A multi-gene vector assembly system and a method for constructing a multi-gene expression vector

Abstract

The application belongs to the technical field of genetic engineering, and discloses a multi-gene vector assembly system and a construction method of a multi-gene expression vector. The multi-gene vector assembly system comprises two modular entry vectors and one target vector. The entry vector is characterized by comprising a pair of different Gateway recombination sites and two screening markers therebetween; the target vector comprises two pairs of recombination sites which are subjected to irreversible Gateway recombination reaction with the entry vector, and each pair of recombination sites has one negative screening marker therebetween. The system adopts two rounds of Gibson cloning to clone multiple target genes to the positions of the two screening markers of the entry vector, and finally integrates the target genes on the two entry vectors into the target vector through one-step Gateway recombination reaction. The application adopts a polymerization strategy to assemble multiple target genes into one expression vector, and is more flexible, time-saving, simple and efficient.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, and in particular relates to a multi-gene vector assembly system and a method for constructing multi-gene expression vectors. Background Technology

[0002] With the development of synthetic biology, there is an increasing demand for transgenic multiple genes to improve multiple agronomic traits, synthesize natural metabolites, and synthesize protein complexes with important functions; the core requirement is the construction and genetic transformation of multi-gene expression vectors. However, most existing expression vectors can only construct vectors for a single target gene. Because loading multiple target genomes into a single expression vector is quite challenging, the assembly of multi-gene expression vectors remains a hot topic and a difficult challenge in current genetic engineering research.

[0003] Currently, various methods exist for assembling and constructing multi-gene expression vectors, including methods based on rare and homing restriction endonucleases (Dafny-Yelin et al., 2007), Gateway recombination (Chen et al., 2006; Wakasa et al., 2006), Golden Gate cloning (Engler et al., 2008; Goosens et al., 2021), Gibson cloning (Gibson et al., 2009), and Cre / loxP cloning (Lin et al., 2003; Zhu et al., 2017). Rare and homing restriction endonucleases, as well as Golden Gate cloning, are all based on restriction endonucleases. However, the high frequency of these restriction endonuclease cleavage sites in the plant genome limits their use in constructing plant multi-gene expression vectors. Gibson cloning can simultaneously ligate multiple DNA fragments with terminal overlap, but specificity and accuracy decrease significantly when a large number of DNA fragments are ligated. Gateway recombination employs two strategies: multi-site and multi-round vector methods. However, the limited number of att sites in the Gateway recombination system restricts the ligation of a large number of DNA fragments. The multi-round vector strategy, on the other hand, requires cumbersome steps to construct the donor vector in each round of reactions. The Cre / loxP recombination system theoretically allows the ligation of any number of target genes through multiple rounds of reactions. However, Cre / loxP recombination efficiency is low, it cannot be performed in vitro, and each transformation requires a specific homing endonuclease to remove a loxp site, demanding a high level of experience from the experimenter. Therefore, the development of a simple and efficient multi-gene vector construction system is urgently needed for applications in metabolic engineering and synthetic biology.

[0004] References:

[0005] Bock,R.Strategies for metabolic pathway engineering with multipletransgenes.Plant Mol Biol.2013。

[0006] Chen,Q.;Zhou,H.;Chen J.;Wang X.A Gateway-based platform for multigeneplant transformation.Plant Mol Biol.2006,62,927–936。

[0007] Dafny-Yelin,M.;Chung,S.M.;Frankman,E.L.;Tzfira,T.(2007).pSAT RNAinterference vectors:a modular series for multiple gene down-regulation inplants.Plant Physiol,145,4,1272-1281。

[0008] Ghareeb,H.,Laukamm,S.,&Lipka,V.(2016).COLORFUL-circuit:a platform forrapid multigene assembly,delivery,and expression in plants.Frontiers in plantscience,7,246。

[0009] Gibson,D.G.;Young,L.;Chuang,R.;Venter,J.C.;Hutchison,C.A.;Smith,H.O.Enzymatic assembly of DNA molecules up to several hundred kilobases.NatMethods.2009,6,5,343-345。

[0010] Goosens,VJWalker,KTAragon,SMSingh,A.Senthivel,VRDekker,L.Caro-Astorga,J.Buat,MLA,Song,W.Lee,K.Ellis,T.Komagataeibacter toolkit(KTK):a modular cloning system for multigene constructs and programmed protein secretion from cellulose producing bacteria.ACSynthetic biology,2021,10,12,3422-3

[0011] Lin, L. and Liu, YG, Xu, X. and Li, B. (2003).Efficient linking and transfer of multiple genes by a multigene assembly and transformation vector system.PNatl Acad Sci Usa, 2003, 100, 10, 5962-5967.

[0012] Rascon-Cruz,Q.Gonzalez-Barriga,CD;Churches-Figueroa,BF,Trejo- JC;Siqueiros-Cendón,T.Sinagawa-García,SR,Arévalo-Gallegos.S.Espinoza-Sanchez,EAPlastid transformation:Advances and challenges for its implementation in agricultural crops.Electron J Biotechnol.2021,51.

[0013] Wakasa, Y.; Yasuda, H.; Takaiwa, F. High accumulation of bioactive peptide in transgenic rice seeds by expression of introduced multiple genes. Plant Biotechnol J, 2006, 4, 5, 499-510.

[0014] Zhu, Q.; Wang B.; Tan J.; Liu T.; Li L.; Liu Y. Plant synthetic metabolic engineering for enhancing crop nutritional quality. Plant Comm. 2020, 1, 100017.

[0015] Based on the above analysis, the problems and shortcomings of the existing technology are as follows:

[0016] (1) Existing multi-gene vector construction systems reported in the technology mostly adopt the strategy of sequentially linking the target genes, which is complicated and time-consuming.

[0017] (2) Existing technologies have low efficiency in sequence linking when assembling multiple genes. Summary of the Invention

[0018] To overcome the problems existing in related technologies, the present invention discloses a multi-gene vector assembly system and a method for constructing a multi-gene expression vector.

[0019] The technical solution is as follows: A multi-gene vector assembly system includes two entry vectors (pL1-CmRccdB-LacZ-L2 and pL3-CmRccdB-LacZ-L4) and one target vector (pDESattR1-4). Multiple target genes are simultaneously assembled into the two entry vectors using two rounds of Gibson cloning. Finally, the target genes on the entry vectors are integrated into the target vector through a one-step Gateway recombination reaction using an aggregation strategy, resulting in a multi-gene expression vector containing multiple target genes.

[0020] The entry carrier ( Figure 1 A) is an intermediate vector used in the multi-genome assembly process to load exogenous target genes or DNA fragments. It can be assembled with multiple target genes through two rounds of Gibson cloning. The vector has the following characteristics:

[0021] 1) Contains a bacterial antibiotic selection gene, including but not limited to the ampicillin resistance gene (AmpR), the AmpR sequence of which is shown in SEQ ID NO:4;

[0022] 2) It has a plasmid replicon element, including but not limited to pUC ori, the pUC ori sequence being shown in SEQ ID NO:5;

[0023] 3) It has two Gateway recombinase recognition sites that do not undergo recombination reactions with each other, wherein pL1-CmRccdB-LacZ-L2 includes, but is not limited to, attL1 and attL2, and pL3-CmRccdB-LacZ-L4 includes, but is not limited to, attL3 and attL4; wherein the attL1 sequence is shown in SEQ ID NO:6, the attL2 sequence is shown in SEQ ID NO:7, the attL3 sequence is shown in SEQ ID NO:13, and the attL4 sequence is shown in SEQ ID NO:14;

[0024] 4) It has two selection markers, including but not limited to the toxin protein gene (ccdB) and the blue-white selection gene (LacZ); wherein the ccdB sequence is shown in SEQ ID NO:8 and the LacZ sequence is shown in SEQ ID NO:9;

[0025] 5) There are linker sequences containing several restriction endonuclease cleavage sites between the ccdB gene and the attL1 / attL3 sites, and between the ccdB gene and the LacZ gene, including but not limited to linker sequences containing restriction endonuclease recognition sites such as MluI-SphI-SacI and NdeI-HindIII-MluI-SfiI; the linker sequences containing restriction endonuclease recognition sites such as MluI-SphI-SacI and NdeI-HindIII-MluI-SfiI are shown in SEQ ID NO:10 and SEQ ID NO:11, respectively. The MluI cleavage site is ACGCGT; the SphI cleavage site is GCATGC; the SacI cleavage site is GAGCTC; the NdeI cleavage site is CATATG; the HindIII cleavage site is AAGCTT; and the first SfiI cleavage site is GGCCTCGTCGGCC.

