplification and calibration curves for known concentrations of F1 and F-28-10.

[0033] Figure 7 The binding dissociation curves for F1 and F-28-10 are shown.

[0034] Figure 8 A schematic diagram for obtaining the aptamer. Detailed Implementation

[0035] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0036] Example 1. Cutting of Vibrio parahaemolyticus aptamers

[0037] (1) Prediction of the base structure of Vibrio parahaemolyticus aptamers

[0038] The secondary structure of aptamer F1 (SEQ ID NO. 2) was predicted using the online structural prediction element mfold to explore its special structures. The aptamer was optimized using methods such as intermediate truncation, stem-loop trimming, and stepwise shortening. The aptamer sequences are shown in SEQ ID NO. 5-10. The structural prediction results are as follows: Figure 1 As shown.

[0039] (2) Verification of cutting effect

[0040] Take 1 mL of pure bacterial culture, centrifuge at 5000 rpm, 4°C for 5 min, discard the supernatant, wash 3 times with 1×BB, resuspend the bacterial pellet to 990 μL, add 10 μL of 100 nM aptamer dilution to the bacterial suspension, incubate at 200 rpm at room temperature for 50 min, centrifuge at 5000 rpm, 4°C for 5 min, and rinse 6 times. Resuspend the rinsed bacterial pellet in 100 μL of 1×BB, heat in a 95°C metal bath for 10 min to separate the aptamer from the bacterial cells, immediately incubate on ice for 10 min, then centrifuge at 14000×g, 4°C for 15 min, and use the supernatant as a template for subsequent qPCR.

[0041] The sequence optimization results were validated by amplification using qPCR.

[0042] The primers are as follows:

[0043] Upstream primer F: 5'-CGTACGGTCGACGCTAGC-3' (SEQ ID NO.21)

[0044] Downstream primer R: 5'-GGATCCGAGCTCCACGTG-3' (SEQ ID NO.22)

[0045] The qPCR system is as follows:

[0046]

[0047] The qPCR amplification procedure is as follows:

[0048]

[0049]

[0050] The preliminary trimmed qPCR results are shown in Table 1. Compared to the original sequence F1 (Ct value: 15.84), the Ct values ​​of the stem-loop portion F1-1 (Ct value: 15.42) and the 3' end sequence F1-2-2 (Ct value: 15.54) are similar, with F1-2-2 slightly larger than F1-1. However, F1-2-1 has a larger Ct value. Therefore, it is believed that the core binding region of F1 may be located near the 3' end of the stem-loop, while the portion near the 5' end may contain redundant sequences affecting binding. Based on the hypothesis that the core recognition sequence may be located near the 3' end of the stem-loop, F1-2-2 was further trimmed. The 20nt F1-2-2 was progressively shortened to obtain 15nt F1-2-2-15, 12nt F1-2-2-12, and 10nt F1-2-2-10. The qPCR Ct values ​​are shown in Table 2. When the 20nt sequence was shortened to 15nt, the Ct value decreased from 16.03 to 15.73. However, if the 15nt F1-2-2-15 was further shortened to 12nt and 10nt, the binding ability of the sequence to Vibrio parahaemolyticus decreased significantly, and the Ct value showed a significant upward trend. The qPCR results of F1 and F1-2-2-15 are as follows: Figure 2 As shown.

[0051] Subsequently, the binding affinity of the 15nt aptamer F-15 obtained by removing primers from the modified F1-2-2-15 was tested using flow cytometry, and the results are as follows: Figure 3 As shown, the aptamer maintains high binding performance even after the primer region is removed, proving that the short aptamer was successfully obtained through trimming.

[0052] Table 1. qPCR Ct values ​​for intermediate truncation and stem-loop trimming.

[0053]

[0054] Table 2. Gradually shortened qPCR Ct values

[0055]

[0056]

[0057] Example 2. Evolutionary screening of Vibrio parahaemolyticus aptamers

[0058] (1) Document Design

[0059] A 15nt F-15 was placed into a random library for evolutionary selection. 10nt random sequences were added to both sides of the 15nt, and primers were added to the outside of these random sequences. F-lib: 5'-ATCCATTGCCACTGACTACCN10AGGTTAAGAGGCGCTN10GAAGTCAGTCGGTCGTT AGT-3', as shown in SEQ: ID NO:11.

