A method for synthesizing 1,4-butanediol based on multi-enzyme cascade catalysis of gamma-butyrolactone

Abstract

The application discloses a method for synthesizing 1,4-butanediol from gamma-butyrolactone based on multi-enzyme cascade catalysis, and belongs to the technical field of biological catalysis and bio-chemical industry. The application provides a method for catalyzing gamma-butyrolactone by using multi-enzyme cascade of caprolactone hydrolytic enzyme, carboxylic acid reductase, alcohol dehydrogenase and coenzyme regeneration enzyme, which can convert and produce 1,4-butanediol under mild conditions. The reaction time is shorter than direct fermentation, the intermediate operation is less, the molar conversion rate is higher, the reaction cost is greatly reduced compared with metal catalyst catalysis, and the method has important application value.

Description

Technical Field

[0001] This invention relates to a method for synthesizing 1,4-butanediol from γ-butyrolactone based on multi-enzyme cascade catalysis, belonging to the fields of biocatalysis and biochemical technology. Background Technology

[0002] 1,4-Butanediol (1,4-BDO) is a commodity chemical primarily used in the production of important organic and fine chemicals, such as polybutylene terephthalate (PET) engineering plastics, PET fibers, and tetrahydrofuran. In addition, 1,4-Butanediol can be used as a solvent and humectant in some reactions. Furthermore, derivatives of 1,4-Butanediol can be used to manufacture a range of important high-value-added compounds, including polyesters, polyurethanes, spandex, pharmaceuticals, cosmetics, polybutylene succinate, and biodegradable plastics. Therefore, 1,4-Butanediol has a wide range of applications and is listed in the NICNAS High Value Industrial Chemicals List (HVICL), possessing broad development prospects.

[0003] Currently, the main industrial production methods for 1,4-butanediol globally are chemical synthesis methods, including the butadiene method, the Reppe method, the propylene oxide method, and the maleic anhydride method. Among these, the maleic anhydride method has gradually become the mainstream chemical production method due to its wide availability of raw materials, simple process, low investment, and significant cost advantage. However, these traditional manufacturing routes rely on non-sustainable renewable fossil resources (acetylene or n-butane) and energy-intensive chemical processes, leading to fossil energy scarcity and environmental pollution. Therefore, exploring a complete biochemical pathway for 1,4-butanediol synthesis, and introducing artificial metabolic pathways that can convert endogenous precursors or inexpensive exogenous renewable raw materials into the desired product, to achieve an efficient and sustainable 1,4-butanediol biosynthesis process, is a significant challenge for the 21st century.

[0004] Current research on the bio-based synthesis of 1,4-butanediol mainly focuses on fermentation using biomass such as glucose and lignocellulose. This method involves a lengthy metabolic pathway, complex metabolic regulation, and low molar conversion rates. In contrast, biocatalytic methods for producing 1,4-butanediol offer a milder reaction and better selectivity, reducing the consumption of metal catalysts and fossil fuels, improving the circular economy, and achieving low-carbon production. Therefore, developing an enzymatic biomanufacturing industry for the production of 1,4-butanediol using γ-butyrolactone (GBL) as a substrate is of great significance for environmental protection and improving the circular economy. Summary of the Invention

[0005] To address the aforementioned problems, this invention provides a novel method for producing 1,4-butanediol from γ-butyrolactone under mild conditions.

[0006] This invention provides a method for the production of 1,4-butanediol from γ-butyrolactone via a multi-enzyme cascade catalysis, wherein the method uses caprolactone hydrolase (ChnC), carboxylic acid reductase (Car), alcohol dehydrogenase (YqhD), and coenzyme regeneration enzyme as catalysts to co-catalyze the production of 1,4-butanediol.

[0007] In one embodiment, the coenzyme for coenzyme regeneration includes, but is not limited to, formate dehydrogenase (FDH).

