A gene mutant of a tumor stem cell marker, its encoded protein, and its applications.

Abstract

This invention relates to the field of biotechnology, and more particularly to a gene mutant of a tumor stem cell marker, its encoded protein, and its applications. The gene mutant has the nucleotide sequence shown in SEQ ID NO.1; the protein encoded by the gene mutant has the amino acid sequence shown in SEQ ID NO.4. The protein encoded by the gene mutant provided by this invention can precisely and effectively inhibit the role of CD96 in tumor stem cells, thereby inhibiting stem cell characteristics such as tumor stemness and drug resistance.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more particularly to a gene mutant of a tumor stem cell marker, its encoded protein, and its applications. Background Technology

[0002] Cancer stem cells are a small subset of tumor cells capable of proliferation and differentiation, and are a major cause of tumor drug resistance. Current treatments for malignant tumors only kill most tumor cells, failing to affect cancer stem cells, ultimately leading to treatment insensitivity and death. For example, current drugs targeting cancer stem cells are prone to resistance and fail to produce effective treatment. Therefore, accurately identifying and intervening in cancer stem cell targets is crucial for current cancer research.

[0003] CD96 is an immune checkpoint expressed on the surface of T cells and NK cells, and is also one of the markers of tumor stem cells. Its high expression significantly inhibits the prognosis of tumor patients. Current technology inhibits CD96 by neutralizing it with CD96 neutralizing antibodies. However, CD96 neutralizing antibodies are not stable and cannot completely block the effect in some cells. Summary of the Invention

[0004] (a) Technical problems to be solved In view of the above-mentioned shortcomings and deficiencies of the prior art, the present invention provides a gene mutant of a tumor stem cell marker and its encoded protein. The protein encoded by the gene mutant can specifically inhibit the transduction of the original CD96 downstream signaling pathway and inhibit the stemness regulation of tumor stem cells, which can provide an accurate target for CD96 gene-based tumor therapy.

[0005] Accordingly, the present invention also provides a detection kit for gene mutants and its application in anti-tumor products.

[0006] (II) Technical Solution To achieve the above objectives, the main technical solutions adopted by the present invention include: In a first aspect, the present invention provides a gene mutant of a tumor stem cell marker, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0007] The gene mutant provided by this invention is a mutation of the original CD96 gene sequence. Experiments have shown that the gene mutant SEQ ID NO.1 can specifically inhibit the transduction of the downstream signaling pathway of the original CD96 through mutation at just one site. It can neutralize and inhibit CD96 with neutralizing antibodies, and can precisely and effectively block the function and inhibit the malignant biological behavior of tumor stem cells.

[0008] In a second aspect, the present invention provides a protein encoded by a gene mutant of a tumor stem cell marker, the amino acid sequence of which is shown in SEQ ID NO.4.

[0009] Optionally, the method of obtaining it includes the following steps: Construction of S1 recombinant nucleic acid body: The recombinant nucleic acid body comprises a vector of the gene mutant of claim 1 or a mutant gene fragment of the gene mutant, wherein the nucleotide sequence of the mutant gene fragment is as shown in SEQ ID NO.2; S2 recombinant nucleic acid was transfected into recipient cells; Expression and acquisition of S3 receptor proteins in cells.

[0010] Thirdly, the present invention also provides a detection kit for detecting gene mutants of the tumor stem cell markers, comprising a PCR detection reagent combination and primers, wherein the primers comprise: The forward primer has the nucleotide sequence shown in SEQ ID NO.5; The reverse primer has the nucleotide sequence shown in SEQ ID NO.6.

[0011] The PCR reagent kit includes: pyrobest buffer, dNTP mixture, DNA template (5-50 ng), pyrobest DNA polymerase (TaKaRa).

[0012] Fourthly, the present invention provides the application of a gene mutant of a tumor stem cell marker in an anti-tumor drug.

[0013] Anti-tumor drugs can be, but are not limited to, gene therapy drugs.

