Applications of tspan32 and car-t cells expressing fusion proteins and methods of making and using the same

Abstract

The application relates to the technical field of CAR-T cell immunotherapy, and particularly relates to the application of TSPAN32, a CAR-T cell expressing a fusion protein and a preparation method and application thereof. + It is found through research on Tspan32 transgenic mice that, in the case of overexpression of the Tspan32 gene, the IL2RA proportion in CD4 + T cells is greatly improved, which indicates that the Tspan32 gene can positively regulate the expression of IL2RA. The T cells expressing the TSPAN32-CAR fusion protein are prepared by using the above rule, the addition of the TSPAN32 protein improves the activation and proliferation capacity, survival capacity, cytokine release capacity and anti-tumor function of the cells, and improves the stability of the CAR on the cells. The scheme creates conditions for enhancing the treatment effect of autologous CAR-T cells on tumor patients in the clinic, and has an ideal application and promotion prospect.

Description

Technical Field

[0001] This invention relates to the field of CAR-T cell immunotherapy technology, specifically to the application of TSPAN32 and CAR-T cells expressing fusion proteins, their preparation methods, and applications. Background Technology

[0002] Chimeric antigen receptor-modified T cells (CAR-T) are T cells that express a receptor structure on the surface of T cell membranes using genetic engineering techniques. This allows T cells to directly recognize, activate, and kill tumor cells through antigen-antibody binding. In recent years, CAR-T cell therapy has shown promising application prospects in the research and clinical treatment of hematological malignancies and solid tumors, especially with the well-established preparation methods and processes for CD19-targeted CAR-T cell products. However, since current clinical CAR-T cell therapy primarily utilizes the patient's own T cells for modification, the tumor-killing ability of CAR-T cells mainly depends on the function and activation level of the patient's own T cells. Furthermore, most cancer patients, due to long-term tumor burden or prior radiotherapy and chemotherapy, may experience immune tolerance or functional suppression of their T cells. In preliminary experimental studies, the inventors also found that when testing the tumor-killing ability of allogeneic CAR-T cells prepared from T cells derived from healthy individuals and cancer patients, the function of CAR-T cells from cancer patients was weaker than that from healthy individuals. This suggests that the clinical efficacy of CAR-T cell therapy using autologous T cells from cancer patients may be poor. Therefore, an increasing number of domestic and international studies are focusing on the functional regulation of CAR-T cells, mainly including regulating CAR-T cell activation, proliferation, survival, and cytokine release. The aim is to ensure that CAR-T cells exert a longer-lasting and stable anti-tumor effect in clinical treatment. How to effectively enhance CAR-T cell activity remains a key technical problem that urgently needs to be solved in this field. Summary of the Invention

[0003] The present invention aims to provide the application of TSPAN32 in the preparation of chimeric antigen receptor T cells to solve the technical problems of unsatisfactory CAR-T cell activity and therapeutic effects in the prior art.

[0004] To achieve the above objectives, the present invention adopts the following technical solution:

[0005] Application of TSPAN32 protein and / or Tspan32 gene in the preparation of chimeric antigen receptor T cells.

[0006] This protocol also provides the application of TSPAN32 protein and / or Tspan32 gene in the preparation of interleukin-2 receptor expression regulation reagents.

[0007] This protocol also provides the application of TSPAN32 protein and / or Tspan32 gene in screening interleukin-2 receptor-based T-cell immunomodulatory drugs for anti-tumor purposes.

[0008] This protocol also provides a chimeric antigen receptor T cell, including T cells expressing the CAR-TSPAN32 fusion protein with the gene sequence shown in SEQ ID NO.10.

[0009] This protocol also provides a method for preparing chimeric antigen receptor T cells, comprising the following sequential steps:

[0010] S1 Construction of expression plasmid: The gene of CAR-TSPAN32 fusion protein was integrated into an empty vector to obtain the expression plasmid;

[0011] S2 virus packaging: Expression plasmid and packaging plasmid were added to 293T cells, and after culturing, the supernatant was collected, and impurities were removed to obtain the virus solution.

[0012] S3 cell infection: T cells were cultured using T lymphocyte stimulation medium and then infected with viral fluid to obtain CAR-TSPAN32 T cells.

[0013] This technical solution also provides the application of chimeric antigen receptor T cells in the preparation of antitumor immunotherapies.