[0060] (2) Positive screening

[0061] 1) Annealing temperature optimization

[0062] Before screening, the annealing temperature for PCR amplification was optimized. Gradient temperature PCR was performed using a 100 nM library. The Tm values ​​of the primers were first predicted using the NEB online website (https: / / ligasecalc.neb.com / #! / ligation). Annealing temperatures are generally about 5°C lower than the Tm value, typically between 55 and 70°C. Therefore, the annealing temperature was optimized between 55 and 65°C. Ten optimized temperatures were set: 55°C, 55.5°C, 56.1°C, 57.1°C, 58.3°C, 59.4°C, 60.5°C, 61.8°C, 63°C, 63.9°C, 64.6°C, and 65°C. The optimized PCR system and procedure are shown below. The PCR products were validated using 4% agarose gel electrophoresis.

[0063] The primers are as follows:

[0064] Upstream primer FP: 5'-ATCCATTGCCACTGACTACC-3' (SEQ ID NO.23)

[0065] Downstream primer RP: 5'-ACTAACGACCGACTGACTTC-3' (SEQ ID NO.24)

[0066] The PCR reaction system is as follows:

[0067]

[0068]

[0069] The PCR amplification procedure is as follows:

[0070]

[0071] like Figure 4As shown, with the continuous increase of annealing temperature, the amount of primer dimer produced and the band brightness of non-specific products continuously increase, indicating that the increase of annealing temperature increases the content of non-specific products. Since the annealing temperature is usually not lower than 55℃, 55℃ was used as the experimental temperature in subsequent experiments.

[0072] 2) Combining

[0073] After diluting and denaturing the randomized library, 5-10 μL of the diluted sample was added to the resuspended bacterial suspension after washing off the culture medium. The amount of competitive aptamer F1-2-2-15 and 2% BSA was gradually increased in each round. The mixture was then incubated on a shaker at 200 rpm, with the incubation time decreasing each round. The sample amounts of each component added in each round of screening are shown in the table below.

[0074]

[0075]

[0076] 3) Separation of unbound sequences

[0077] The incubated bacterial and aptamer mixture was centrifuged at 6000 rpm and 4°C for 5 min. Due to the large volume of the bacterial cells, they settled to the bottom of the centrifuge tube after centrifugation, while unbound sequences remained in the supernatant. The supernatant was discarded using a pipette, and the bacterial cells were washed with 1×BB buffer to remove nucleic acid sequences with weak adsorption and binding ability. The number of washing cycles was gradually increased as the screening progressed.

[0078] 4) Separation by binding sequence

[0079] The washed bacterial pellet was reselected into 100 μL of 1×BB buffer, heated at 95°C to denature the nucleic acid sequence and detach it from the bacterial cells, and immediately placed on ice for 5 min, then centrifuged at 14000 rpm and 4°C for 15 min. The supernatant, which is the aptamer candidate sequence, was transferred as a PCR amplification template.

[0080] 5) Amplification

[0081] Before formal amplification, the number of PCR rounds was optimized. After selecting the optimal number of rounds using 4% agarose gel electrophoresis, large-scale PCR amplification was performed to prepare for secondary library preparation. The amplification system was the same as the primer optimization system. Subsequently, large-scale amplification was performed using the optimized number of rounds.

[0082] 6) ssDNA preparation

[0083] Take 45 μL of PCR product, add 0.8-2.5 μL of Lambda exonuclease and 5 μL of Lambda exonuclease buffer, mix well, and optimize the digestion time and enzyme dosage. Digestion is performed at 37℃, and after digestion, the enzyme is inactivated by treatment at 75℃ for 10 min. The optimization results are verified by gel electrophoresis. After optimization, the optimal dosage and digestion time are selected for large-scale digestion. After digestion, the product is collected in a 2 mL centrifuge tube, 0.1 volume of 3M sodium acetate is added and mixed well, followed by 2 volumes of pre-chilled anhydrous ethanol. Precipitation is carried out overnight at -20℃. After overnight precipitation, centrifuge at 14000 rpm at 4℃ for 15 min, wash the precipitate with 70% ethanol, and continue centrifuging at 14000 rpm at 4℃ for 15 min. Remove the supernatant, dry at 50℃ to remove residual ethanol, and after complete drying, dissolve in 50 μL of ultrapure water to obtain the secondary library for the next round of screening. The nucleic acid concentration is then measured.