[0026] 6) There is a linker sequence containing several restriction endonuclease sites between the LacZ gene and the attL2 / attL4 sites, including but not limited to a linker sequence containing the SfiI-MluI restriction endonuclease recognition site; the linker sequence containing the SfiI-MluI restriction endonuclease recognition site is shown in SEQ ID NO:12; the second SfiI restriction site is GGCCAGTCTGGCC.

[0027] The target carrier ( Figure 1 B) is a vector that ultimately loads a foreign target gene or DNA fragment during multi-genome assembly. It serves as an expression vector in plant transformation (including Agrobacterium-mediated transformation or gene gun methods) and possesses the corresponding vector backbone and elements when used in other organisms. The vector has the following characteristics:

[0028] (1) Having a bacterial antibiotic selection marker gene that is different from the entry vector, including but not limited to the kanamycin resistance gene (KanR). The KanR sequence is shown in SEQ ID NO:16.

[0029] (2) It has sites that can undergo irreversible recombination with two Gateway recombination sites in the entry vector pL1-CmRccdB-LacZ-L2, including but not limited to attR1 and attR2; the sequences of attR1 and attR2 are shown in SEQ ID NO:17 and SEQ ID NO:18, respectively.

[0030] (3) It has sites that can undergo irreversible recombination with two Gateway recombination sites in the entry vector pL3-CmRccdB-LacZ-L4, including but not limited to attR3 and attR4; the sequences of attR3 and attR4 are shown in SEQ ID NO:19 and SEQ ID NO:20, respectively.

[0031] (4) There is a negative selection marker between attR1 and attR2 sites, including but not limited to the toxin protein gene (ccdB), the ccdB sequence of which is shown in SEQ ID NO:10;

[0032] (5) There is a negative selection marker between attR3 and attR4 sites, including but not limited to the sucrose lethal gene (SacB), the SacB sequence of which is shown in SEQ ID NO:21.

[0033] As those skilled in the art will understand, the preferred embodiments used in the above technical solutions are, but are not limited to, preferred technical means adopted further within the scope of this application, intended to express that the above technical means need to exist in a way that is relatively easy to implement or relatively easy to achieve good results. Other similar means or technical features, solutions obtained under the technical teaching of this application all fall within the protection scope of this application. Therefore, this is stated here.

[0034] In one embodiment, the initiation carrier pL1-CmRccdB-LacZ-L2 is prepared by the following steps:

[0035] (1) Replace the kanamycin resistance gene of pENTR-Gus with the ampicillin resistance gene: amplify the vector sequences at both ends of the pENTR-Gus kanamycin resistance gene using primers P1-P2, amplify the ampicillin resistance gene of the pGEM-T easy vector using primers P3-P4, and connect the two sequences into pENTR-Gus-amp using the ClonExpress Ultra One Step Cloning Kit homologous recombination kit;

[0036] (2) Artificially synthesized toxin protein gene (ccdB) and blue-white screening gene (LacZ) elements: The pDEST15 vector was amplified with primers P5-P6 containing restriction sites to obtain the MluI-SpeI-SacI-CmRccdB sequence. The pGEM-T easy vector was amplified by primers P7-P8 and P9-P10 in two rounds of PCR to obtain the SfiI-LacZ-SfiI-MluI sequence. Then, the two DNA fragments were fused into the MluI-SpeI-SacI-CmRccdB-NdeI-HindIII-MluI-SfiI-LacZ-SfiI-MluI element by overlapping PCR with primers P11-P12.

[0037] (3) Assembly of pL1-CmRccdB-LacZ-L2: The sequences at both ends of the Gus gene in the pENTR-Gus-amp vector were amplified using primers P13-P14. The resulting sequences were then linked with the MluI-SpeI-SacI-CmRccdB-NdeI-HindIII-MluI-SfiI-LacZ-SfiI-MluI element using the ClonExpress Ultra One Step Cloning Kit homologous recombination kit to form pL1-CmRccdB-LacZ-L2.

[0038] In one embodiment, the introductory carrier pL3-CmRccdB-LacZ-L4 is prepared by the following steps:

[0039] ①AttL site mutation: Using two pairs of mutation primers P15-P16 and P17-P18, the ampR-attL1 and CmRccdB-LacZ-attL2 sequences in pL1-CmRccdB-LacZ-L2 were mutated to ampR-attL3 and cmRccdB-LacZ-attL4.

[0040] ② Assembly of pL3-CmRccdB-LacZ-L4: The mutated ampR-attL3 and cmRccdB-LacZ-attL4 were further linked using the ClonExpress Ultra One StepCloning Kit to obtain pL3-CmRccdB-LacZ-L4.

[0041] In one embodiment, the target vector pDESattR1-4 is prepared by the following steps:

[0042] (i) Linearization of the pCAMBIA1300 vector: The sequences at both ends of the pCAMBIA1300 vector LacZα were amplified using primers P19-P20 to linearize it;

[0043] (ii) Cloning of the attR1-CmRccdB-attR2 element: The attR1-CmRccdB-attR2 sequence in the pDEST15 vector was amplified using primers P21-P22.

[0044] (iii) Cloning of the attR3-LacZ-SacB-attR4 element: Primers P23-P24 and P25-P26 were designed to mutate attR1 and attR2 into attR3 and attR4, respectively. LacZ and SacB sequences were amplified from pGEMT easy and pCasPA vectors using primers P27-P28 and P29-P30, respectively. Finally, the attR3-LacZ-SacB-attR4 sequence was assembled using the overlapping PCR strategy with primers P23 / P26.

[0045] (iv) Assembly of pDESattR1-4: The linearized pCAMBIA1300 vector, attR1-CmRccdB-attR2, and attR3-LacZ-SacB-attR4 were ligated into pDESattR1-4 using the ClonExpress Ultra One Step Cloning Kit homologous recombination kit.

[0046] Another objective of this invention is to provide a method for assembling a multi-gene vector, which is a specific application of the aforementioned multi-gene vector assembly system. This method utilizes two rounds of restriction endonuclease digestion combined with Gibson cloning to simultaneously assemble different target genes into two entry vectors. Finally, an irreversible Gateway LR reaction is used to load the entry vector into the target vector, resulting in an expression vector containing multiple target genes. The specific steps are as follows (…). Figure 2 ):

[0047] S1: The entry vectors pL1-CmRccdB-LacZ-L2 and pL3-CmRccdB-LacZ-L4 were double-digested with SphI / SacI and NdeI / HindIII to remove the CmRccdB element. The digested vectors were then recovered to obtain linearized entry vectors. Overlapping PCR was used to amplify the target gene expression cassette containing the promoter, the coding region of the target gene, and the terminator. The target gene and the linearized entry vector had homologous ends of 15-20 bp. One or more genes were then simultaneously assembled into the linearized entry vectors using Gibson cloning to obtain two intermediate entry vectors, pL1-N1G-LacZ-L2 and pL3-N2G-LacZ-L4.