[0008] In one embodiment, the method first hydrolyzes γ-butyrolactone to 4-hydroxybutyric acid (GHB) using caprolactone hydrolase. Then, 4-hydroxybutyric acid is reduced to 4-hydroxybutyraldehyde (4HB) by carboxylic acid reductase. Subsequently, 4-hydroxybutyraldehyde is finally reduced to 1,4-butanediol by alcohol dehydrogenase. Simultaneously, NADH / NAD is constructed by introducing formate dehydrogenase. + The coenzyme recycling system achieves efficient enzymatic production of 1,4-butanediol through a cascade reaction of four enzymes.

[0009] In one embodiment, the caprolactone hydrolase is derived from Rhodococcus sp. TK6, with the amino acid sequence shown in GenBank accession number AY486161.1, and the gene sequence encoding the caprolactone hydrolase is shown in SEQ ID NO.1.

[0010] In one embodiment, the carboxylic acid reductase is derived from Mycobacterium marinum, with the amino acid sequence shown in GenBank accession number NZ_CP058277.1, and the gene sequence encoding the carboxylic acid reductase is shown in SEQ ID NO.2.

[0011] In one embodiment, the alcohol dehydrogenase is derived from Escherichia coli (E. coli K12 MG1655), with the amino acid sequence shown in GenBank accession number: AP009048.1, and the gene sequence encoding the alcohol dehydrogenase is shown in SEQ ID NO.3.

[0012] In one embodiment, the formate dehydrogenase is derived from Candida boidinii, with the amino acid sequence shown in GenBank accession number AJ245934.1, and the gene sequence encoding the formate dehydrogenase is shown in SEQ ID NO.4.

[0013] In one embodiment, the caprolactone hydrolase, carboxylic acid reductase, alcohol dehydrogenase, and formate dehydrogenase are obtained by Escherichia coli production.

[0014] In one embodiment, the encoding genes for caprolactone hydrolase, carboxylic acid reductase, alcohol dehydrogenase, and formate dehydrogenase are expressed using pET28a or pETDuet1 as expression vectors, respectively.

[0015] In one embodiment, the gene is successfully expressed in recombinant Escherichia coli using E. coli BL21 as the expression host.

[0016] In one embodiment, the enzyme solution is prepared by activating the recombinant Escherichia coli strain with LB medium and culturing it at 37°C and 160-180 r / min for 10-12 h to obtain a seed culture; the seed culture is then transferred to 50 mL of LB liquid medium at an inoculation rate of 1%, and cultured for another 2 h until OD (Organic Demand). 600 The concentration was set to 0.8 to obtain the fermentation broth. After adding 0.5 mmol / L IPTG to the fermentation broth, the mixture was induced at 16℃ for 12-14 h. After fermentation, the cells were collected by centrifugation at 8000 rpm for 10 min at 4℃. The cells were washed twice with phosphate-buffered saline (pH 7.4) to thoroughly remove the culture medium. Finally, the bacterial suspension was disrupted using a cell disruptor, and after disruption, it was centrifuged at 12000 rpm for 20 min at 4℃.

[0017] In one embodiment, the method involves a catalytic reaction in a reaction system containing coenzyme NADH and sodium formate for coenzyme recycling.

[0018] In one embodiment, the conversion is carried out at 30–35°C and pH 7.0–8.0.

[0019] In one embodiment, the concentration of the substrate γ-butyrolactone in the conversion reaction system is 5–10 g / L.

[0020] In one embodiment, the ratio of the enzyme activities of caprolactone hydrolase, carboxylic acid reductase, and alcohol dehydrogenase is 1:3:2.

[0021] In one embodiment, the reaction process is further supplemented 1 to 2 times; the supplement is the addition of a final concentration of 5 g / L of substrate γ-butyrolactone and an equimolar ratio (0.12 M) of co-substrate sodium formate.

[0022] In one embodiment, the reaction system contains 5 g / L (0.06 M) of the substrate γ-butyrolactone, 24 mM NADH, 0.12 M sodium formate, formate dehydrogenase at a final concentration of 1 U / L, and caprolactone hydrolase, carboxylic acid reductase, and alcohol dehydrogenase with an enzyme activity ratio of 1:3:2; the amount of caprolactone hydrolase added is 10 U / L.