[0014] Optionally, the antitumor product is a recombinant nucleic acid containing the gene mutant described in any of the above schemes; or The antitumor product is a recombinant nucleic acid containing a mutant gene fragment of any of the gene mutants in the above schemes, and the nucleotide sequence of the mutant gene fragment is shown in SEQ ID NO.2.

[0015] Specifically, the use of the anti-tumor product of the present invention can be achieved by constructing the mutated gene fragment into a recombinant plasmid vector to obtain recombinant nucleic acid bodies, and after amplification, by injecting it into blood or tumor cells to inhibit the stemness regulation of tumor stem cells, etc.

[0016] Optionally, the recombinant nucleic acid is viral and / or plasmid DNA.

[0017] Secondly, the present invention also provides the application of a gene encoding a tumor stem cell marker in an anti-tumor product.

[0018] Optionally, the antitumor product is a vector containing the above-mentioned encoding gene; The vector is viral and / or plasmid DNA.

[0019] (III) Beneficial Effects The beneficial effects of this invention are: This invention utilizes the encoding gene of a tumor stem cell marker to inhibit the gene function of CD96 and its downstream signaling pathways, thereby achieving precise and effective suppression of stem cell characteristics such as drug resistance in tumor cells. This invention primarily inhibits the role of CD96 in tumor stem cells through gene mutation, thereby suppressing the stem cell characteristics of tumors. Attached Figure Description

[0020] Figure 1 This is a schematic diagram of the GeneArt™ site-directed mutagenesis system in Example 2; Figure 2 Constructing the mutant gene structure diagram of CD96 for Example 2; Figure 3 This is a schematic diagram showing the results of the immunoprecipitation technique used in Example 5 to detect the binding ability of the mutated CD96 functional motif to the downstream regulatory protein SRC. Figure 4 This is a schematic diagram showing the results of the tumor stem cell sphere formation experiment in Example 6; Figure 5 Example 7 uses cell immunofluorescence technology to detect the activation status of STAT3, an important downstream signaling node after the mutation of the CD96 functional motif. Detailed Implementation

[0021] To better explain and facilitate understanding of the present invention, the present invention will be described in detail below through specific embodiments.

[0022] Example 1 This embodiment provides a gene mutant, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0023] In this embodiment, the original CD96 gene is mutated at position 1736 to form a gene mutant, and the tyrosine residue at position 579 of the original encoded protein CD96 is mutated to phenylalanine.

[0024] Example 2 This embodiment provides a mutant gene fragment from the gene mutant of Example 1, the nucleotide sequence of which is shown in SEQ ID NO.2: 5'-AACGAAAGTGATCTGCCTTTTCATGAG ATGGAGACCCTC -3'; The nucleotide sequence of the unmutated gene fragment in the original sequence is shown in SEQ ID NO.3: 5'- AACGAAAGTGATCTGCCTTATCATGAGATGGAGACCCTC -3'.

[0025] Example 3 This embodiment provides a protein encoded by a gene mutant, the amino acid sequence of which is shown in SEQ ID NO.4.

[0026] This embodiment is an example of a protein encoded as shown in SEQ ID NO.4 expressed by a gene mutant from Example 1.

[0027] Example 4 This example provides a method for obtaining a gene mutant according to Example 1, the steps of which are as follows: S1 In this embodiment, a gene mutant was obtained by site-directed mutagenesis of the downstream regulatory site of the original CD96: specifically, the tyrosine residue at position 579 of the original CD96 was mutated to phenylalanine, and the sequence of the mutant gene fragment is shown in SEQ ID NO. 2; the mutagenesis was performed using the GeneArt™ site-directed mutagenesis system, and the specific method is shown in the appendix. Figure 1 and 2 As shown.

