Salt-tolerant related molecular marker of rice and application thereof

Abstract

The application belongs to the field of agricultural biotechnology, and relates to a salt-tolerant related molecular marker of rice and application thereof. The GWAS signal site is located on chromosome 5, the SNP closely linked to the site is m5_29816, is located at 29,816,575 of chromosome 5 of the rice reference genome IRGSP1.0 5, and the polymorphic site is G / A. The molecular marker is used for quickly screening the AA genotype rice variety of the site from the natural resources of rice, so as to be used as a target variety of rice salt tolerance in a later field, and to reduce the workload of field test. In breeding, the AA genotype is introduced into the GG genotype receptor variety through hybridization, the AA genotype individual is identified from a separation population by using the molecular marker, and the breeding process of the salt-tolerant molecular marker is accelerated by combining with the evaluation of agronomic characters.

Description

Technical Field

[0001] This invention belongs to the field of agricultural biotechnology and relates to a molecular marker related to salt tolerance in rice and its application. Background Technology

[0002] Soil salinization is a major problem facing my country's agricultural production. More than 20% of my country's total arable land is threatened by salinization, of which nearly 200 million mu (approximately 13.3 million hectares) have agricultural potential, accounting for more than 10% of my country's total arable land. With my country's economic and social development and the accelerating urbanization process, a portion of high-yield agricultural land will inevitably be occupied. Given the continuously decreasing arable land area, planting crops in the vast saline-alkali land is a potentially valuable approach to ensure the basic needs of the Chinese people for grain and vegetable production. However, like most crops, rice is sensitive to salt stress, severely restricting rice yields in coastal, Northeast, and Hetao rice-growing areas. Conventional breeding of salt-tolerant rice varieties is time-consuming and costly. Identifying salt-tolerant loci in rice, exploring salt-tolerant gene resources, and developing molecular marker-assisted breeding design and selection will accelerate the breeding process of salt-tolerant rice varieties.

[0003] Plant salt tolerance is regulated by multiple genes, including salt stress signal sensing, signal transduction, ion transport, salt stress-induced growth slowdown, reduced cell division, cell wall extension regulation, osmotic regulation, and decreased photosynthetic rate. More than 100 genes have been identified as involved in these processes. Because crop salt tolerance is controlled by multiple minor genes, the lack of effective salt tolerance-related gene resources is a significant bottleneck limiting salt tolerance breeding in rice. Rice natural resources, due to their rich genetic diversity, are important materials for identifying salt tolerance-related genes. Summary of the Invention

[0004] The purpose of this invention is to disclose the identification of a new rice salt tolerance-related locus through field salt tolerance identification and genome-wide association analysis of natural rice resources, and to develop its molecular marker for use in the molecular design and screening of salt-tolerant rice.

[0005] This invention provides a rice salt tolerance-related molecular marker, which is located on chromosome 5 and has a GWAS signal site. The SNP closely linked to this site is m5_29816, located at position 29,816,575 on chromosome 5 of the rice reference genome IRGSP1.0, and the polymorphic site is G / A.

[0006] Furthermore, this invention provides a method for identifying rice salt tolerance-related molecular markers, which detects the polymorphism of the rice salt tolerance-related molecular markers, namely, whether the rice reference genome IRGSP1.0 chromosome 5 position 29,816,575 is a G genotype, an A genotype, or a GA mixed genotype.

[0007] Specifically, the detection is performed using PCR amplification.

[0008] Preferably, the PCR is performed using the KASP technique.

[0009] More specifically, the primers used are as follows:

[0010] SNP_G 5'-GAAGGTGACCAAGTTCATGCTaccaagtgatatgttcgaagatagtctatG-3';

[0011] SNP_A 5'-GAAGGTCGGAGTCAACGGATTaccaagtgatatgttcgaagatagtctatA-3';

[0012] Common 5'-tgaagcttcgttgttagatgcga-3'.

[0013] Furthermore, using the primers and KASP Master Mix, with rice genomic DNA as a template, PCR amplification, fluorescence detection, and data analysis were carried out on a KASP real-time quantitative PCR instrument.

[0014] In a specific implementation, the PCR program was as follows: 94℃ for 15 minutes; 94℃ for 20 seconds, 60℃ for 60 seconds, 10 cycles, with the temperature decreasing by 0.6℃ per cycle; 94℃ for 20 seconds, 55℃ for 60 seconds, 30 cycles. After the reaction was complete, the fluorescence signals of the FAM and HEX channels were read. The FAM signal corresponds to the G genotype, and the HEX signal corresponds to the A genotype.