[0023] This invention provides the application of caprolactone hydrolase, carboxylic acid reductase, alcohol dehydrogenase, and formate dehydrogenase, or enzyme preparations containing the above four enzymes, in the preparation of 1,4-butanediol.

[0024] Beneficial effects:

[0025] (1) The caprolactone hydrolase (ChnC), carboxylic acid reductase (Car), alcohol dehydrogenase (YqhD) and formate dehydrogenase (FDH) of the present invention can catalyze the conversion of γ-butyrolactone to 1,4-butanediol under mild conditions via a multi-enzyme cascade method.

[0026] (2) The method of the present invention is used to prepare 1,4-butanediol. The reaction time is shorter than that of direct fermentation, there are fewer intermediate operations, and the molar conversion rate is higher. At the same time, the reaction cost is greatly reduced compared with the use of metal catalysts, which has important value and significance. Attached Figure Description

[0027] Figure 1 The effect of different substrate concentrations on the enzyme conversion for the preparation of 1,4-butanediol.

[0028] Figure 2 The effects of different temperatures and pH values ​​on the enzyme conversion of 1,4-butanediol were investigated.

[0029] Figure 3 The effect of adding different enzyme activities at varying ratios on conversion rate.

[0030] Figure 4 To facilitate the synthesis of 1,4-butanediol via a multi-enzyme cascade catalysis.

[0031] Figure 5 The synthesis of 1,4-butanediol was carried out using a multi-enzyme cascade catalysis strategy with a substrate feed approach.

[0032] Figure 6 Comparison of the synthesis of 1,4-butanediol catalyzed by carboxyl reductases from different sources. Detailed Implementation

[0033] The present invention will be further described below with reference to specific embodiments.

[0034] The detection methods involved in the following embodiments are as follows:

[0035] Method for determining caprolactone hydrolase activity:

[0036] The 3 mL premix solution used for enzyme activity assay contained 0.3 mol / L γ-butyrolactone solution and 0.05 mol / L phosphate solution, with a pH of 7.4. 50 μL of appropriately diluted test sample was added, the reaction was started and timed, and samples were taken every hour. A standard curve was plotted using different concentrations of γ-butyrolactone, and the amount of substrate γ-butyrolactone consumed per hour was calculated.

[0037] Enzyme activity is defined as the amount of enzyme required to consume 1 μmol of γ-butyrolactone per hour.

[0038] Methods for determining carboxylic acid reductase activity:

[0039] The 3 mL reaction system included 2840 μL of 50 mM phosphate buffer (pH 7.4), 100 μL of 0.3 mol / L R-3-aminobutyric acid solution, 10 μL of 3 mmol / L NADH and 50 μL of enzyme solution;

[0040] After the reaction was completed, the activity was determined based on the change in NADH absorbance of the reaction solution at 340 nm.

[0041] Enzyme activity unit definition: The amount of enzyme required to consume 1 μmol NADH in 1 minute.

[0042] Methods for determining alcohol dehydrogenase activity:

[0043] The 3 mL reaction system included 2840 μL of 50 mM phosphate buffer (pH 7.4), 100 μL of 0.3 mol / L 4-hydroxybutyraldehyde solution, 10 μL of 3 mmol / L NADH and 50 μL of enzyme solution;

[0044] After the reaction was completed, the activity was determined based on the change in NADH absorbance of the reaction solution at 340 nm.

[0045] Enzyme activity unit definition: The amount of enzyme required to consume 1 μmol NADH in 1 minute.

[0046] Method for determining formate dehydrogenase activity:

[0047] The 3 mL reaction system included 2840 μL of 50 mM phosphate buffer (pH 7.4), 100 μL of 0.3 mol / L sodium formate solution, and 10 μL of 3 mmol / L NAD+. + And 50 μL of enzyme solution;

[0048] After the reaction was completed, the activity was determined based on the change in NADH absorbance of the reaction solution at 340 nm.

[0049] Enzyme activity unit definition: The amount of enzyme required to generate 1 μmol NADH in 1 minute.