[0048] S2: The two intermediate entry vectors obtained in step S1 were digested with SfiI to remove the LacZ element. The digested vectors were recovered to obtain linearized intermediate entry vectors. The target gene expression cassette containing the promoter, the coding region of the target gene, and the terminator was obtained by overlapping PCR amplification. The target gene and the linearized intermediate entry vectors have homologous ends of 15-20 bp. One or more genes were further assembled into the linearized intermediate entry vectors simultaneously by Gibson cloning to obtain two final entry vectors pL1-N1G-N3G-L2 and pL3-N2G-N4G-L4.

[0049] S3: The entry vector obtained in step S2 is mixed with the target vector pDESattR1-4. After a Gateway LR recombination reaction, the target genes loaded in the entry vectors pL1-N1G-N3G-L2 and pL3-N2G-N4G-L4 are integrated into the attR1-attR2 and attR3-attR4 sites of the pDESattR1-4 vector, respectively, to finally obtain the expression vector pDES-NG containing multiple target genes.

[0050] In one embodiment, the multi-gene vector assembly system was used to obtain the multi-gene expression vector pDES-4G containing four target genes, the sequence of which is SEQ ID NO:24.

[0051] In one embodiment, the multi-gene vector assembly system is used to assemble nine genes into the target vector pDESattR1-4 to obtain a multi-gene expression vector pDES-9G containing nine target genes, the sequence of which is SEQ ID NO:25.

[0052] Another objective of this invention is to provide an application of the aforementioned multi-gene vector assembly system in the construction of multi-gene expression vectors, multi-gene genetic transformation, and the cultivation of transgenic organisms.

[0053] Combining all the above technical solutions, the advantages and positive effects of this invention are as follows:

[0054] First, addressing the technical problems and difficulties in solving the aforementioned existing technologies, and closely combining the technical solution to be protected by this invention with the results and data from the research and development process, this paper provides a detailed and in-depth analysis of how the technical solution of this invention solves the technical problems and the creative technical effects brought about by solving these problems: This invention combines Gibson cloning and Gateway recombination, two multi-gene vector construction strategies, improving the efficiency and accuracy of sequence ligation while assembling multiple genes. This invention designs a modular entry vector, significantly reducing the difficulty of vector construction. This invention employs a polymerization assembly strategy, integrating the target gene on the entry vector into the target vector through a one-step Gateway recombination reaction, greatly shortening the vector construction time. The system provided by this invention has application value in constructing multi-gene expression vectors. The multi-gene expression vectors constructed by this system can be used for multi-gene transformation and expression or for cultivating transgenic organisms.

[0055] Secondly, considering the technical solution as a whole or from a product perspective, the technical effects and advantages of the technical solution protected by this invention are specifically described as follows: Most reported multi-gene vector construction systems employ a strategy of sequentially linking target genes, resulting in cumbersome and time-consuming vector construction steps. This invention designs a modular introductory vector, combining Gibson cloning and Gateway recombination methods for multi-gene vector construction, and uses an aggregation strategy to load multiple target genomes into a single expression vector; this simplifies operation and significantly shortens vector construction time, making it simpler and more efficient. This invention provides a simple and efficient multi-gene vector construction platform for genetic operations such as improving multiple agronomic traits, synthesizing natural metabolites, and synthesizing protein complexes with important functions, and has significant application value. Attached Figure Description

[0056] The accompanying drawings, which are incorporated in and form a part of this specification, illustrate embodiments consistent with this disclosure and, together with the description, serve to explain the principles of this disclosure.

[0057] Figure 1Figure 1 is a schematic diagram of the multi-gene vector assembly system provided in this embodiment of the invention; Figure 2a shows the structure of the entry vectors pL1-CmRccdB-LacZ-L2 and pL3-CmRccdB-LacZ-L4. The entry vector has a bacterial antibiotic selection gene (ampicillin resistance gene, AmpR), an Escherichia coli plasmid replicon (pUC ori), and a Gateway recombination region (with two selection genes, ccdB and LacZ, between the two attL sites). Figure 3b shows the structure of the target vector pDESattR1-4. It contains a bacterial resistance selection gene (kanamycin resistance gene, KanR) different from the entry vector, a plant selection marker gene (hygromycin resistance gene, HygR), an Escherichia coli plasmid replicon (pBR322 ori), an Agrobacterium plasmid replicon (pVS1), and two Gateway recombination regions (attR1-CmRccdB-attR2 and attR3-SacB-attR3).

[0058] Figure 2 The multi-gene vector assembly method provided in this embodiment of the invention is illustrated. This system employs two rounds of Gibson cloning to sequentially insert multiple target genes into the positions of two selection markers in the entry vector, and finally integrates multiple genes from the entry vector into the target vector simultaneously through a one-step Gateway recombination.

[0059] Figure 3 This is a flowchart illustrating the assembly process of four target genes provided in this embodiment of the invention. After two rounds of Gibson cloning, the OsC1 and OsDRF, OsRb and eGFP expression cassettes were assembled into the entry vectors pL1-CmRccdB-LacZ-L2 and pL3-CmRccdB-LacZ-L4, respectively, resulting in the assembled entry vectors pL1-C1-DRF-L2 and pL3-Rb-eGFP-L4. Finally, through a one-step Gateway LR reaction, the four target genes from the two entry vectors were integrated into the target vector pDESattR1-4, yielding pDES-4G.

[0060] Figure 4 This is a schematic diagram of the T-DNA structure of the pDES-4G vector assembled with four target genes. Its full-length T-DNA is approximately 11 kb, containing the hygromycin resistance gene (HygR) and the four assembled target genes.

[0061] Figure 5 This is the electrophoretic pattern of the pDES-4G vector after digestion with MluI.

[0062] Figure 6This invention provides an assembly flowchart for nine target genes. Through two rounds of Gibson cloning, OsC1, OsDRF, eGFP, PgUGT94Q2, and PgUGT74AE2, as well as PgDS, PgPPDS, OsRb, and Gus expression cassettes, were assembled into the entry vectors pL1-CmRccdB-LacZ-L2 and pL3-CmRccdB-LacZ-L4, respectively, resulting in the assembled entry vectors pL1-C1-DRF-GFP-94-74-L2 and pL3-DS-PPDS-Rb-Gus-L4. Finally, through a one-step Gateway LR reaction, the nine target genes from the two entry vectors were integrated into the target vector pDESattR1-4, yielding pDES-9G.

[0063] Figure 7 This is a schematic diagram of the T-DNA structure of the pDES-9G vector assembled with 9 target genes. Its full-length T-DNA is approximately 24kb, containing the hygromycin resistance gene (HygR) and 9 assembled target genes.

[0064] Figure 8 This is an electrophoresis pattern of the pDES-9G vector after MluI digestion. No MluI restriction site was added between the OsRb and Gus expression cassettes, while three MluI restriction sites were present inside the Gus expression cassette. Detailed Implementation

[0065] To make the above-mentioned objects, features, and advantages of the present invention more apparent and understandable, specific embodiments of the present invention will be described in detail below with reference to the accompanying drawings. Many specific details are set forth in the following description to provide a thorough understanding of the present invention. However, the present invention can be practiced in many other ways different from those described herein, and those skilled in the art can make similar modifications without departing from the spirit of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.

[0066] Unless otherwise specified, the experimental techniques and methods used in the following examples are all conventional molecular biology techniques, and researchers in the field can achieve the results by following conventional molecular biology techniques. Unless otherwise specified, the materials and reagents used are commercially available.