[0014] The principle and beneficial effects of this technical solution are as follows:

[0015] Through research on Tspan32 transgenic mice, the inventors discovered that under the condition of Tspan32 gene overexpression, CD4 + and CD8 +The significantly increased proportion of IL2RA (i.e., CD25) in T cells suggests that the Tspan32 gene can positively regulate IL2RA expression. Therefore, TSPAN32 protein and / or the Tspan32 gene can serve as regulatory agents (e.g., expression promoters) for IL2RA expression in T-cell immunomodulatory therapy based on the interleukin-2 receptor. By increasing IL2RA expression, they can enhance cellular sensitivity to interleukin-2, thereby improving therapeutic efficacy. Furthermore, TSPAN32 protein and / or the Tspan32 gene can also be used in scientific research as a tool to study the mechanism of action of IL2RA and IL2RA-related immune responses. For example, knocking out or overexpressing the Tspan32 gene can be used to observe the expression of IL2RA and changes in IL2RA-based signaling pathways. ShRNA can be used to inhibit Tspan32 gene expression for a certain period, and then the expression of IL2RA and changes in IL2RA-based signaling pathways can be observed during the downregulation and restoration of Tspan32 gene transcription. Furthermore, using TSPAN32 protein inhibitors (or agonists) to inhibit (or activate) protein activity can be observed, and the expression of IL2RA and changes in IL2RA-based signaling pathways can be observed under conditions of inhibition or activation, during the process of reversal of inhibition or activation, and after reversal. Through these research methods, the mechanism of action of IL2RA and the immune regulation based on IL2RA can be further elucidated, creating a theoretical foundation for new drug development. Therefore, applying TSPAN32 protein and / or the Tspan32 gene to prepare tool reagents for regulating interleukin-2 receptors has certain practical application value.

[0016] Because of the correlation between TSPAN32 protein and / or Tspan32 gene expression and IL2RA expression, TSPAN32 protein and / or Tspan32 gene can serve as potential drug targets to regulate IL2RA-based immune activation. Alternatively, TSPAN32 protein and / or Tspan32 gene can be used as targets to screen for IL2RA expression promoters or inhibitors. For example, screening for activators targeting TSPAN32 protein and / or Tspan32 gene could yield novel drugs that act as IL2RA expression promoters on T cells, thereby increasing T cell sensitivity to IL2 and potentially leading to T cell immunomodulatory drugs based on the interleukin-2 receptor for anti-tumor applications.

[0017] Based on the discovery of the interaction between TSPAN32 protein and / or Tspan32 gene and IL2RA, in addition to the aforementioned applications, the inventors further applied TSPAN32 protein and / or Tspan32 gene to chimeric antigen receptor T cells. By constructing T cells expressing the CAR-TSPAN32 fusion protein gene sequence as shown in SEQ ID NO.10, CAR-T cell activity was effectively enhanced, promoting CAR-T cell activation and proliferation, improving CAR-T cell survival and cytokine release capacity, and further ensuring that CAR-T cells exert a longer-lasting and stable anti-tumor effect in clinical treatment. Insufficient T cell function in cancer patients is one of the main reasons for the unsatisfactory clinical efficacy of autologous CAR-T cell therapy, and solid tumors further inhibit the anti-tumor function of CAR-T cells due to the tumor microenvironment. This invention, by expressing the CAR-TSPAN32 fusion protein on T cells, promotes the activation of internal T cell signals and enhances the anti-tumor activity of CAR-T cells, creating conditions for enhancing the clinical efficacy of autologous CAR-T cell therapy for cancer patients.

[0018] Current technology reports indicate that in Tspan32 gene knockout mice, the proportion of T cells in vivo is not significantly altered, and CD4 counts are low. + The expression level of interleukin-2 (IL2) on T cells is upregulated, and the Tspan32 gene negatively regulates T cell activation. However, in this technical solution, a phenomenon not reported in existing technologies was discovered: overexpression of the Tspan32 gene can promote CD4+ expression. + and CD8 + The expression of interleukin-2 receptors on T cells increases the T cell response to the T cell growth factor interleukin-2. Applying the Tspan32 gene to the construction of CAR-T cells enhanced the tumor-killing ability of CAR-T cells and increased the expression and secretion levels of interleukin-2 (IL2), achieving unexpected technical effects. Furthermore, expressing the CAR-TSPAN32 fusion protein on T cells, a four-transmembrane protein, can stabilize CAR expression on the T cell membrane and enhance the anti-tumor function of CAR-T cells.

[0019] Furthermore, the gene sequence of the TSPAN32 protein is shown in SEQ ID NO.1.

[0020] Furthermore, the TSPAN32 protein and the CAR protein form a CAR-TSPAN32 fusion protein; the gene sequence of the CAR-TSPAN32 fusion protein is shown in SEQ ID NO.10.

[0021] Furthermore, the chimeric antigen receptor T cells express the CAR-TSPAN32 fusion protein.

[0022] Furthermore, in S3, the components of the T lymphocyte stimulation solution include lymphocyte culture medium, FBS, penicillin-streptomycin antibiotics, human IL2, human Anti-CD3, and human Anti-CD28.

[0023] Furthermore, in S1, the empty vector is pLVX-IRES-mCherry; in S2, the packaging plasmids include psPAX2 and pMD2G.