[0050] Method for determining the yield of 1,4-butanediol:

[0051] The sample was centrifuged, filtered, and dehydrated before being diluted with methanol. 1,4-Butanediol was detected by gas chromatography using an HP-Innowax (60m × 0.25mm × 0.5μm) column. Detection conditions were set as follows: initial column temperature 70℃, hold for 1 min, then ramp to 220℃ at a rate of 20℃ / min, hold for 5 min. Injector temperature: 230℃. Carrier gas: helium (purity ≥99.999%), flow rate 1 mL / min. Injection method: pulsed splitless injection; injection pulse pressure: 30 psi; time: 0.5 min; injection volume: 1 μL.

[0052] Conversion efficiency: The conversion efficiency is calculated as the ratio of the mass of 1,4-butanediol produced in the final reaction to the mass of the initially added γ-butyrolactone.

[0053] The culture media involved in the following examples are as follows:

[0054] LB solid medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, 0.2 g / L agar powder.

[0055] LB liquid medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl.

[0056] Example 1: Construction of recombinant plasmids

[0057] The specific steps are as follows:

[0058] (1) Based on the caprolactone hydrolase gene sequence (SEQ ID NO.1) in NCBI, design PCR primers P5 and P6 for caprolactone hydrolase;

[0059] P5:CATCACCACAGCCAGGATCCCATGACCAACAGCGTTCGTAG;

[0060] P6:GGCGCGCCGAGCTCGAATTCTTACTTCTGGTACCAGGCGGC;

[0061] (2) Based on the carboxylic acid reductase gene sequence (SEQ ID NO.2) in NCBI, design PCR primers P7 and P8 for carboxylic acid reductase;

[0062] P7:GCGGCAGCCATATGGCTAGCATGAGCCCGATCACCCG;

[0063] P8:TGGTGGTGGTGGTGCTCGAGTTACAGCAGGCCCAGCAG;

[0064] (3) Based on the alcohol dehydrogenase gene sequence (SEQ ID NO.3) in NCBI, design PCR primers P9 and P10 for alcohol dehydrogenase;

[0065] P9:TGGGTCGCGGATCCGAATTCATGAACAACTTTAATCTGCACACCC;

[0066] P10:TCGAGTGCGGCCGCAAGCTTTTAGCGGGCGGCTTCG;

[0067] (4) Based on the formate dehydrogenase gene sequence (SEQ ID NO.4) in NCBI, design PCR primers P11 and P12 for caprolactone hydrolase;

[0068] P11:TGGGTCGCGGATCCGAATTCATGAAGATTGTCTTAGTTCTTTATGATGCTG;

[0069] P12:TCGAGTGCGGCCGCAAGCTTCTATTTCTTATCGTGTTTACCGTAAGCT;

[0070] (5) Sangon Biotech (Shanghai) Co., Ltd. was commissioned to synthesize the genes of three enzymes: caprolactone hydrolase, carboxylic acid reductase and formate dehydrogenase. The synthesized genes were linked to the pUC18 plasmid. Genomic DNA was extracted from Escherichia coli (E. coli K12 MG1655) using the Novizan Genomic DNA Extraction Kit.

[0071] (6) Using the plasmid synthesized in step (5) or the extracted genomic DNA as a template, perform PCR amplification using the primers described above. The amplification conditions are as follows: 95℃ pre-denaturation for 5 min, one cycle; 95℃ denaturation for 1 min, 58℃ annealing for 1 min, 72℃ extension for 1 min 30 s, 30 cycles; 72℃ final extension for 10 min. After amplification, the PCR product is purified and recovered using the Novizan gel recovery kit.

[0072] (7) The PCR product ChnC was digested with BamHI and EcoRI respectively and then ligated by PCR to obtain the recombinant plasmid pETDuet1-RsChnC; the PCR product Car was digested with NheI and XhoI respectively and then ligated by PCR to obtain the recombinant plasmid pET28a-MmCar; the PCR product YqhD was digested with EcoRI and HindIII respectively and then ligated by PCR to obtain the recombinant plasmid pET28a-EcYqhD; the PCR product FDH was digested with EcoRI and HindIII respectively and then ligated by PCR to obtain the recombinant plasmid pET28a-CbFDH.