[0015] This invention thereby provides the application of the aforementioned rice salt tolerance-related molecular markers or the method described herein in rice breeding.

[0016] Specifically, the breeding is to cultivate or screen salt-tolerant rice varieties; the marker is used for marker-assisted selection.

[0017] Preferably, the target rice variety is of AA genotype or GA heterozygous genotype.

[0018] The present invention has the following beneficial effects:

[0019] In the screening of salt-tolerant rice varieties, the molecular markers described in this invention can be used to screen for the AA genotype from natural rice resources, followed by field evaluation of salt tolerance, reducing the workload of field trials, improving efficiency, and lowering costs. In marker-assisted breeding, the molecular markers described in this invention can be used to identify F1 true heterozygotes, and backcrossing the F1 heterozygotes with the parents can accelerate the salt-tolerant rice breeding process. Attached Figure Description

[0020] Figure 1 GWAS results for rice yield under salt stress. The horizontal dashed line represents the significance threshold p=10. -5 The arrow indicates the location of the SNP molecular marker m5_29816.

[0021] Figure 2 Comparison of yield per plant under salt stress among different genotypes of the hybrid population using the SNP molecular marker m5_29816. In the figure, each point represents a recombinant inbred line, and t-tests were used for inter-group comparisons. Detailed Implementation

[0022] Example 1: Localization of salt tolerance-related loci in rice

[0023] First, over 500 rice samples were selected for field salt tolerance assessment. The method is briefly described below: Rice seeds were soaked at room temperature for one day and then sown in seedbeds. At 4 weeks of age, seedlings were transplanted individually with a plant spacing of 15 cm and a row spacing of 25 cm. Fifteen days after transplanting, the seedlings were irrigated with a 0.3% saline solution until maturity. During this period, the salinity of the paddy field was continuously measured, and the saline concentration was adjusted to maintain it at 0.3-0.4%. After maturity, individual plants were harvested, dried, threshed, and weighed. Ten replicates were performed for each variety, and the average yield was calculated.

[0024] Rice genotypes were identified using next-generation high-throughput sequencing (NGS), as follows: 100 mg of rice leaves were frozen in liquid nitrogen, ground, and genomic DNA was extracted using the CTAB method. After library construction, sequencing was performed on the Novaseq platform to obtain Fastaq sequencing data files, which were then aligned to the rice reference genome IRGSP1.0 using BWA. SNP / Indel analysis was performed according to the GATK workflow to obtain rice genotype data.

[0025] Genome-wide association analysis (GWAS) of salt tolerance-related loci in rice. After quality filtering and missing value imputation of the above genotype data, association analysis was performed using a GEMMA mixed linear model, combined with yield phenotypic data. A GWAS signal locus was found on chromosome 5, and the SNP closely linked to this locus is m5_29816. Figure 1 As shown.

[0026] Example 2: Development of primers for molecular marker PCR identification

[0027] The SNP molecular marker m5_29816 is located at position 29,816,575 on chromosome 5 of the rice reference genome IRGSP1.0, with a polymorphism of G / A. Its 300 bp flanking sequence (SEQ ID No. 1) was obtained from the genome, and the sequence is as follows:

[0028] SEQ ID No. 1, 300 bp flanking sequence of molecular marker m5_29816

[0029] tccacaactctcggagtgaagagtacttagttgacaaaggtcaaaagatgattgatagaagatatcgaaaaagatgtttattaccaggcaaagaagtaggtcgaaaggtgattgataagagaaatcgggaaagaacacatcaaggtcaaaggtgtaaaggaatacgttgaatgctaactgaggacaacatgaagagaatagtgggaagtgaaccaaatgtaaagaaagtgaatccgagttgcttgttcgtgagagctattcccagttatgaaccaagtgatatgttcgaagatagtctat[G / A]gaggtcagattaaaatcgcatctaacaacgaagcttcagatttggcaggataacgat cagaccataacaagtccagcagtaaagtcatttggggagacgtcaaagcatgtcaagtgggataagttggttctttttagaaacataattcaaaggcaaagttatcgaccctcgcatcgaatagcagaagtagctagcacccggagaccaggaaagctaatatgaggcagttggtggcaagttagaagtaaatgacaagcatgatattctcatgatgacaagcatggtatcctagtaatgacg

[0030] Competitive allele-specific PCR (KASP) primers designed using Primer3 are as follows:

[0031] SNP_G 5’-GAAGGTGACCAAGTTCATGCTaccaagtgatatgttcgaagatagtctatG-3’;

[0032] SNP_A 5’-GAAGGTCGGAGTCAACGGATTaccaagtgatatgttcgaagatagtctatA-3’;

[0033] Common 5’-tgaagcttcgttgttagatgcga-3’.