[0024] In summary, this technical solution, based on the existing CAR structure, increases the expression level of TSPAN32 protein, promotes intracellular signal transduction and activation of T cells, significantly improves the killing effect of CAR-T cells on tumor cells, and enhances the efficacy of CAR-T cell therapy. The main benefits of this technical solution are as follows: Firstly, it discovers the correlation between TSPAN32 protein and / or Tspan32 gene expression and IL2RA expression. TSPAN32 protein and / or Tspan32 gene can be used as interleukin-2 receptor expression promoters in cancer treatment or scientific research, and it creates conditions for screening novel IL2RA-based immunomodulatory drugs, further elucidating the mechanism of action of IL2RA. TSPAN32 is a four-transmembrane protein. After forming a fusion protein with CAR, it can improve the stability of CAR on the T cell membrane, making it less susceptible to endocytosis and degradation, enhancing the antigen recognition ability of CAR-T cells and the transduction of intracellular activation signals, thereby enhancing the tumor-killing effect of CAR-T cells. Clinically, because cancer patients are under long-term tumor burden or have received radiotherapy and chemotherapy, most of their T cells are in a state of immune tolerance or functional suppression. By expressing the CAR-TSPAN32 fusion protein, not only can T cells be made tumor-targeting, but also T cell activation can be regulated by increasing the expression level of TSPAN32 protein, enhancing the anti-tumor function of T cells. The combined use of CAR and TSPAN32 produces a synergistic effect. Attached Figure Description

[0025] Figure 1 This is a schematic diagram of the structure of the CAR-TSPAN32 T cells constructed in Example 1.

[0026] Figure 2 This is a fluorescence microscope image of T cells infected with the virus 72 hours after Example 1.

[0027] Figure 3 The following is a statistical graph showing the results of the in vitro T cell killing experiment in Example 2 (data are from 3 independent samples, mean ± SD, p-value calculated by two-way ANOVA). ***P < 0.001, **** P < 0.0001.

[0028] Figure 4 The statistical graph shows the results of the cytokine secretion detection experiment in Example 3 (data are the mean ± SD of 3 independent samples, P value was calculated by unpaired t-test analysis, ns, P > 0.05). *** P < 0.001, **** P < 0.0001.

[0029] Figure 5 The image shows the results of the in vivo T cell killing experiment in Experiment Example 4.

[0030] Figure 6 The statistical graph shows the results of the interleukin-2 receptor (IL2RA) expression detection experiment in Experiment Example 5 (data are the mean ± SD of 5 independent samples, and the p-value was calculated by unpaired t-test analysis). * P < 0.05 *** P < 0.001).

[0031] Figure 7 The image shows the WB results of the downstream signaling pathway detection of IL2 / IL2RA in Experiment Example 5. Detailed Implementation

[0032] The present invention will be further described in detail below with reference to embodiments, but the implementation of the present invention is not limited thereto. Unless otherwise specified, the technical means used in the following embodiments and experimental examples are conventional means well known to those skilled in the art, and the materials and reagents used can all be obtained commercially.

[0033] Example 1:

[0034] The specific process for preparing a T cell expressing the CAR-TSPAN32 fusion protein is as follows:

[0035] (1) Constructing expression plasmids

[0036] The original lentiviral expression vector (empty vector) used was pLVX-IRES-mCherry (Baori Biotechnology Co., Ltd., product number: 631237). The gene sequence of the fusion protein CAR-TSPAN32 was synthesized by a commissioned team. This sequence was inserted into the expression vector using the EcoR1 and BamH1 restriction enzyme sites to obtain the pLVX-CAR-TSPAN32-IRES-mCherry expression vector. Enzyme digestion at the EcoR1 and BamH1 sites was used to confirm the ligation of the CAR-TSPAN32 sequence. A band of approximately 2400 bp was obtained, indicating that the pLVX-CAR-TSPAN32-IRES-mCherry plasmid had been successfully constructed.

[0037] The gene sequence of the TSPAN32 protein (SEQ ID NO.1, 5'→3'):