[0073] Example 2: Construction of recombinant bacteria

[0074] Take 100 μL of E. coli BL21 competent cells and place them in a 1.5 mL centrifuge tube. Add 5 μL of the recombinant plasmids pETDuet1-RsChnC, pET28a-MmCar, pET28a-EcYqhD, and pET28a-CbFDH prepared in Example 1, respectively. Gently pipette the plasmids and place them on ice for 30 min. Place the centrifuge tube in a 42°C heat shock tank for 90 s and then place it on ice for 5 min. Add 800 μL of LB liquid medium and incubate at 37°C in a shaker for 1-1.5 h. After centrifugation, discard most of the supernatant, resuspend the cells by pipette, and spread the remaining bacterial culture on an LB plate containing the corresponding resistance (kanamycin or ampicillin). After the transformants grow, extract the plasmids for verification. If the verification is correct, the recombinant bacteria can be obtained.

[0075] Example 3: Preparation of enzyme solution

[0076] (1) The recombinant bacteria obtained in Example 2 were activated with LB medium and cultured at 37°C and 160-180 r / min for 12 h to obtain seed liquid;

[0077] (2) Transfer the seed culture obtained in step (1) into 50 mL of LB medium at an inoculation rate of 1%, and continue culturing for 2 h until OD. 600 The concentration was 0.8, and the fermentation broth was obtained.

[0078] (3) After inducing the fermentation broth obtained in step (2) at a final concentration of 0.5 mmol / L at 16℃ for 12 h, the cells were collected by centrifugation at 4℃ and 8000 r / min for 10 min.

[0079] (4) After washing the bacterial cells collected in step (3) twice with phosphate buffer at pH 7.4, place the bacterial suspension in a cell disruptor to disrupt it. After disruption, centrifuge at 4°C and 12000r / min for 20min to obtain enzyme solution.

[0080] Example 4: Establishment and optimization of multi-enzyme cascade catalytic reactions

[0081] (1) Establishment of multi-enzyme cascade catalytic reaction

[0082] The formation of 1,4-butanediol was carried out through a multi-enzyme cascade catalytic reaction. The total volume of the reaction system was 100 mL, including 0.1 M phosphate buffer (pH 7.4), key enzyme solution, substrate γ-butyrolactone, sodium formate, and coenzyme NADH. The reaction temperature was 30℃-37℃, and the reaction time was 40 h-96 h.

[0083] (2) Substrate concentration optimization

[0084] The reaction system contained caprolactone hydrolase, carboxyl reductase, and alcohol dehydrogenase, each at a concentration of 2 U / g of the substrate γ-butyrolactone, and coenzyme NADH at 10.8 g / L. Multi-enzyme cascade transformation was performed under different substrate concentrations of 5 g / L, 10 g / L, 15 g / L, and 20 g / L for 40 h at a temperature of 30 °C and a pH of 7.0. The results are as follows: Figure 1 . Figure 1 Figure a shows the concentrations of various substances after 16 hours of the conversion reaction: When the concentration of γ-butyrolactone was 15 g / L, the yield of 1,4-butanediol was 0.703 g / L, and the overall yields among the groups were not significantly different. When the substrate concentration was 20 g / L, the yield decreased significantly, reaching only 0.612 g / L. Furthermore, both the substrate and intermediate product were detectable at γ-butyrolactone concentrations of 10 and 15 g / L, while at a substrate concentration of 5 g / L, only 0.684 g / L of 1,4-butanediol was detectable; the intermediate product 4-hydroxybutyraldehyde and the substrate γ-butyrolactone were undetectable. Since the substrate, as an organic solvent, may affect enzyme activity, a substrate concentration of 5 g / L was chosen for subsequent experiments.

[0085] (3) Optimization of reaction temperature

[0086] The reaction system contained three key enzymes—caprolactone hydrolase, carboxyl reductase, and alcohol dehydrogenase—each at a concentration of 10 U / L; γ-butyrolactone as substrate at a concentration of 5 g / L; and NADH coenzyme at a concentration of 10.8 g / L. Multi-enzyme cascade transformation was performed at 25℃, 30℃, 35℃, 37℃, and 40℃, with a buffer pH of 7.4. The results are as follows: Figure 2 a. When reacted at 30℃ for 16 hours, the concentration of 1,4-butanediol can reach 0.642 g / L.