[0067] This invention provides a multi-gene vector assembly system comprising: two entry vectors and one target vector. Each entry vector has a pair of gateway recombination sites and two selection markers between these sites. These selection markers can be removed sequentially by two rounds of restriction endonuclease digestion or PCR. Multiple target genes are then assembled into the two entry vectors using two rounds of Gibson cloning. The target vector has two pairs of gateway recombination sites that undergo irreversible gateway recombination with the entry vectors. Each pair of gateway recombination sites has a negative selection marker between it. Using an aggregation strategy, the target genes on the entry vectors are integrated into the target vector through a single gateway recombination reaction, resulting in a multi-gene expression vector containing multiple target genes.

[0068] In a preferred embodiment of the present invention, the introductory vectors are pL1-CmRccdB-LacZ-L2 and pL3-CmRccdB-LacZ-L4, and the corresponding vector sequences are SEQ ID NO:1 and SEQ ID NO:2, respectively; the target vector is pDESattR1-4, and the vector sequence is SEQ ID NO:3.

[0069] In a preferred embodiment of the present invention, the entry carrier pL1-CmRccdB-LacZ-L2 includes:

[0070] (1) Contains a bacterial antibiotic selection gene, including but not limited to the ampicillin resistance gene (AmpR), the AmpR sequence of which is shown in SEQ ID NO:4;

[0071] (2) It has a plasmid replicon element, including but not limited to pUC ori, the pUC ori sequence being shown in SEQ ID NO:5;

[0072] (3) It has two Gateway recombinase recognition sites that do not undergo recombination reactions with each other, including but not limited to attL1 and attL2, wherein the attL1 sequence is shown in SEQ ID NO:6 and the attL2 sequence is shown in SEQ ID NO:7;

[0073] (4) It has two selection markers, including but not limited to the toxin protein gene (ccdB) and the blue-white selection gene (LacZ), wherein the ccdB sequence is shown in SEQ ID NO:8 and the LacZ sequence is shown in SEQ ID NO:9;

[0074] (5) There are linker sequences containing several restriction endonuclease cleavage sites between the ccdB gene and the attL1 site and between the ccdB gene and the LacZ gene, preferably including but not limited to linker sequences containing MluI-SphI-SacI and NdeI-HindIII-MluI-SfiI restriction endonuclease recognition sites. The linker sequences containing MluI-SphI-SacI and NdeI-HindIII-MluI-SfiI restriction endonuclease recognition sites are shown in SEQ ID NO:10 and SEQ ID NO:11, respectively; wherein the MluI cleavage site is ACGCGT; the SphI cleavage site is GCATGC; the SacI cleavage site is GAGCTC; the NdeI cleavage site is CATATG; the HindIII cleavage site is AAGCTT; and the first SfiI cleavage site is GGCCTCGTCGGCC.

[0075] (6) There is a linker sequence containing several restriction endonuclease sites between the LacZ gene and the attL2 site, including but not limited to a linker sequence containing the SfiI-MluI restriction endonuclease recognition site, as shown in SEQ ID NO:12; the second SfiI restriction site is GGCCAGTCTGGCC.

[0076] In a preferred embodiment of the present invention, the entry carrier pL3-CmRccdB-LacZ-L4 includes:

[0077] 1) Contains a bacterial antibiotic selection gene, including but not limited to the ampicillin resistance gene (AmpR), the AmpR sequence of which is shown in SEQ ID NO:4;

[0078] 2) It has a plasmid replicon element, including but not limited to pUC ori, with the sequence shown in SEQ ID NO:5;

[0079] 3) It has two Gateway recombinase recognition sites that are different from pL1-CmRccdB-LacZ-L2 and do not undergo recombination reactions with each other, including but not limited to attL3 and attL4, wherein the attL3 sequence is shown in SEQ ID NO:13 and the attL4 sequence is shown in SEQ ID NO:14;

[0080] 4) It has two selection markers, including a toxin protein gene (ccdB) and a blue-white selection gene (LacZ), wherein the ccdB sequence is shown in SEQ ID NO:8 and the LacZ sequence is shown in SEQ ID NO:9;

[0081] 5) There are linker sequences containing several restriction endonuclease cleavage sites between the ccdB gene and the attL3 site, and between the ccdB gene and the LacZ gene, including but not limited to linker sequences with MluI-SphI-SacI and NdeI-HindIII-MluI-SfiI restriction endonuclease recognition sites. The linker sequences containing MluI-SphI-SacI and NdeI-HindIII-MluI-SfiI restriction endonuclease recognition sites are shown in SEQ ID NO:10 and SEQ ID NO:11, respectively; wherein the MluI cleavage site is ACGCGT; the SphI cleavage site is GCATGC; the SacI cleavage site is GAGCTC; the NdeI cleavage site is CATATG; the HindIII cleavage site is AAGCTT; and the first SfiI cleavage site is GGCCTCGTCGGCC.

[0082] 6) There is a linker sequence between the LacZ gene and the attL4 site containing several restriction endonuclease sites, including but not limited to a linker sequence with an SfiI-MluI restriction endonuclease recognition site, the sequence containing the SfiI-MluI restriction endonuclease recognition site is shown in SEQ ID NO:12; the second SfiI restriction site is GGCCAGTCTGGCC.

[0083] In a preferred embodiment of the present invention, the target carrier pDESattR1-4 comprises:

[0084] ① Contains bacterial antibiotic selection genes that differ from the entry vector, including but not limited to the kanamycin resistance gene (KanR); the KanR sequence is shown in SEQ ID NO:15;

[0085] ② It has a plant selection marker gene, preferably a hygromycin resistance gene (HygR), the HygR sequence of which is shown in SEQ ID NO:16;

[0086] ③ It has sites that can undergo irreversible recombination with two Gateway recombination sites in the entry vector pL1-CmRccdB-LacZ-L2, including but not limited to attR1 and attR2, the sequences of attR1 and attR2 being shown in SEQ ID NO:17 and SEQ ID NO:18, respectively;

[0087] ④ Sites that can undergo irreversible recombination with two Gateway recombination sites in the entry vector pL3-CmRccdB-LacZ-L4, including but not limited to attR3 and attR4, the sequences of attR3 and attR4 are shown in SEQ ID NO:19 and SEQ ID NO:20, respectively;

[0088] ⑤ There is a negative selection marker between attR1 and attR2 sites, including but not limited to the toxin protein gene (ccdB), the sequence of which is shown in SEQ ID NO:10;

[0089] ⑥ There is a negative selection marker between attR3 and attR4 sites, including but not limited to the sucrose lethal gene (SacB), the sequence of which is shown in SEQ ID NO:21;

[0090] ⑦ It has an E. coli replicon element, including but not limited to pBR322 ori, the pBR322 ori sequence of which is shown in SEQ ID NO:22;

[0091] ⑧ It has an Agrobacterium replicon element, including but not limited to pVS1, the pVS1 sequence of which is shown in SEQ ID NO:23.

[0092] In a preferred embodiment of the present invention, the initiation carrier pL1-CmRccdB-LacZ-L2 is prepared by the following steps:

[0093] (1) Replace the kanamycin resistance gene of pENTR-Gus with the ampicillin resistance gene: amplify the vector sequences at both ends of the pENTR-Gus kanamycin resistance gene and the ampicillin resistance gene of the pGEM-T easy vector by PCR, and connect the two sequences into pENTR-Gus-amp using the ClonExpress Ultra One Step Cloning Kit homologous recombination kit;

[0094] (2) Artificial synthesis of toxin protein gene (ccdB) and blue-white screening gene (LacZ) elements: Primers containing restriction sites were designed and the toxin protein gene (ccdB) and blue-white screening gene (LacZ) sequences of pDEST15 and pGEM-T easy vectors were amplified by PCR to obtain two sequences: MluI-SpeI-SacI-CmRccdB-NdeI-HindIII-MluI and SfiI-LacZ-SfiI-MluI. Then, the MluI-SpeI-SacI-CmRccdB-NdeI-HindIII-MluI-SfiI-LacZ-SfiI-MluI elements were amplified by overlapping PCR.