[0038] GGGCCTTGGAGTCGAGTCAGGGTTGCCAAATGCCAGATGCTGGTCACCTGCTTCTTTATCTTGCTGCTGGGCCTCTCTGTGGCCACCATGGTGACTCTTACCTACTTCGGGGCCCACTTTGCTGTCATCCGCCGAGCGTCCCTGGAGAAGAACCCGTACCAGGCTGTGCACCAATGGGCCTTCTCTGCGGGGTTGAGCCTGGTGGGCCTCCTGACTCTGGGAGCCGTGCTGAGCGCTGCAGCCACCGTGAGGGAGGCCCAGGGCCTCATGGCAGGGGGCTTCCTGTGCTTCTCCCTGGCGTTCTGCGCACAGGTGCAGGTGGTGTTCTGGAGACTCCACAGCCCCACCCAGGTGGAGGACGCCATGCTGGACACCTACGACCTGGTATATGAGCAGGCGATGAAAGGTACGTCCCACGTCCGGCGGCAGGAGCTGGCGGCCATCCAGGACGTGTTTCTGTGCTGTGGGAAGAAGTCTCCTTTCAGCCGTCTGGGGAGCACAGAGGCTGACCTGTGTCAGGGAGAGGAGGCGGCGAGAGAGGACTGCCTTCAGGGCATCCGGAGCTTCCTGAGGACACACCAGCAGGTCGCCTCCAGCCTGACCAGCATCGGCCTGGCCCTCACGGTGTCCGCCTTGCTCTTCAGCTCCTTCCTGTGGTTTGCCATCCGCTGTGGCTGCAGCTTGGACCGCAAGGGCAAATACACCCTGACCCCACGAGCATGTGGCCGCCAGCCCCAGGAGCCCAGCCTCTTGAGATGCTCCCAGGGTGGACCCACACATTGTCTCCACTCCGAAGCAGTTGCTATTGGTCCAAGAGGATGCTCGGGTAGTCTTCGGTGGCTGCAGGAGAGCGATGCTGCGCCTCTGCCCCTCTCCTGCCACCTGGCTGCCCACAGAGCTCTCCAGGGCAGAAGTCGCGGTGGGCTCAGTGGGTGCCCTGAGCGGGGTCTCTCAGACTGA。

[0039] The chimeric antigen receptor (CAR) is constructed based on the FMC63 antibody sequence. It is a conventional chimeric antigen receptor in existing technology, comprising the following parts in order from extracellular to intracellular: signal peptide, light chain variable region (mIglv), hinge region, heavy chain variable region (mIghv), CD28 extracellular region (CD28 Extra), CD28 transmembrane region (CD28 TM), CD28 intracellular region (CD28 cyto), and CD3zeta intracellular region (CD3zeta cyto, CD3ζ). The specific sequence details are as follows:

[0040] The gene sequence of the signal peptide (SEQ ID NO.2, 5'→3'):

[0041] ATGCTTCTCCTGGTGACAAGCCTTCTGCTCTGTGAGTTACCACACCCAGCATTCCTCCTGATCCCA;

[0042] Gene sequence of the light chain variable region (mIglv) (SEQ ID NO.3, 5'→3'):

[0043] GACATCCAGATGACAGACTACATCCTCCCTGTCTGCCTCTCTGGGAGACAGAGTCACCATCAGTTGCAGGGCAAGTCAGGACATTAGTAAATATTTAAATTGGTATCAGCAGAAACCAGATGGAACTGTTAAACTCCTGATCTACCATACATCAAGATT ACACTCAGGAGTCCCATCAAGGTTCAGTGGCAGTGGGTCTGGAACAGATTATTCTCTCACCATTAGCAACCTGGAGCAAGAAGATATTGCCACTTACTTTTGCCAACAGGGTAATACGCTTCCGTACACGTTCGGAGGGGGGACTAAGTTGGAAATAACA;

[0044] Gene sequence of the hinge chain (SEQ ID NO.4, 5'→3'):

[0045] GGCTCCACCTCTGGATCCGGCAAGCCCGGATCTGGCGAGGGATCCACCAAGGGC;

[0046] Gene sequence of the heavy chain variable region (mIghv) (SEQ ID NO.5, 5'→3'):

[0047] GAGGTGAAACTGCAGGAGTCAGGACCTGGCCTGGTGGCGCCCTCACAGAGCCTGTCCGTCACATGCACTGTCTCAGGGGTCTCATTACCCGACTATGGTGTAAGCTGGATTCGCCAGCCTCCACGAAAGGGTCTGGAGTGGCTGGGAGTAATATGGGGTAGTGAAACCACATACTATAAT TCAGCTCTCAAATCCAGACTGACCATCATCAAGGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCATTTACTACTGTGCCAAACATTATTACTACGGTGGTAGCTATGCTATGGACTACTGGGGTCAAGGAACCTCAGTCACCGTCTCCTCA;

[0048] The gene sequence of the CD28 extracellular region (CD28 Extra) (SEQ ID NO.6, 5'→3'):

[0049] ATTGAAGTTATGTATCCTCCTCCTTACCTAGACAATGAGAAGAGCAATGGAACCATTATCCATGTGAAAGGGAAA CACCTTTGTCCAAGTCCCCTATTTCCCGGACCTTCTAAGCCC;

[0050] The gene sequence of the CD28 transmembrane region (CD28TM) (SEQ ID NO.7, 5'→3'):

[0051] TTTTGGGTGCTGGTGGTGGTTGGGGGAGTCCTGGCTTGCTATAGCTTGCTAGTAACAGTGGCCTTTATTATTTTC TGGGTG;

[0052] The gene sequence of the CD28 intracellular region (CD28 cyto) (SEQ ID NO.8, 5'→3'):

[0053] AGGAGTAAGAGGAGCAGGCTCCTGCACAGTGACTACATGAACATGACTCCCCGCCGCCCCGGGCCCACCCGCAAG CATTACCAGCCCTATGCCCCACCACGCGACTTCGCAGCCTATCGCTCC;

[0054] Gene sequence of the CD3zeta intracellular domain (CD3zeta cyto, CD3ζ) (SEQ ID NO.9, 5'→3'):

[0055] AGAGTGAAGTTCAGCAGGAGCGCAGACGCCCCCGCGTACCAGCAGGGCCAGAACCAGCTCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGTACGATGTTTTGGACAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGAGAAGGAAGAACCCTCAGGAAGGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGGAGGCCTACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCACGATGGCCTTTACCAGGGTCTCAGTACAGCCACCAAGGACACCTACGACGCCCTTCACATGCAGGCCCTGCCCCCTCGC.