[0028] S2 methylation and mutagenesis: S21 configuration reaction system: 10X AccuPrime™ Pfx Reaction mix 5 μL, 10X enhancer 5 μL, Mixed primers (10 μM each) 1.5 μL 0.3 μM, Plasmid DNA (25 ng / μL) 1 μL, DNA methyltransferase (4 U / μL) 1 μL, 25X SAM 2 μL AccuPrime™ Pfx (2.5 U / μL) 0.4 μL, Add water to a final volume of 50 μL for PCR. S22 used the obtained gene mutant as a DNA template for PCR reaction: Phase 1: 37℃ for 15 min, 94℃ for 2 min, 1 cycle; Second stage: 94℃ for 20 seconds, 57℃ for 30 seconds, 68℃ for 53 seconds, for a total of 18 cycles; Third stage: Extend at 68℃ for 5 min; finally store at 4℃. S3 in vitro recombination reaction: The reaction system consisted of 4 μL 5X buffer, 10 μL PCR water, 4 μL PCR sample, and 2 μL 10X Enzymer mix. After incubation at room temperature for 10 min, the mixture was neutralized with 1 μL 0.5 M EDTA and placed on ice to obtain the recombinant plasmid. Transformation of S4 competent cells (DH5α™-T1R E. Coli): Take three 100µl competent cell suspensions and add 10µl of recombinant plasmid DNA (volume not exceeding 10µl). Gently shake each sample, place on ice for 20-30 min, incubate in a 42℃ water bath for 1-2 min, and then rapidly cool on ice for 2 min. Immediately add 0.4 ml of LB liquid medium (no need to operate on ice) to each of the above tubes to bring the total volume to 0.5 ml. This solution is called the transformation stock solution. Shake well and incubate at 37℃ with shaking for about 60 min to allow the recipient bacteria to recover to normal growth and for the transformants to express the gene product (Ampr). Transfer these products to agar plates and incubate at 37℃ for 30 min. Select 3-5 clones for verification and then increase the yield by shaking. The method of this embodiment, especially the in vitro recombination reaction in step S3, can increase the mutation efficiency by up to 10 times.

[0029] Example 4 This embodiment provides a method for obtaining the protein SEQ ID NO.4 encoded by a gene mutant, which is as follows: The gene sequence shown in SEQ ID NO.1 was used as a DNA template and inserted into the pcDNA3.1-6his plasmid. Mutants were screened for bacteria using ampicillin. Large-scale plasmids were extracted and transfected into MCF-7 cells. The protein encoded by SEQ ID NO.4 was expressed in MCF-7 cells.

[0030] Example 5 This embodiment provides a protein encoded by a gene mutant, SEQ ID NO.4, which was obtained by immunoprecipitation with mouse anti-human CD96 antibody and electrophoresis, as shown below. Figure 3 The results are shown.

[0031] The specific method is as follows: MCF-7 cells transfected in Example 2 were cultured for 48 hours, then a single-cell suspension obtained by digestion with 0.25% trypsin was added, and the cells were counted and divided into groups of 10. 7Lyse cells at a rate of / ml using pre-chilled IP digestion buffer (Cat# 87787, Thermo Scientific) and shake at 4°C for 1 h. Centrifuge cells (10000g, 4°C, 30 min) and collect the supernatant. Add 12 μg of mouse anti-human CD96 antibody (1:50, Cat# PA5-97568, Thermo) to the supernatant and shake for 1 h. Prepare A / G agarose beads (wash A / G agarose beads twice with PBS and then dilute to 50% concentration with IP lysis buffer). Mix agarose beads and cell lysis buffer (50:1), shake at 4°C for 1 h, centrifuge (10000g, 4°C, 15 s), and wash beads 3 times with IP lysis buffer. Resuspend in 1× loading buffer and boil at 95°C for 5 min; perform SDS-PAGE electrophoresis.