[0084] (3) Reverse Filtering

[0085] Reverse screening was performed in rounds 5, 8, and 10. The secondary library prepared in the previous round was denatured and added to the bacterial suspension used for reverse screening. After incubation for 90 min, the mixture was centrifuged at 6000 rpm for 5 min at 4°C. The supernatant was used directly as the library for the next round of forward screening. Staphylococcus aureus, Listeria monocytogenes, and Salmonella were used for reverse screening.

[0086] (4) Aptamer performance characterization

[0087] The screening process was repeated 12 times, including 8 rounds of forward screening and 3 rounds of reverse screening, followed by sequencing of the amplified products. After verifying the binding efficacy of 10 candidate sequences using qPCR, two sequences were selected for flow cytometry to detect aptamer specificity, and the affinity of aptamer sequences with good performance was determined. The qPCR results are shown in Table 3. Among the 10 sequences, sequence F-3-2 had a Ct value of 17.23, and sequence F-28-10 had a Ct value of 18.74, showing significantly better results than the other sequences.

[0088] Table 3. qPCR Ct values ​​of candidate aptamer sequences

[0089]

[0090] Furthermore, the steps for performing flow cytometry on the two sequences include: diluting the FAM-labeled aptamer, using 100 nM aptamer with 1 × 10⁻⁶ ions / mL of the aptamer. 8The bacterial cells were incubated in a 200 μL incubation system at room temperature in the dark for 60 min, then washed twice with 1×BB and resuspended in 1 mL of 1×BB for flow cytometry analysis. Before the test, the flow cytometry parameters were adjusted using Vibrio parahaemolyticus without the aptamer; a higher fluorescence intensity indicated better binding ability of the aptamer. Similarly, the aptamer concentration was used with 1×10⁻⁶ cells / mL of 1×BB. 8 Incubation with other bacterial cells and detection of fluorescence intensity achieves specific detection of this aptamer. For example... Figure 5 As shown, F-28-10 exhibits slightly better binding efficacy and specificity than F-3-2. Therefore, affinity testing was performed on F-28-10.

[0091] Further steps to determine the affinity of the aptamer include: first, diluting the aptamer solution to obtain a concentration of 10–10. -4 nM, a regression equation was obtained through qPCR, which was used to calculate the aptamer binding target concentration. Subsequently, aptamer concentrations of 1 nM, 10 nM, 50 nM, 100 nM, and 200 nM were used in conjunction with approximately 10 9 Incubation with CFU / mL Vibrio parahaemolyticus was performed, followed by the same procedures as aptamer trimming. The resulting Ct value was substituted into the regression equation to obtain the aptamer binding concentration. Binding-dissociation curves were plotted using the binding concentration and incubation concentration, and K was analyzed using Origin. d The values ​​are fitted and calculated.

[0092] First, the original adapter F1 used for cutting ( Figure 6 B) and F-28-10 Figure 6 A) Dilution yielded the amplification curve and linear regression equation, as shown below. Figure 6 As shown in the figure. Subsequently, the target was incubated with aptamers of different concentrations. Binding concentrations were calculated using Ct values, and binding-dissociation curves were fitted. The results are shown in the figure. Figure 7 As shown, the K of the original aptamer F1 was obtained through fitting. d The value is 62.49 ± 16.05 nM, K of F-28-10 d The value was 44.31±31.46 nM. F-28-10 showed slightly better affinity than the original aptamer F1, and at the same aptamer incubation concentration, F-28-10 could bind significantly more to the target than the original aptamer, demonstrating stronger binding ability. The entire process flow diagram for obtaining F-28-10 is shown below. Figure 8 As shown.

Claims

1. An aptamer for Vibrio parahaemolyticus, characterized in that, The nucleic acid sequence of the aptamer is selected from the following sequences: F1-1: 5'-CGTACGGTCGACGCTAGCCAGCGGGGAAGGTTAAGAGGCGCTGCACGTGGAGCTCGGATCC -3', as shown in SEQ ID NO: 5; F1-2-2: 5'-CGTACGGTCGACGCTAGCAGGTTAAGAGGCGCTAGGAGCACGTGGAGCTCGGATCC -3', as shown in SEQ ID NO: 7; F1-2-2-15: 5'-CGTACGGTCGACGCTAGCAGGTTAAGAGGCGCTCACGTGGAGCTCGGATCC-3', as shown in SEQ ID NO:

8.

2. A short aptamer for Vibrio parahaemolyticus with high binding performance obtained through tailoring, characterized in that, The aptamer sequence is: F-15:5'-AGGTTAAGAGGCGCT-3', as shown in SEQ ID NO:

1.