[0056] Gene sequence of the fusion protein CAR-TSPAN32 (SEQ ID NO.10, 5'→3'):

[0057]

[0058] The linker sequence connecting CAR and TSPAN32 (SEQ ID NO.11, 5'→3'):

[0059] GGTGGCGGAGGCAGCGGTGGCGGAGGCAGCGGTGGCGGAGGCAGC.

[0060] (2) Virus packaging

[0061] The virus packaging employs conventional methods based on existing technology, as follows:

[0062] 293T cell culture: The culture medium is DMEM with 10% FBS. When the cells reach 80-90% confluence, they need to be passaged to increase the cell number and maintain good cell growth. Culture in a cell culture incubator at 37℃, 5% CO2, and 90% relative humidity.

[0063] Plate formation: The night before virus encapsulation, plate 293T cells in a 10cm dish to achieve a cell density of 80-90% for virus encapsulation. One hour before virus encapsulation, replace the cell culture medium with DMEM (1:4000 with chloroquine) and place the dish in a cell incubator.

[0064] Plasmid addition: Prepare a mixture of viral plasmids and packaging plasmids (psPAX2 and pMD2G), the composition and ratio of which are shown in Table 1. Mix the mixture in Table 1 with 500 μL of 2×HBS and add it dropwise to a culture dish of 293T cells.

[0065] Table 1: Mixture of Viral Plasmids and Packaging Plasmids

[0066] psPAX2 6.7μg pMD2G 4.4μg pLVX-CAR-TSPAN32-IRES-mCherry 8.9μg <![CDATA[CaCl2(2M)]]> 62.5μL <![CDATA[H2O]]> Add water to bring the volume up to 500μL

[0067] Medium change: Replace with normal culture medium after 12 hours, and continue changing the medium after 24 hours.

[0068] Virus collection: Viral supernatant was collected three times at 36h, 48h and 60h, and mixed well.

[0069] Filtration: Filter the supernatant using a 0.45 μm filter membrane to remove cellular impurities, etc.

[0070] Virus cryopreservation: Freeze the aliquoted virus solution in a freezer at -80°C.

[0071] (3) Isolation and culture of primary human T cells

[0072] This technical solution uses T cells to prepare CAR-T cells, which can be collected from peripheral blood. In this embodiment, T cells isolated from peripheral blood are used for illustration. This technical solution does not involve blood collection; it only uses T cells isolated from peripheral blood to prepare cell preparations and does not involve any surgical procedures.

[0073] Peripheral blood T cell isolation: The obtained peripheral blood was diluted 1:1 with PBS. An equal volume of lymphocyte separation medium was added to a 15ml centrifuge tube, making the ratio of separation medium:blood:PBS 1:1:1. The diluted blood was carefully added to the top layer of the separation medium. Centrifuged at 800g for 20 minutes at room temperature, with both the ramp and deceleration speeds reduced to level 2. After centrifugation, the PBMC (human peripheral blood mononuclear cell) cell layer was carefully aspirated and transferred to a new 15ml centrifuge tube. 3-5 times the volume of PBS was added for dilution, and the cells were centrifuged at 1500rpm for 5 minutes. The cells were then washed once with PBS, incubated with anti-CD3 magnetic beads for 20 minutes, and CD3 cells were separated using a magnetic separation column. + T cells were counted, and the cells were washed 1-2 times with PBS. CD3+ was also counted. + T lymphocytes represent all T lymphocytes, including helper / inducer T lymphocytes (CD3+). + CD4 + ), inhibitory / cytotoxic T lymphocytes (CD3) + CD8 + All types of T lymphocytes, including )

[0074] T cell in vitro stimulation culture: Prepare T lymphocyte stimulation medium; the components and ratios are shown in Table 2. Resuspend cells in the prepared stimulation medium and culture in 12-well plates, 2 mL / well. Observe cell density under a microscope. Change the stimulation medium daily for three consecutive days. On the fourth day, replace the medium with IL-2-only medium.