[0095] (3) Assembly of pL1-CmRccdB-LacZ-L2: The sequences at both ends of the Gus gene in the pENTR-Gus-amp vector were amplified by PCR. The obtained sequences were then linked with the MluI-SpeI-SacI-CmRccdB-NdeI-HindIII-MluI-SfiI-LacZ-SfiI-MluI element using the ClonExpress Ultra One Step Cloning Kit homologous recombination kit to form pL1-CmRccdB-LacZ-L2.

[0096] In a preferred embodiment of the present invention, the initiation carrier pL3-CmRccdB-LacZ-L4 is prepared by the following steps:

[0097] ①AtL site mutation: The ampR-attL1 and CmRccdB-LacZ-attL2 sequences in pL1-CmRccdB-LacZ-L2 were mutated to ampR-attL3 and cmRccdB-LacZ-attL4 using two pairs of mutation primers.

[0098] ② Assembly of pL3-CmRccdB-LacZ-L4: The mutated ampR-attL3 and cmRccdB-LacZ-attL4 were further linked using the ClonExpress Ultra One StepCloning Kit to obtain pL3-CmRccdB-LacZ-L4.

[0099] In a preferred embodiment of the present invention, the target carrier pDESattR1-4 is prepared by the following steps:

[0100] (i) Linearization of pCAMBIA1300 vector: The sequences at both ends of the LacZα vector of pCAMBIA1300 were amplified by PCR to linearize it;

[0101] (ii) Cloning of the attR1-CmRccdB-attR2 element: The attR1-CmRccdB-attR2 sequence in the pDEST15 vector was obtained by PCR amplification.

[0102] (iii) Cloning of the attR3-LacZ-SacB-attR4 element: Primers were designed to mutate attR1 and attR2 into attR3 and attR4, respectively. LacZ and SacB sequences were amplified from pGEMT easy and pCasPA vectors by PCR. Finally, the attR3-LacZ-SacB-attR4 sequence was assembled by overlapping PCR.

[0103] (iv) Assembly of pDESattR1-4: The linearized pCAMBIA1300 vector, attR1-CmRccdB-attR2, and attR3-LacZ-SacB-attR4 were ligated into pDESattR1-4 using the ClonExpress Ultra One Step Cloning Kit homologous recombination kit.

[0104] In a preferred embodiment of the present invention, a method for constructing a multi-gene expression vector based on the multi-gene vector assembly system is provided, the method specifically including the following steps:

[0105] S1: The entry vectors pL1-CmRccdB-LacZ-L2 and pL3-CmRccdB-LacZ-L4 were double-digested with SphI / SacI and NdeI / HindIII to remove the CmRccdB element. The digested vectors were then recovered to obtain linearized entry vectors. Overlapping PCR was used to amplify the target gene expression cassette containing the promoter, the coding region of the target gene, and the terminator. The target gene and the linearized entry vector had homologous ends of 15-20 bp. One or more genes were then simultaneously assembled into the linearized entry vectors using Gibson cloning to obtain two intermediate entry vectors, pL1-N1G-LacZ-L2 and pL3-N2G-LacZ-L4.

[0106] S2: The two intermediate entry vectors obtained in step S1 were digested with SfiI to remove the LacZ element. The digested vectors were recovered to obtain linearized intermediate entry vectors. The target gene expression cassette containing the promoter, the coding region of the target gene, and the terminator was obtained by overlapping PCR amplification. The target gene and the linearized intermediate entry vectors have homologous ends of 15-20 bp. One or more genes were further assembled into the linearized intermediate entry vectors simultaneously by Gibson cloning to obtain two final entry vectors pL1-N1G-N3G-L2 and pL3-N2G-N4G-L4.

[0107] S3: The entry vector obtained in step S2 is mixed with the target vector pDESattR1-4. After a Gateway LR recombination reaction, the target genes loaded in the entry vectors pL1-N1G-N3G-L2 and pL3-N2G-N4G-L4 are integrated into the attR1-attR2 and attR3-attR4 sites of the pDESattR1-4 vector, respectively, to finally obtain the expression vector pDES-NG containing multiple target genes.

[0108] In the above embodiments, the sequence fragments involved are as follows:

[0109] The sequence SEQ ID NO:1 is:

[0110]

[0111] The sequence SEQ ID NO:2 is:

[0112]

[0113] The sequence SEQ ID NO:3 is:

[0114]

[0115] The sequence SEQ ID NO:4 (Ampicillin resistance gene, AmpR) is as follows:

[0116]

[0117] The sequence is SEQ ID NO: 5 (Escherichia coli plasmid replicon, pUC ori):

[0118] ATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGG

[0119] The sequence is SEQ ID NO: 6 (attL1):

[0120] CAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGC T

[0121] The sequence is SEQ ID NO: 7 (attL2):

[0122] ACCCAGCTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTT

[0123] The sequence is SEQ ID NO: 8 (CmRccdB):

[0124]

[0125] The sequence of SEQ ID NO: 9 (LacZ) is:

[0126] GCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGGATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGG

[0127] The sequence of SEQ ID NO: 10 (MluI-SphI-SacI ligation sequence) is:

[0128] CATTTAACTTTAAGAAGGAGATATATACCATGGTCCGTCCTGTAGAAACCCCAACCGCACGCGTCAGCATGCATGCATGCGAGCTCGCCAGACTACATAATACTGTAAAACACAACATATCCAGTCACTATGGCTGCCGCATTAGGCACCCCAGGC

[0129] The sequence of SEQ ID NO: 11 (NdeI-HindIII-MluI-SfiI ligation sequence) is:

[0130] ATGTCAGGCTCCCTTATACACAGCCAGTCTGCAGGTCGACACCATATGCCAAGCTTGGGCACGCGTCAGAGTGGTCTCTGTCCAGTCCTGGCCTCGTCGGCCATCTGTTACGCCGGCGGTAGAAGAGAAGCGGAAGA

[0131] The sequence SEQ ID NO:12 (SfiI-MluI linker sequence) is as follows:

[0132] AACCGAGGCCGGATTCATCATACTCTTAGGGATAACAGGGTAATCTTAGCTGATAAGCGCGGCGGGTGAGCGTCTTAGTCGACTACTCATCTGTTACGCCGGCGGTAGGGCCAGTCTGGCCACTTGTGGTCTGCTGAGACCCTGACGCGTGCGAACTTCGGTGAAAAACCGCAGCAGGGAGGCAAACAATAAT

[0133] The sequence SEQ ID NO:13(attL3) is:

[0134] CAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTATAATGCCAACTTTGTATAATAAAGTTGGTT

[0135] The sequence SEQ ID NO:14(attL4) is:

[0136] ACCCAACTTTTCTATACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTG

[0137] The sequence SEQ ID NO:15 (Kanamycin resistance gene, KanR) is as follows:

[0138] CTAAAACAATTCATCCAGTAAAATATAATATTTTATTTTCTCCCAATCAGGCTTGATCCCCAGTAAGTCAAAAAATAGCTCGACATACTGTTCTTCCCCGATATCCTCCCTGATCGACCGGACGCAGAAGGCAATGTCATACCACTTGTCCGCCCTGCCGCTTCTCCCAAGATCAATAAAGCCACTTACTTTGCCATCTTTCACAAAGATGTTGCTGTCTCCCAGGTCGCCGTGGGAAAAGACAAGTTCCTCTTCGGGCTTTTCCGTCTTTAAAAAATCATACAGCTCGCGCGGATCTTTAAATGGAGTGTCTTCTTCCCAGTTTTCGCAATCCACATCGGCCAGATCGTTATTCAGTAAGTAATCCAATTCGGCTAAGCGGCTGTCTAAGCTATTCGTATAGGGACAATCCGATATGTCGATGGAGTGAAAGAGCCTGATGCACTCCGCATACAGCTCGATAATCTTTTCAGGGCTTTGTTCATCTTCATACTCTTCCGAGCAAAGGACGCCATCGGCCTCACTCATGAGCAGATTGCTCCAGCCATCATGCCGTTCAAAGTGCAGGACCTTTGGAACAGGCAGCTTTCCTTCCAGCCATAGCATCATGTCCTTTTCCCGTTCCACATCATAGGTGGTCCCTTTATACCGGCTGTCCGTCATTTTTAAATATAGGTTTTCATTTTCTCCCACCAGCTTATATACCTTAGCAGGAGACATTCCTTCCGTATCTTTTACGCAGCGGTATTTTTCGATCAGTTTTTTCAATTCCGGTGATATTCTCATTTTAGCCA

[0139] The sequence is SEQ ID NO: 16 (hygromycin resistance gene, HygR):

[0140]

[0141] The sequence SEQ ID NO:17(attR1) is:

[0142] ACAAGTTTGTACAAAAAAGCTGAACGAGAAACGTAAAATGATATAAATATCAATATATTAAATTAGATTTTGCATAAAAAACAGACTACATAATACTGTAAAACACAACATATCCAGTCACTATG

[0143] The sequence SEQ ID NO:18(attR2) is:

[0144] CATAGTGACTGGATATGTTGTGTTTTACAGTATTATGTAGTCTGTTTTTTATGCAAAATCTAATTTAATTATTGATATTTATATCATTTTACGTTTCTCGTTCAGCT

[0145] The sequence SEQ ID NO:19(attR3) is:

[0146] GCAACTTTGTATAATAAAAGTTGAACGAGAAACGTAAAATGATATAAATATCAATATATTAAATTAGATTTTGCATAAAAAACAGACTACATAATACTGTAAAACACAACATATCCAGTCACTATG

[0147] The sequence SEQ ID NO:20(attR4) is:

[0148] CATAGTGACTGGATATGTTGTGTTTTACAGTATTATGTAGTCTGTTTTTTATGCAAAATCTAATTTAATATATTGATATTTATATCATTTTACGTTTCTCGTTCAACTTTTCTATACAAAGTTGG

[0149] The sequence SEQ ID NO:21(SacB) is:

[0150]

[0151] The sequence SEQ ID NO:22 (E. coli plasmid replicon, pBR322 ori) is:

[0152] CGGAGTGTATACTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAATACCGCATCAGGCGCTCTTCCGCTTCCTCGC TCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAG

[0153] The sequence SEQ ID NO:23 (Agrobacterium plasmid replicon, pVS1) is as follows:

[0154]

[0155] The sequence SEQ ID NO:24 (pDES-4G sequence) is:

[0156]

[0157] The sequence SEQ ID NO:25 (Agrobacterium plasmid replicon, pVS1) is as follows:

[0158]

[0159] The technical solution of the present invention will be further described below with reference to specific embodiments.

[0160] Example 1: Construction of a Multi-Gene Vector Construction System

[0161] S1. Construction of the introductory carrier pL1-CmRccdB-LacZ-L2:

[0162] (1) Replace the kanamycin resistance gene of pENTR-Gus with the ampicillin resistance gene: amplify the vector sequences at both ends of the pENTR-Gus kanamycin resistance gene using primers P1-P2, amplify the ampicillin resistance gene of the pGEM-T easy vector using primers P3-P4, and connect the two sequences into pENTR-Gus-amp using the ClonExpress Ultra One Step Cloning Kit homologous recombination kit;

[0163] (2) Artificially synthesized toxin protein gene (ccdB) and blue-white screening gene (LacZ) elements: Primers containing restriction sites were designed and the pDEST15 vector was amplified with primers P5-P6 to obtain the MluI-SpeI-SacI-CmRccdB sequence. The pGEM-T easy vector was amplified by primers P7-P8 and P9-P10 in two rounds of PCR to obtain the SfiI-LacZ-SfiI-MluI sequence. Then, the two DNA fragments were fused into the MluI-SpeI-SacI-CmRccdB-NdeI-HindIII-MluI-SfiI-LacZ-SfiI-MluI element by overlapping PCR with primers P11-P12.

[0164] (3) Assembly of pL1-CmRccdB-LacZ-L2: The sequences at both ends of the Gus gene in the pENTR-Gus-amp vector were amplified using primers P13-P14. The resulting sequences were then linked with the MluI-SpeI-SacI-CmRccdB-NdeI-HindIII-MluI-SfiI-LacZ-SfiI-MluI element using the ClonExpress Ultra One Step Cloning Kit homologous recombination kit to form pL1-CmRccdB-LacZ-L2.

[0165] S2. Construction of the introductory carrier pL3-CmRccdB-LacZ-L4:

[0166] ①AttL site mutation: Using two pairs of mutation primers P15-P16 and P17-P18, the ampR-attL1 and CmRccdB-LacZ-attL2 sequences in pL1-CmRccdB-LacZ-L2 were mutated to ampR-attL3 and cmRccdB-LacZ-attL4.

[0167] ② Assembly of pL3-CmRccdB-LacZ-L4: The mutated ampR-attL3 and cmRccdB-LacZ-attL4 were further linked using the ClonExpress Ultra One StepCloning Kit to obtain pL3-CmRccdB-LacZ-L4.

[0168] S3. Construction of the target vector pDESattR1-4:

[0169] (i) Linearization of the pCAMBIA1300 vector: The sequences at both ends of the pCAMBIA1300 vector LacZα were amplified using primers P19-P20 to linearize it;

[0170] (ii) Cloning of the attR1-CmRccdB-attR2 element: The attR1-CmRccdB-attR2 sequence in the pDEST15 vector was amplified using primers P21-P22.

[0171] (iii) Cloning of the attR3-LacZ-SacB-attR4 element: Primers P23-P24 and P25-P26 were designed to mutate attR1 and attR2 into attR3 and attR4, respectively. LacZ and SacB sequences were amplified from pGEMT easy and pCasPA vectors using primers P27-P28 and P29-P30, respectively. Finally, the attR3-LacZ-SacB-attR4 sequence was assembled using the overlapping PCR strategy with primers P23 / P26.

[0172] (iv) Assembly of pDESattR1-4: The linearized pCAMBIA1300 vector, attR1-CmRccdB-attR2, and attR3-LacZ-SacB-attR4 were ligated into pDESattR1-4 using the ClonExpress Ultra One Step Cloning Kit homologous recombination kit.