[0087] (4) Optimization of reaction pH

[0088] The reaction system contained caprolactone hydrolase, carboxyl reductase, and alcohol dehydrogenase (each enzyme solution was added at 10 U / L), γ-butyrolactone substrate at 5 g / L, and NADH coenzyme at 10.8 g / L. Multi-enzyme cascade transformation was carried out at 37℃ and pH 6, 7, 8, and 9. The results are as follows: Figure 2 b. After 20 hours of reaction, the yield of 1,4-butanediol reached 0.535 g / L at pH 7, while the reaction efficiency was significantly affected at pH 6 and 9.

[0089] (5) Optimize the enzyme activity addition ratio

[0090] The reaction system contained: 1 g / L of substrate γ-butyrolactone, 10.8 g / L of coenzyme NADH, and enzyme solutions of key enzymes with varying concentrations. The concentration of caprolactone hydrolase was fixed at 10 U / L. The enzyme activities (U / mL) of caprolactone hydrolase, carboxyl reductase, and alcohol dehydrogenase were in ratios of 1:1:1, 1:3:2, and 1:2:3, respectively. The multi-enzyme cascade transformation was carried out at 30℃ and pH 7 for 1 hour. The transformation results are shown below. Figure 3 As shown, the conversion efficiency reached 30.6% (0.306 g 1,4-butanediol / g γ-butyrolactone) when the enzyme activity ratio was 1:3:2. In subsequent experiments, caprolactone hydrolase, carboxylic acid reductase, and alcohol dehydrogenase were selected and added in a ratio of 1:3:2 for conversion experiments.

[0091] Example 5: Verification of multi-enzyme cascade catalytic reaction

[0092] The catalytic reaction of a multi-enzyme cascade was carried out under the optimized conditions of Example 4. The total volume of the catalytic system was 100 mL, the reaction conditions were 30 °C and pH 7, the enzyme activities (U / mL) of caprolactone hydrolase, carboxylic acid reductase, and alcohol dehydrogenase were added in a ratio of 1:3:2, the amount of caprolactone hydrolase added was 10 U / L, the buffer was phosphate buffer at pH 7.0, and it also contained 5 g / L (0.06 M) of substrate γ-butyrolactone, 24 mM NADH, 0.12 M sodium formate, and 10 U of formate dehydrogenase. The reaction solution was diluted with methanol, filtered through a 0.22 μm organic filter to remove water, and analyzed by gas chromatography. The results are as follows: Figure 4 As shown, after 96 hours of multi-enzyme cascade catalytic reaction, the final yield of 1,4-butanediol reached 3.52 g / L, with a molar conversion rate of 67.3%.

[0093] Example 6: Experimental verification by adding an equal mass of substrate

[0094] The reaction system and conditions were the same as in Example 5, except that the same amount of substrate γ-butyrolactone was added again 12 hours after the start of the reaction, and the results were as follows. Figure 5 As shown in a, the yield of 1,4-butanediol reached 5.03 g / L, with a molar conversion rate of 48.1%.

[0095] The reaction system and conditions were the same as in Example 5, except that the substrate was added twice more, at 12 h and 24 h, with an additional 5 g / L each time, for a total of 10 g / L added. The results are as follows: Figure 5 As shown in b, the yield of 1,4-butanediol reached a maximum of 6.31 g / L, but the molar conversion rate was only 40.2%.

[0096] The above results indicate that the enzymatic method for preparing 1,4-butanediol significantly improves the molar conversion rate of the product and greatly reduces the cost of the catalytic reaction. It has the potential to replace chemical synthesis methods due to its environmental optimization, relatively fewer reaction steps, and clean and efficient characteristics.

[0097] Comparative Example 1:

[0098] The specific implementation method is the same as in Example 5, except that the substrate concentration is 15 g / L, the pH of the reaction system is 7.4, the reaction temperature is 37°C, and the carboxyl reductase from Mycobacterium marinum is replaced with carboxyl reductase from Mycobacterium abscessus (GenBank accession number: NZ_CP034181.1). The results are as follows... Figure 6 As shown, the yields of 1,4-butanediol after 24 hours of reaction were 1.24 g / L and 1.04 g / L, respectively, indicating that the carboxyl reductase from marine mycobacteria is superior to that from mycobacterium abscessus.