[0032] In this embodiment, the protein obtained by mutating tyrosine at position 566 of the original CD96 amino acid sequence to phenylalanine was used as a control protein (the method is the same as for obtaining the protein encoded by SEQ ID NO.4), and it was immunoprecipitated with mouse anti-human CD96 antibody according to the method of this embodiment. Simultaneously, the original CD96 protein was immunoprecipitated with mouse anti-human CD96 antibody as a control.

[0033] The method in this embodiment yields the following result: Figure 3 As shown in the figure, Y579F represents the mutant protein encoded by SEQ ID NO.4, Y566F represents the control protein, and WT represents the original CD96 protein.

[0034] from Figure 3 It can be seen that the mutant-encoded protein cannot be immunoprecipitated with mouse anti-human CD96 antibody, proving that the mutant in this embodiment does not have the ability to bind to the downstream regulatory protein SRC.

[0035] Example 6 In this embodiment, the cells obtained in Example 2 were digested with 0.25% trypsin, washed 2-3 times with sterile PBS and counted. 1000 cells per well were added to a low-adhesion 24-well culture plate and cultured in an incubator. The culture medium was added as needed according to the condition of the medium. After 10 days, the number and volume of cell spheroids were observed to evaluate the cell's ability to form spheroids.

[0036] In this embodiment, the protein obtained by mutating tyrosine at position 566 of the original CD96 amino acid sequence to phenylalanine was used as a control protein. The method for obtaining the protein was the same as in Example 2, and its cell spheroid formation ability was evaluated according to the method of this embodiment. Simultaneously, the cell spheroid formation ability of the original CD96 protein (extracted by digestion using commercially available and commonly used RIPA lysis buffer) was evaluated according to the method of this embodiment.

[0037] The method in this embodiment yields the following result: Figure 4 The results shown in the figure indicate that Y579F represents the mutant protein, Y566F represents the control protein, and WT represents the original CD96 protein.

[0038] Changes in the stemness of tumor stem cells; the stronger the stemness, the more spheroids form. Figure 4 It can be seen that the mutant-encoded protein prevents MCF-7 tumor cells from forming spheres, inhibits the maturation and development of tumor cells, and destroys the stemness and other characteristics of tumor cells.

[0039] Example 7 In this embodiment, the cells obtained in Example 2 were subjected to a cell immunofluorescence experiment. Furthermore, the protein obtained by mutating tyrosine at position 566 of the original CD96 amino acid sequence to phenylalanine, and the CD96 protein, were used as controls in cell immunofluorescence experiments on cells obtained according to the method in Example 2. Figure 5 The results are shown.

[0040] In the figure, Y579F represents the protein encoded by the mutant of SEQ ID NO.4, Y566F represents the control protein, and WT represents the original CD96 protein.

[0041] The method for cell immunofluorescence assay is as follows: Cells were evenly seeded on coverslips and, after adhesion, were treated according to the experimental design. After treatment, cells were washed 2-3 times with PBS, fixed with 4% paraformaldehyde for 15 minutes, washed 1-2 times with PBS, and then blocked with PBS containing 5% bovine serum albumin for 20 minutes at room temperature. Rabbit anti-human Stat3 antibody was diluted with PBS containing 1% bovine serum albumin and incubated with cells overnight at 4°C. The next day, cells were washed twice with PBS, then incubated with Alexa Fluor® 488 conjugated secondary antibody for the corresponding species at room temperature for 1 hour, washed twice more with PBS, and mounted with anti-fluorescence quencher (Thermo Fisher). Images were acquired using an LSM800 (Zeiss). Cell nuclei were counterstained with DAPI (4',6-diamidino-2-phenylindole, Life Technologies) for 15 minutes, washed 3 times with PBS, mounted with anti-fluorescence quencher, and images were captured using an LSM800 (Zeiss).

[0042] In this embodiment, cell immunofluorescence technology was used to detect the activation state of STAT3, an important downstream signaling node after the mutant functional motif; the activated STAT3 protein enters the cell nucleus in greater quantities. Figure 5 It can be seen that the activation state of the mutant of the present invention is suppressed.