[0034] Using the primers and KASP Master Mix described above, and with rice leaf DNA from the varieties listed in the table below as templates, PCR amplification, fluorescence detection, and data analysis were performed using KASP technology on the LGC SNPline platform or an ABI 7500 / 7900 real-time quantitative PCR instrument. The PCR program was as follows: 94℃ for 15 minutes; 94℃ for 20 seconds, 60℃ for 60 seconds, 10 cycles, with a 0.6℃ decrease per cycle; 94℃ for 20 seconds, 55℃ for 60 seconds, 30 cycles. After the reaction, the fluorescence signals from the FAM and HEX channels were read. The FAM signal corresponds to the G genotype, and the HEX signal corresponds to the A genotype.

[0035] The genotypes of the molecular marker m5_29816 in 20 natural rice germplasm resources were detected using the above method. The results are shown in the table below:

[0036]

[0037]

[0038] Example 3: Application of Molecular Marker-Assisted Selection

[0039] To verify whether the SNP molecular marker m5_29816 can be used for breeding selection, we crossed the rice variety Yanfeng 47 (GG genotype) with Pokkali (AA genotype). The F2 population was passaged single-grain to obtain a recombinant inbred line population. Rice yield was then assessed in the field according to method 1, and the genotype of the recombinant inbred lines was identified using the SNP molecular marker m5_29816 according to method 2. The results are shown in the table below. Figure 2 As shown in the figure, the results indicate that the yield per plant of the AA genotype and the heterozygous GA recombinant inbred lines was significantly higher than that of the GG genotype. This suggests that the molecular marker m5_29816 can be used for auxiliary selection in the breeding of salt-tolerant rice.

[0040]

[0041]

[0042]

Claims

1. A method for identifying molecular markers related to salt tolerance in rice, characterized in that, The rice salt tolerance-related molecular marker was found to have a GWAS signal site on chromosome 5. The SNP closely linked to this site is m5_29816, located at position 29,816,575 on chromosome IRGSP1.05 of the rice reference genome. The polymorphic site is G / A, and rice carrying the A nucleotide at this site has significantly stronger salt tolerance than rice carrying the G nucleotide. The polymorphism of the rice salt tolerance-related molecular marker was detected, that is, position 29,816,575 on chromosome IRGSP1.05 of the rice reference genome is a G genotype, an A genotype, or a GA mixed genotype. The salt tolerance of recombinant inbred lines with genotypes AA and GA mixed genotypes is significantly higher than that of the GG genotype.

2. The method as described in claim 1, characterized in that, The detection was performed using PCR amplification.

3. The method as described in claim 2, characterized in that, The PCR used was the KASP technique.

4. The method as described in claim 3, characterized in that, The primers used are as follows: SNP_G5'-GAAGGTGACCAAGTTCATGCTaccaagtgatatgttcgaagatagtctatG-3'; SNP_A5'-GAAGGTCGGAGTCAACGGATTaccaagtgatatgttcgaagatagtctatA-3'; Common5'-tgaagcttcgttgttagatgcga-3'.

5. The method as described in claim 4, characterized in that, Using the primers and KASP Master Mix, rice genomic DNA was used as a template, and PCR amplification, fluorescence detection, and data analysis were carried out on a KASP real-time quantitative PCR instrument.

6. The method as described in claim 5, characterized in that, The PCR program was as follows: 94℃ for 15 minutes; 94℃ for 20 seconds, 60℃ for 60 seconds, 10 cycles, with the temperature decreasing by 0.6℃ per cycle; 94℃ for 20 seconds, 55℃ for 60 seconds, 30 cycles. After the reaction was completed, the fluorescence signals of the FAM and HEX channels were read. The FAM signal corresponds to the G genotype, and the HEX signal corresponds to the A genotype.

7. The application of the method according to any one of claims 1 to 6 in rice breeding, wherein the breeding is for cultivating or screening salt-tolerant target rice varieties, wherein, The molecular markers related to salt tolerance in rice were found to be GWAS signal sites on chromosome 5. The SNP closely linked to this site is m5_29816, located at position 29,816,575 on chromosome 5 of the rice reference genome IRGSP1.

0. The polymorphic site is G / A, and rice with the A nucleotide at this site has significantly stronger salt tolerance than rice with the G nucleotide.

8. The application as described in claim 7, characterized in that, The target rice variety is of AA genotype or GA heterozygous genotype.

Images