[0099] Comparative Example 2:

[0100] The specific implementation method is the same as in Example 5, except that the substrate concentration is 15 g / L, the pH of the reaction system is 7.4, the reaction temperature is 37°C, and the alcohol dehydrogenase from *E. coli* K12 MG1655 is replaced with alcohol dehydrogenase from *Saccharomyces cerevisiae* (GenBank accession number: NC_001147.6) and butanol dehydrogenase from *Clostridium acetobutylicum* (GenBank accession number: NC_015687.1). The results showed that only the alcohol dehydrogenase from *E. coli* K12 MG1655* could catalyze the production of 1,4-butanediol from 4-hydroxybutyraldehyde; the other two enzymes could not catalyze this reaction.

[0101] Comparative Example 3:

[0102] The specific implementation method is the same as in Example 5, except for the addition of formate dehydrogenase and sodium formate as a cosubstrate for coenzyme cycle regeneration. The design is as follows: Group A is a blank control group; Group B is Group A with the addition of 0.12M sodium formate; Group C is Group A with the addition of 10U formate dehydrogenase; and Group D has both 0.12M sodium formate and 10U formate dehydrogenase added. The results are shown in Table 1. The introduction of the NADH regeneration system effectively increased the NADH content in the catalytic system and increased the yield of 1,4-butanediol by 85%.

[0103] Table 1. Effects of introducing the sodium formate / formate dehydrogenase-coenzyme cycle system on the synthesis of 1,4-butanediol.

[0104]

[0105] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A method for producing 1,4-butanediol from γ-butyrolactone via a multi-enzyme cascade catalysis, characterized in that, The method uses caprolactone hydrolase, carboxylic acid reductase, alcohol dehydrogenase, and coenzyme regeneration enzyme as catalysts to co-catalyze the production of 1,4-butanediol; the amino acid sequence of the caprolactone hydrolase is shown in GenBank accession number AY486161.1; the gene sequence of the carboxylic acid reductase is shown in SEQ ID NO.2; the amino acid sequence of the alcohol dehydrogenase is shown in GenBank accession number AP009048.1; the coenzyme regeneration enzyme is formate dehydrogenase; the amino acid sequence of the formate dehydrogenase is shown in GenBank accession number AJ245934.

1.

2. The method according to claim 1, characterized in that, The caprolactone hydrolase, carboxylic acid reductase, alcohol dehydrogenase, and formate dehydrogenase are obtained by fermentation of Escherichia coli.

3. The method according to claim 2, characterized in that, Caprolactone hydrolase, carboxylic acid reductase, alcohol dehydrogenase, and formate dehydrogenase were obtained by fermentation using pET28a or pETDuet1 as expression vectors and Escherichia coli as expression host.

4. The method according to any one of claims 1 to 3, characterized in that, The method involves a catalytic reaction in a reaction system containing coenzyme NADH and sodium formate for coenzyme recycling.

5. The method according to any one of claims 1 to 3, characterized in that, The method was carried out at 30-35℃ and pH 7.0-8.

0.

6. The method according to claim 4, characterized in that, The method was carried out at 30-35℃ and pH 7.0-8.

0.

7. The method according to claim 6, characterized in that, substrate in the conversion reaction system γ The concentration of β-butyrolactone is 5~10 g / L.

8. The method according to any one of claims 1-3, 6-7, characterized in that, The ratio of the enzyme activities of caprolactone hydrolase, carboxylic acid reductase, and alcohol dehydrogenase is 1:3:

2.

9. The method according to claim 8, characterized in that, Feeding is also carried out during the reaction process; the feeding refers to the addition of feed. γ -Butyrolactone and sodium formate in an equimolar ratio as a cosubstrate.

10. Use of the method according to any one of claims 1 to 9 in the preparation of products containing 1,4-butanediol.

Images