[0173] The primer sequences involved include:

[0174] The sequence is SEQ ID NO:26(P1):CTGTCAGACCAAGTTTACTCCAGAATTGGTTAATTGGTTGTAACAC

[0175] The sequence is SEQ ID NO:27(P2):GCGCACATTTCCCCGAAAAGTAACACCCCTTGTATTACTGTTTA

[0176] The sequence is SEQ ID NO:28(P3):GAGTAAACTTGGTCTGACAGTTACC

[0177] The sequence is SEQ ID NO:29(P4):CTTTTCGGGGAAATGTGCGCGGAAC

[0178] The sequence is SEQ ID NO:30(P5):GCGTGCCCAAGCTTGGCATATGGTGTCGACCTGCAGACTGGCTGTGTA

[0179] The sequence is SEQ ID NO:31(P6):GCACGCGTCAGCATGCATGCATGCGAGCTCGCCAGACTACATAATACTGTAAAAC

[0180] The sequence is SEQ ID NO:32(P7):AGTGGTCTCTGTCCAGTCCTGGCCTCGTCGGCCATCTGTTACGCCGGCGGTAG

[0181] The sequence is SEQ ID NO:33(P8):ACCATATGCCAAGCTTGGGCACGCGTCAGAGTGGTCTCTGTCCAGTCCTGG

[0182] The sequence is SEQ ID NO:34(P9):ACCATATGCCAAGCTTGGGCACGCGTCAGAGTGGTCTCTGTCCAGTCCTGG

[0183] The sequence is SEQ ID NO:35(P10):

[0184] ACCGCCGGCGTAACAGATGAGTAGTCGACTAAGACGCTCACCCGC

[0185] The sequence is SEQ ID NO:36(P11):

[0186] GTCCTGTAGAAACCCCAACCGCACGCGTCAGCATGCATGCATGCGA

[0187] The sequence is SEQ ID NO:37(P12):

[0188] GCGGTTTTTCACCGAAGTTCGCACGCGTCAGGGTCTCAGCAGACCACAAGTGGCCAG

[0189] The sequence is SEQ ID NO:38(P13):GGTTGGGGTTTCTACAGGAC

[0190] The sequence is SEQ ID NO:39(P14):GAACTTCGGTGAAAAACCGCAGCAGGG

[0191] The sequence is SEQ ID NO:40(P15):CATTTAACTTTAAGAAGGAGATATATACC

[0192] The sequence is SEQ ID NO:41(P16):TTATTGTTTGCCTCCCTGCTGCGGT

[0193] The sequence is SEQ ID NO:42(P17):

[0194] AGCAGGGAGGCAAACAATAAACCCAACTTTTCTATACAAAGTT

[0195] The sequence is SEQ ID NO:43(P18):

[0196] GGTATATATCTCCTTCTTAAAGTTAAATGGCTAACCAACTTTATTATACAAAGTTGGC

[0197] The sequence is SEQ ID NO:44(P19):

[0198] GTCGAGCGCGCTTGGCTATATGGCGGGTAAACCTAAGAGAAAAGAGCG

[0199] The sequence is SEQ ID NO:45(P20):

[0200] TGTATGCTATACGAAGTTATGCGGTTTGCGTATTGGCTAGAGCAGCTT

[0201] The sequence is SEQ ID NO:46(P21):

[0202] ATAACTTCGTATAGCATACATTATACGAAGTTATTTTGGTGGTGGCGACCATCCTCC

[0203] The sequence is SEQ ID NO:47(P22):GGTTATGCTAGTTATTGCTCAGCGG

[0204] The sequence is SEQ ID NO:48(P23):

[0205] GAGCAATAACTAGCATAACCTGCACGGCAACTTTGTATAATAAAGTTGAACGA

[0206] The sequence is SEQ ID NO:49(P24):

[0207] TCAGGTGCAGTTGTCCTCCTTCATAGTGACTGGATATGTTGTGTTTT

[0208] The sequence is SEQ ID NO:50(P25):

[0209] CTAGGCTGTGACTTGTGTACTAGGCTGTGACTTGTGTATTCATAGTGACTGGATATGTT

[0210] The sequence is SEQ ID NO:51(P26):

[0211] TATAGCCAAGCGCGCTCGACCAGCTAACCAACTTTGTA

[0212] The sequence is SEQ ID NO:52(P27):

[0213] GGAGAACTACTGCACCTGAGAGCTCATCGGGTACCATCTGTTACGCCGGCGGTAG

[0214] The sequence is SEQ ID NO:53(P28):

[0215] TCATACTCCCGCCATTCAGAGCTTATCAGCTAAGATTACCCTGTTATCC

[0216] The sequence is SEQ ID NO:54(P29):

[0217] AAGAATCCATGGCGGCCGCTGTGGATCTAGACGGCATCAGAGCAGATTGTA

[0218] The sequence is SEQ ID NO:55(P30):

[0219] TCTGAATGGCGGGAGTATGAAAAGTCTCGAGGCAACTTTATGCCCATGCAACA.

[0220] Example 2: Assembling four target genes using a multi-gene vector construction system.

[0221] The process of constructing an expression vector containing four target genes using this multi-gene vector construction system is as follows: Figure 3 As shown:

[0222] S1. The CmRccdB element in the entry vectors pL1-CmRccdB-LacZ-L2 and pL3-CmRccdB-LacZ-L4 was excised using restriction endonucleases SacI and HindIII, respectively, to obtain linearized pL1----LacZ-L2 and pL3----LacZ-L4 vectors. Overlapping PCR was used to amplify OsC1 and OsRb expression cassettes containing promoters, coding sequences, and terminators, respectively. The OsC1 and OsRb expression cassettes shared 20 bp homologous ends with the linearized entry vectors pL1----LacZ-L2 and pL3----LacZ-L4, respectively. Finally, the OsC1 and OsRb expression cassettes were assembled into the linearized pL1----LacZ-L2 and pL3----LacZ-L4 vectors respectively by Gibson cloning to obtain the intermediate plasmids pL1-C1-LacZ-L2 and pL3-Rb-LacZ-L4.

[0223] S2. The intermediate vectors obtained in S1 were digested with SfiI to remove the LacZ selection gene. The digestion products were subjected to agarose gel electrophoresis and gel recovery to obtain linearized pL1-C1----L2 and pL3-Rb----L4 vectors. OsDRF expression cassettes containing promoters, coding sequences, and terminators were amplified using overlapping PCR. eGFP expression cassettes were amplified from the pBI121-EGFP vector using PCR. The OsDRF and eGFP expression cassettes shared 20 bp homologous ends with the linearized pL1-OsC1----L2 and pL3-OsRb----L4 vectors, respectively. Finally, the OsDRF and eGFP expression cassettes were assembled into the linearized pL1-C1----L2 and pL3-Rb----L4 vectors, respectively, using Gibson cloning to obtain the intermediate plasmids pL1-C1-DRF-L2 and pL3-Rb-eGFP-L4.

[0224] S3. The pL1-C1-DRF-L2, pL3-Rb-eGFP-L4, and pDESattR1-4 plasmids were mixed and subjected to a one-step GatewayLR recombination reaction. The OsC1 and OsDRF expression cassettes assembled on the pL1-C1-DRF-L2 vector and the OsRb and eGFP expression cassettes assembled on the pL3-Rb-eGFP-L4 vector were integrated into the attR1 and attR2 and attR3 and attR4 spaces of the pDESattR1-4 vector, respectively. This resulted in a multi-gene expression vector pDES-4G containing four target genes, with a full-length T-DNA of approximately 11 kb. Figure 4 MluI digestion confirmed that all four target genes were assembled into the pDES-4G expression vector. Figure 5 ).

[0225] Example 3: Assembly of 9 target genes using a multi-gene vector construction system.

[0226] The process of constructing an expression vector containing nine target genes using this multi-gene vector construction system is as follows: Figure 6 As shown:

[0227] S1. The CmRccdB element in the entry vectors pL1-CmRccdB-LacZ-L2 and pL3-CmRccdB-LacZ-L4 was excised using restriction endonucleases SphI and HindIII, respectively, to obtain linearized pL1----LacZ-L2 and pL3----LacZ-L4 vectors. Overlapping PCR amplification yielded OsC1, OsDRF, eGFP, PgDS, and PgPPDS expression cassettes containing promoters, coding sequences, and terminators. The OsC1, OsDRF, and eGFP expression cassettes shared 20 bp homologous ends with the linearized entry vector pL1----LacZ-L2, and the PgDS and PgPPDS expression cassettes shared 20 bp homologous ends with the linearized pL3----LacZ-L4. Further, the OsC1, OsDRF, and eGFP expression cassettes were assembled into the linearized pL1----LacZ-L2 vector using Gibson cloning to obtain the intermediate vector pL1-C1-DRF-GFP-LacZ-L2. The PgDS and PgPPDS expression cassettes were assembled into the linearized pL3----LacZ-L4 vector to obtain the intermediate plasmid pL3-DS-PPDS-LacZ-L4.