[0075] Table 2: T lymphocyte stimulation solution

[0076]

[0077]

[0078] (4) T-cell viral infection

[0079] The stimulated T cells were seeded in six-well plates at a density of 2 × 10⁶ cells / well. 6Prepare viral infection solution using reagents listed in Table 3. Centrifuge the 6-well plates (1000g, 37℃, 90min), then incubate for 8-10 hours before replacing with normal culture medium (containing IL-2). Perform fluorescence detection on the cells 72 hours after infection to determine successful transfection. This completes the construction of CAR-TSPAN32 T cells. See the schematic diagram below. Figure 1 72 hours after T cell infection, the fluorescence ratio was observed under a fluorescence microscope, and photographs were taken. Figure 2 The cell infection rate is about 70%.

[0080] Table 3: Composition of Virus Infection Fluid

[0081] Virus liquid 2mL Cell fluid 2mL Polybrene (1 mg / ml) 8μL HEPES (1M; Gibco) 40μL

[0082] Example 2: In vitro T cell killing experiment

[0083] The Raji-luc B lymphoma cell line (expressing luciferase) was divided into 2×10 4 T cells were seeded in black 96-well plates. NCT cells (wild-type T cells without any plasmids), CAR T cells (T cells transfected with a plasmid containing the CAR gene; other preparation methods are described in Example 1), and CAR-TSPAN32 T cells (preparation method described in Example 1) were added to Raji-luc cells at effector-to-target ratios (E:T) of 1:2, 1:4, and 1:16, respectively. 10 μL of fluorescein substrate (1 mg / mL) was added to each well and mixed thoroughly. The fluorescence signal of Raji-luc tumor cells was detected at 0 h, 8 h, 24 h, 36 h, and 48 h. The tumor cell mortality rate was calculated, representing the killing ability of each T cell group. The results showed that the tumor-killing effect of the CAR-TSPAN32 T cell group was significantly better than that of the CAR T cell group alone. (Experimental results are described in Example 1.) Figure 3 .

[0084] Example 3: Cytokine secretion detection

[0085] NC T, CAR T, and CAR-TSPAN32 T cells were seeded with Raji-luc tumor cells at a 1:1 ratio in 96-well plates. After 8 hours of co-culture, the cell supernatant was collected, centrifuged at 10000g for 10 minutes to remove cell debris, and the resulting supernatant was diluted 10-fold. Cytokine secretion in each group was detected by ELISA. The results showed that the cytokine secretion level in the CAR-TSPAN32T group was higher than that in the CAR T group, especially in the secretion levels of cytotoxic factors such as granzyme and perforin, indicating that CAR-TSPAN32 T cells had a stronger tumor-killing function. (See attached results). Figure 4 .

[0086] Existing technical literature indicates (Tarrant, JM, The absence of Tssc6, a member of the tetraspanin superfamily, does not affect lymphoid development but enhances in vitro T cell proliferative responses. Mol. Cell. Biol. 2002, 22, 5006–5018.; Salvo Danilo Lombardo, Modulation of Tetraspanin 32 (TSPAN32) Expression in T Cell-Mediated Immune Responses and in Multiple Sclerosis, Int J Mol Sci. 2019 Sep 4; 20(18):4323.): CD4 from Tspan32 knockout mice + The expression level of interleukin-2 (IL2) on T cells was upregulated. While the proportion of T cells in Tspan32 knockout mice did not increase, increased IL2 secretion and accelerated proliferation were observed in in vitro culture experiments of Tspan32 knockout T cells. This literature did not delve into the relationship between the Tspan32 gene and T cell activity or its anti-tumor ability, but it suggests a negative regulatory effect of the Tspan32 gene or TSPAN32 protein on the proliferation of peripheral T lymphocytes. In this technical solution, the inventors prepared a CAR-TSPAN32 fusion protein and constructed CAR-TSPAN32 T cells. Co-culturing these T cells with tumor cells significantly increased the expression and secretion of IL2. Figure 4 (Leftmost) CAR-TSPAN32 T cells show significantly higher IL-2 expression and secretion levels than CAR T cells. In contrast to the aforementioned literature, this method combines CAR and TSPAN32 to construct CAR-T cells. Overexpression of the TSPAN32 protein actually enhances the expression of IL-2, a "T cell growth factor," positively regulating T cell proliferation and further improving the ability of T cells to kill tumor cells. Therefore, compared to existing technologies, the combined use of the Tspan32 gene and TSPAN32 protein in this new application environment exhibits a synergistic effect, achieving unexpected technical results.