[0043] The results of Examples 2-5 of this invention show that the mutant protein provided by this invention can be successfully transfected in recipient cells and can inhibit the regulatory effect of CD96 on tumor stem cells, thereby inhibiting tumor stemness and other characteristics, providing a precise site and method for targeting tumor stem cells.

[0044] Example 8 This embodiment specifically provides a detection kit for mutant SEQ ID NO.1, which includes primers, 5X PrimeScript Buffer 2 μl, 1X PrimeScript RT Enzyme Mix I 0.5 μl, Oligo dT Primer 0.5 μl, Random 6 mers 0.5 μl, and 300 ng RNA. The forward primer nucleotide sequence is shown in SEQ ID NO.5: 5'-TTCCTCAACAGACCCTCCAC-3'; The reverse primer nucleotide sequence is shown in SEQ ID NO.6: 5'-TGGGTTGAGGAGTGGTGTTT-3'.

[0045] The assay method using the kit was as follows: Cells were digested with 0.25% trypsin, washed twice with PBS, and total RNA was analyzed using TRIzol. TM Extracted from (Cat# 10296010, Thermo). RNA was reverse transcribed into cDNA using the PrimeScript RT reagent Kit (Cat#RR037B, Takara). The reaction system was prepared as follows: 2 μl of 5X PrimeScript Buffer, 0.5 μl of 1X PrimeScript RT EnzymeMix I, 0.5 μl of Oligo dT Primer, 0.5 μl of Random 6 mers, 300 ng RNA, and RNaseFree dH2O to make up to 10 μl. The reaction conditions were 37°C for 15 min, 85°C for 5 sec, and storage at 4°C.

[0046] Gene expression was detected using qPCR premixes (Cat# 639676, Takara). The reaction mixture consisted of 10 µl of TBGreen Advantage qPCR Premix (2X), 0.4 µl of forward primer, 0.4 µl of reverse primer, 2 µl of template, and 7.2 µl of PCR-grade H2O. The reaction was performed in the dark under the following conditions: 95°C for 3–5 sec, 60–66°C for 20–30 sec, for a total of 40 cycles. Fluorescence intensity changes were measured.

[0047] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A gene mutant of a tumor stem cell marker, characterized in that: Its nucleotide sequence is shown in SEQ ID NO.

1.

2. The protein encoded by the gene mutant as described in claim 1, characterized in that: Its amino acid sequence is shown in SEQ ID NO.

4.

3. The protein encoded by the gene mutant as described in claim 2, characterized in that: The method of obtaining it includes the following steps: Construction of S1 recombinant nucleic acid body: The recombinant nucleic acid body comprises a vector of the gene mutant of claim 1 or a mutant gene fragment of the gene mutant, wherein the nucleotide sequence of the mutant gene fragment is shown in SEQ ID NO.2; S2 recombinant nucleic acid was transfected into recipient cells; Expression and acquisition of S3 receptor proteins in cells.

4. A kit for detecting the gene mutant of claim 1, characterized in that: It includes a PCR detection reagent kit and primers, wherein the primers include: The forward primer has the nucleotide sequence shown in SEQ ID NO.5; The reverse primer has the nucleotide sequence shown in SEQ ID NO.

6.

5. The application of the gene mutant as described in claim 1 in the preparation of antitumor products, characterized in that: The anti-tumor product is a drug that inhibits MCF-7 cells.

6. The application of the gene mutant as described in claim 5 in the preparation of antitumor products, characterized in that: The antitumor product is a recombinant nucleic acid containing the gene mutant of claim 1; or The antitumor product is a recombinant nucleic acid containing a mutant gene fragment of the gene mutant described in claim 1, and the nucleotide sequence of the mutant gene fragment is shown in SEQ ID NO.

2.

7. The application of the gene mutant as described in claim 6 in anti-tumor products, characterized in that: The recombinant nucleic acid is viral and / or plasmid DNA.

Images