3. A method for evolutionary screening of Vibrio parahaemolyticus aptamers, characterized in that, It includes the following four steps: (1) Library design: The library used for evolutionary screening is rationally designed based on the core region of the aptamer obtained by trimming. The core region is: F-15:5'-AGGTTAAGAGGCGCT-3', as shown in SEQ ID NO: 1; (2) Forward screening: The library and the target are incubated to obtain specific sequences, and low affinity sequences are removed using BSA and F1-2-2-15, wherein F1-2-2-15 is: 5'-CGTACGGTCGACGCTAGCAGGTTAAGAGGCGCTCACGTGGAGCTCGGATCC-3', as shown in SEQ ID NO: 8; (3) Reverse screening: The library was incubated with Listeria monocytogenes, Salmonella, and Staphylococcus aureus to remove non-specific sequences; (4) Aptamer performance characterization: The binding performance, specificity and affinity of the aptamers were characterized by qPCR and flow cytometry.

4. The evolutionary screening method for Vibrio parahaemolyticus aptamers according to claim 3, characterized in that, The short aptamer of Vibrio parahaemolyticus with high binding performance obtained by tailoring was introduced into a random library to obtain the library sequence F-lib: 5'-ATCCATTGCCACTGACTACCNNNNNNNNNNAGGTTAAGAGGCGCTNNNNNNNNNNGAAGTCAGTCGGTCGTTAGT-3', as shown in SEQ ID NO: 11, where N is a random base.

5. The evolutionary screening method for Vibrio parahaemolyticus aptamers according to claim 3, characterized in that, The F1-2-2-15 replaces tRNA to increase the competitive pressure in the screening process.

6. An aptamer for Vibrio parahaemolyticus obtained through evolutionary screening, characterized in that, The nucleic acid sequence of the aptamer is selected from the following sequences: F-3-2: 5'- ATCCATTGCCACTGACTACCTCATCCCCACATTGTCATTTATCCCTCTAGCTCTTTTGCACCCCAGTAGAAGTCAGTCGGTCGTTAGT -3', as shown in SEQ ID NO: 13; F-5-3: 5'- ATCCATTGCCACTGACTACCATGGGGGGGAAGGTTAAGAGGCGCTTTGGATTTATGAAGTCAGTCGGTCGTTAGT -3', as shown in SEQ ID NO: 14; F-7-4: 5'- ATCCATTGCCACTGACTACCCTTATATTGTGGACATTCTGAACCCGGTTTGAAGTCAGTCGGTCGTTAGT -3', as shown in SEQ ID NO: 15; F-9-5: 5'- ATCCATTGCCACTGACTACCTGTAGTCTCCAGGTTAAGAGGCGCTAGCGCTCTTGGAAGTCAGTCGGTCGTTAGT -3', as shown in SEQ ID NO: 16; F-10-6: 5'- ATCCATTGCCACTGACTACCTGTGTGTCGCAGGTTAAAAGGCGCTCTATGGATCTGAAGTCAGTCGGTCGTTAGT -3', as shown in SEQ ID NO: 17; F-13-7: 5'- ATCCATTGCCACTGACTACCTTCCCCAGTTAGGTTTAAGAGGCGCTTCAAGATCTCGAAGTCAGTCGGTCGTTAGT -3', as shown in SEQ ID NO: 18; F-18-8: 5'- ATCCATTGCCACTGACTACCAGGTTAAGGAAGGTTAAGGGGCGCTTTAGGTTAGAGAAGTCAGTCGGTCGTTAGT -3', as shown in SEQ ID NO: 19; F-22-9: 5'- ATCCATTGCCACTGACTACCCTGGAAAGTCAGCAGGAGGGTTTTGAATTCAATCCGAAGTCAGTCGGTCGTTAGT -3', as shown in SEQ ID NO: 20; F-28-10: 5'- ATCCATTGCCACTGACTACCAATATCACGTAGGTTAAGAGGCGCTCTCCCACCAAGAAGTCAGTCGGTCGTTAGT -3', as shown in SEQ ID NO:

2.

7. The application of the aptamer according to any one of claims 1 to 2 or 6 in the development of a method for detecting Vibrio parahaemolyticus.

8. The use of the aptamer according to any one of claims 1 to 2 or 6 in the preparation of a Vibrio parahaemolyticus detection kit.

9. The application of the evolutionary screening method according to any one of claims 3 to 5 in the screening of Vibrio parahaemolyticus aptamers.

Images