[0087] Example 4: In vivo T cell killing experiment

[0088] NSG mice (immunodeficient mice) were subcutaneously inoculated with A375-CD19-luc melanoma cells (expressing CD19 protein and luciferase) in the upper right back, 2 × 10⁶ cells per mouse. 6 On day 7 after inoculation, mice were intraperitoneally injected with 100 μL of fluorescein substrate (15 mg / ml). Tumor size was assessed using an in vivo imaging system. Mice with uniformly sized tumors were selected and divided into three groups: NCT, CAR-T, and CAR-TSPAN32T, with five mice in each group. On day 8, each group of mice received NCT, CAR-T, and CAR-TSPAN32T intravenously, with a cell count of 2 × 10⁶ cells in each group. 6 Individuals / animals; tumor cell growth and size were assessed by in vivo imaging on days 14 and 24 after inoculation. The tumor size in the NCT group was close to 2000 mm. 3 Therefore, the experiment was terminated on day 24. The results showed that, in vivo in mice, the CAR-TSPAN32 T group exhibited significantly better tumor-killing effects than traditional CAR T cells, and maintained good therapeutic efficacy in solid tumors. See the experimental results below. Figure 5 .

[0089] Example 5: Study on the mechanism of action of TSPAN32

[0090] (1) Detection of interleukin-2 receptor (IL2RA) expression

[0091] Five C57BL / 6 wild-type mice and five Tspan32 transgenic mice (i.e., mice overexpressing this gene, a mature technology in this field) were used in each group. Spleen cells were harvested from each mouse, ground into single-cell suspensions, centrifuged, incubated on ice for 5 min with lysin, washed twice with PBS, and then incubated with anti-mouse CD3 magnetic beads at 4°C in the dark for 20 min. The cells were washed twice with wash buffer and resuspended, then added to a separation column in a magnetic rack to elute unbound cells. After washing 2-3 times with wash buffer, the separation column was removed from the magnetic rack, and the cells were flushed into 15 ml centrifuge tubes using a stopcock. After centrifugation, the cells were resuspended in RPMI 1640 medium, and anti-mouse CD3 / CD28 and mIL2 were added. The cells were then cultured in 24-well plates for 24 h. Flow cytometry was used to detect CD4+ in both groups. + and CD8 + The proportion of IL2RA (i.e., CD25) in cells was analyzed. It was found that the IL2RA expression level in T cells of Tspan32 transgenic mice was significantly higher than that in the C57BL / 6 wild-type mouse group, indicating that overexpression of Tspan32 can upregulate the expression level of IL2RA in T cells. (See attached experimental results). Figure 6 .

[0092] IL2RA (interleukin 2 receptor, alpha chain) is a 55 kDa glycoprotein, also known as CD25, Ly-43, p55, or Tac. IL2RA is primarily expressed on the surface of activated T cells, B cells, thymocyte subsets, pre-B cells, and regulatory T cells. The homodimeric alpha chain produces a low-affinity receptor, which binds to CD122 (IL-2Rβ) and CD132 (the common γ chain) to form a high-affinity IL-2 receptor for signal transduction. Increasing IL2RA expression can be used in IL2 immunotherapy to treat tumors and autoimmune diseases. In T cells, the addition of interleukin-2 (IL2, a ligand of IL2RA) promotes long-term proliferation, acting as a T cell growth factor. However, if T cells do not express IL2 receptors (e.g., IL2RA), the cells will not respond to IL2 stimulation and are considered quiescent T cells. Only when T cells are activated and express the IL2 receptor can they respond to the effects of IL2, and IL2 can inducing target cells to increase receptor expression. In vivo, IL2 affects CD4+. + T cells function through an autocrine pathway, involving activated CD4+. + T cells can produce large amounts of IL2; while CD8 + T cells maintain cell growth through paracrine pathways. The expression window of the IL2 receptor on T cells is limited; generally, IL2 receptor expression begins after T cell activation and disappears after a certain period. With the disappearance of the receptor, T cells lose their ability to respond to IL2. Increasing the expression level and duration of the IL2 receptor can enhance the T cell's responsiveness to IL2 and improve T cell activity. The upregulation of the Tspan32 gene or TSPAN32 protein in this technical solution can promote the expression of interleukin-2 receptor (IL2RA), creating a material basis for using IL2 to enhance T cell activity. Based on this discovery, the inventors attempted to construct a fusion protein using TSPAN32 protein and CAR protein to enhance IL2RA expression on T cells, increase CAR-T cell activity, and enhance therapeutic effects.

[0093] Existing technical literature indicates (Tarrant, JM, The absence of Tssc6, a member of the tetraspanin superfamily, does not affect lymphoid development but enhances in vitro T cell proliferative responses. Mol. Cell. Biol. 2002, 22, 5006–5018.): In Tspan32 knockout mice, CD4 + The expression level of interleukin-2 (IL2, a ligand of IL2RA) on T cells showed an upward trend, indicating that the presence of the Tspan32 gene inhibits IL2 expression; furthermore, the Tspan32 gene has a negative regulatory effect on T cell activation. Since IL2 and its receptor expression show a certain positive correlation, based on current technology, we could hypothesize that the deletion of the Tspan32 gene would lead to the upregulation of IL2 receptor expression, and conversely, that the overexpression of the Tspan32 gene would lead to the downregulation of IL2 receptor expression. This is clearly contrary to the results of our study. This demonstrates that the phenomena observed in our study cannot be predicted based on current technology; the upregulation of the Tspan32 gene or TSPAN32 protein promotes the upregulation of interleukin-2 receptor (IL2RA) expression, resulting in a higher proportion of CD4+. + and CD8 + The cells exhibited IL2RA expression, which was unpredictable before the inventors conducted this research. Specifically, the expression of the Tspan32 gene or TSPAN32 protein is positively correlated with IL2RA. The inventors then applied the Tspan32 gene and TSPAN32 protein to the preparation of CAR-T cells, enhancing the efficacy of immunotherapy and achieving unexpected technological results, overcoming existing technological biases.