[0228] S2. The intermediate vectors obtained in the first round were digested with SfiI to remove the LacZ selection gene. The digestion products were subjected to agarose gel electrophoresis and gel recovery to obtain linearized pL1-C1-DRF-GFP----L2 and pL3-DS-PPDS----L4 vectors. Overlapping PCR was used to amplify PgUGT94Q2, PgUGT74AE2, OsRb, and Gus expression cassettes containing promoters, coding sequences, and terminators. Among them, the PgUGT94Q2 and PgUGT74AE2 expression cassettes have 20 bp homologous ends with the linearized pL1-C1-DRF-GFP----L2, and the OsRb and Gus expression cassettes have 20 bp sticky ends with the linearized pL3-DS-PPDS----L4. Finally, using Gibson cloning, the PgUGT94Q2 and PgUGT74AE2 expression cassettes were assembled into the linearized pL1-C1-DRF-GFP----L2 vector to obtain the introductory vector pL1-C1-DRF-GFP-94-74-L2; and the OsRb and Gus expression cassettes were assembled into the linearized pL3-DS-PPDS----L4 vector to obtain the introductory vector pL3-DS-PPDS-Rb-Gus-L4.

[0229] S3. The plasmids pL1-C1-DRF-GFP-94-74-L2, pL3-DS-PPDS-Rb-Gus-L4, and pDESattR1-4 were mixed and subjected to a one-step Gateway LR recombination reaction. The OsC1, OsDRF, eGFP, PgUGT94Q2, and PgUGT74AE2 expression cassettes assembled on the pL1-C1-DRF-GFP-94-74-L2 vector, and the PgDS, PgPPDS, OsRb, and Gus expression cassettes assembled on the pL3-DS-PPDS-Rb-Gus-L4 vector, were integrated into the attR1 and attR2 and attR3 and attR4 spaces of the pDESattR1-4 vector, respectively. This resulted in a multi-gene expression vector pDES-9G containing nine target genes, with a full-length T-DNA of approximately 24 kb. Figure 7 MluI digestion confirmed that all nine target genes were assembled into the pDES-9G expression vector. Figure 8 ).

[0230] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any changes, modifications, substitutions, combinations, simplifications and improvements made by those skilled in the art within the scope of the technology disclosed in the present invention and within the spirit and principles of the present invention should be regarded as equivalent substitutions and should be covered within the scope of protection of the present invention.

Claims

1. A multi-gene vector assembly system, characterized in that, The multi-gene vector assembly system includes two entry vectors and one target vector. The entry vectors are pL1-CmRccdB-LacZ-L2 and pL3-CmRccdB-LacZ-L4, respectively. Each entry vector has a pair of Gateway recombination sites, and there are two selection markers between the Gateway recombination sites: the toxin protein gene ccdB and the blue-white selection gene LacZ. The selection markers are removed by two rounds of restriction endonuclease digestion or PCR, and multiple target genomes are assembled into the two entry vectors by two rounds of Gibson cloning. The target vector is pDESattR1-4, which has two pairs of gateway recombination sites that can undergo irreversible gateway recombination with the entry vector. There is a negative selection marker between each pair of gateway recombination sites. One pair of recombination sites contains the toxin protein gene ccdB, and the other pair of recombination sites contains the sucrose lethal gene SacB. The target gene on the entry vector is integrated into the target vector through a one-step gateway recombination reaction using an aggregation strategy, resulting in a multi-gene expression vector containing multiple target genes. The sequence of the introductory vector pL1-CmRccdB-LacZ-L2 is SEQ ID NO:1, the sequence of the introductory vector pL3-CmRccdB-LacZ-L4 is SEQ ID NO:2, and the sequence of the target vector pDESattR1-4 is SEQ ID NO:

3.

2. The multi-gene vector assembly system according to claim 1, characterized in that, The entry vector pL1-CmRccdB-LacZ-L2 includes the ampicillin resistance gene AmpR, the pUC replicon, and Gateway recombinase recognition sites attL1 and attL2. The ccdB gene and the attL1 site have linker sequences containing MluI-SphI-SacI and NdeI-HindIII-MluI-SfiI restriction endonuclease recognition sites, respectively, and the LacZ gene and the attL2 site have a linker sequence containing the SfiI-MluI restriction endonuclease recognition site. The entry vector pL3-CmRccdB-LacZ-L4 includes the ampicillin resistance gene AmpR, the pUC replicon, and Gateway recombinase recognition sites attL3 and attL4. The ccdB gene and attL3 site have linker sequences containing MluI-SphI-SacI and NdeI-HindIII-MluI-SfiI restriction endonuclease recognition sites, respectively, and the LacZ gene and attL4 site have a linker sequence containing SfiI-MluI restriction endonuclease recognition site. The target vector pDESattR1-4 includes the kanamycin resistance gene KanR, the hygromycin resistance gene HygR, Gateway recombinase recognition sites attR1 and attR2, Gateway recombinase recognition sites attR3 and attR4, the pBR322 replicon, and the pVS1 replicon. A ccdB negative selection marker is set between attR1 and attR2, and a SacB negative selection marker is set between attR3 and attR4.

3. A method for constructing a multi-gene expression vector using the multi-gene vector assembly system according to any one of claims 1-2, characterized in that: The method for constructing a multi-gene expression vector specifically includes the following steps: S1: The target gene expression cassette containing the promoter, the coding region of the target gene, and the terminator was obtained by overlapping PCR amplification. The target gene and the linearized entry vector have a homologous end of 15-20 bp. One or more genes were then simultaneously assembled into the linearized entry vector by Gibson cloning to obtain two intermediate entry vectors, pL1-N1G-LacZ-L2 and pL3-N2G-LacZ-L4. S2: The two intermediate entry vectors obtained in step S1 were digested with SfiI to remove the LacZ element. The digested vectors were recovered to obtain linearized intermediate entry vectors. The target gene expression cassette containing the promoter, the coding region of the target gene, and the terminator was obtained by overlapping PCR amplification. The target gene and the linearized intermediate entry vectors have homologous ends of 15-20 bp. One or more genes were further assembled into the linearized intermediate entry vectors simultaneously by Gibson cloning to obtain two final entry vectors pL1-N1G-N3G-L2 and pL3-N2G-N4G-L4. S3: The entry vector obtained in step S2 is mixed with the target vector pDESattR1-4. After a Gateway LR recombination reaction, the target genes loaded in the entry vectors pL1-N1G-N3G-L2 and pL3-N2G-N4G-L4 are integrated into the attR1-attR2 and attR3-attR4 sites of the pDESattR1-4 vector, respectively, to finally obtain the expression vector pDES-NG containing multiple target genes.

4. The method for constructing a multi-gene expression vector according to claim 3, characterized in that: Before obtaining the target gene expression cassette containing the promoter, target gene coding region, and terminator through overlapping PCR amplification in step S1, the following steps are required: double digestion of the entry vectors pL1-CmRccdB-LacZ-L2 and pL3-CmRccdB-LacZ-L4 with either SphI or SacI and either NdeI or HindIII to remove the CmRccdB element. The digested vectors are then recovered and purified to obtain linearized entry vectors.

Images