[0094] In addition, according to the results of this study, the Tspan32 gene and / or TSPAN32 protein can also act as promoters of IL2RA expression. Directly applying TSPAN32 protein to T cells, or constructing transgenic T cells with the Tspan32 gene, can increase IL2RA expression in T cells, thereby enhancing the cell's IL2 response. The Tspan32 gene and / or TSPAN32 protein can also serve as drug targets for research and screening of drugs that promote IL2RA expression, leading to the development of novel drugs to enhance T cell activity. Due to the aforementioned regulatory relationship between the Tspan32 gene and / or TSPAN32 protein and IL2RA, the Tspan32 gene and / or TSPAN32 protein can also be used as research reagents in research on IL2RA-related immune responses.

[0095] (2) Detection of downstream signaling pathways of IL2 / IL2RA

[0096] Wild-type T cells and Tspan32-overexpressing T cells were cultured in vitro for about 3 days, and 1×10⁻⁶ cells were collected from each group. 6 Cells were washed twice with PBS, resuspended in 1 ml of culture medium (without mIL2), starved for 8 h, stimulated with 50 ng / ml mIL2 for 5 min, and then collected for protein extraction and quantification. Western blot analysis was used to detect activation markers of downstream IL2 / IL2RA signaling pathways, such as p-STAT1, p-STAT3, p-STAT5, p-ERK, and p-AKT1. The results showed that under the same mIL2 stimulation time, T cells overexpressing Tspan32 showed more significant activation of the downstream IL2 / IL2RA signaling pathway, indicating that Tspan32 promotes downstream IL2 / IL2RA signal transduction and enhances T cell activation by upregulating IL2RA expression levels on the T cell surface. See detailed Western blot images. Figure 7 .

[0097] The above descriptions are merely embodiments of the present invention, and common knowledge such as specific technical solutions and / or characteristics are not described in detail here. It should be noted that those skilled in the art can make various modifications and improvements without departing from the technical solutions of the present invention, and these should also be considered within the scope of protection of the present invention. These modifications and improvements will not affect the effectiveness of the implementation of the present invention or the practicality of the patent. The scope of protection claimed in this application should be determined by the content of its claims, and the specific embodiments described in the specification can be used to interpret the content of the claims.

Claims

1. Encoding the TSPAN32 protein Tspan32 The application of the gene in the preparation of chimeric antigen receptor T cells is characterized by: The TSPAN32 protein and the CAR protein form a CAR-TSPAN32 fusion protein; the gene sequence of the CAR-TSPAN32 fusion protein is shown in SEQ ID NO.

10.

2. The protein encoding TSPAN32 according to claim 1 Tspan32 The application of the gene in the preparation of chimeric antigen receptor T cells is characterized by: The gene sequence of the TSPAN32 protein is shown in SEQ ID NO.

1.

3. The protein encoding TSPAN32 according to claim 2 Tspan32 The application of the gene in the preparation of chimeric antigen receptor T cells is characterized by: The chimeric antigen receptor T cells express the CAR-TSPAN32 fusion protein.

4. A chimeric antigen receptor T cell, characterized in that: This includes T cells that express the CAR-TSPAN32 fusion protein, as shown in SEQ ID NO.

10.

5. The method for preparing chimeric antigen receptor T cells according to claim 4, characterized in that: The following steps are performed sequentially: S1 Construction of expression plasmid: The gene of CAR-TSPAN32 fusion protein was integrated into an empty vector to obtain the expression plasmid; S2 virus packaging: Expression plasmid and packaging plasmid were added to 293T cells, and after culturing, the supernatant was collected, and impurities were removed to obtain the virus solution. S3 cell infection: T cells were cultured using T lymphocyte stimulation medium and then infected with viral fluid to obtain CAR-TSPAN32 T cells.

6. The method for preparing chimeric antigen receptor T cells according to claim 5, characterized in that: In S3, the T lymphocyte stimulation solution consists of lymphocyte culture medium, FBS, penicillin-streptomycin antibiotics, human IL2, human Anti-CD3, and human Anti-CD28; in S1, the empty vector is pLVX-IRES-mCherry; and in S2, the packaging plasmids include psPAX2 and pMD2G.

7. The use of a chimeric antigen receptor T cell according to claim 4 in the preparation of an immunomodulatory drug for B-lymphoma.

Images