PCR primer for detecting african swine fever virus and application thereof

Abstract

The application discloses a PCR primer for detecting African Swine fever virus (ASFV), comprising a forward primer and a reverse primer, and the nucleotide sequences of the primer are shown as SEQ ID NO. 1 and SEQ ID NO. 2 respectively, and the application further discloses application of the primer in detection of African Swine fever virus and a method for detecting African Swine fever virus, which is high in accuracy, good in specificity and repeatability, can accurately, quickly and efficiently detect ASFV and distinguish two different genotypes of gene I and gene II.

Description

Technical Field

[0001] This invention belongs to the field of pathogen detection technology, specifically relating to a PCR primer for detecting African swine fever virus (ASFV). This invention also relates to the application of the primer in ASFV detection, which can be used to identify the genotype of ASFV. Background Technology

[0002] African swine fever (ASF) is a highly contagious disease in pigs caused by the African swine fever virus (ASFV). It is clinically characterized by acute onset, fever, hemorrhagic activity, high morbidity, and high mortality. It is also known as African swine fever or warts disease. This disease is one of the animal diseases that the World Organisation for Animal Health (WOAH) requires to be legally reported, and my country classifies it as a Class A animal disease. First reported in Kenya in 1921, the disease has been present in sub-Saharan African countries ever since. In 1957, it spread to Western Europe and Latin America. Due to timely eradication, it did not cause a major impact, but it remains prevalent in Portugal, Sardinia (Italy), and southwestern Spain.

[0003] Different ASFV strains exhibit significant differences in virulence, resulting in varying clinical symptoms. Furthermore, clinical symptoms are related to the pig's breed, health status, route of exposure, infectious dose, and local prevalence. Highly virulent strains have an incubation period of 5-15 days, accompanied by high fever, and death occurs 5-7 days after onset, with a mortality rate as high as 100%. Moderately virulent strains have a rapid onset but exhibit a certain survival rate. Pigs infected with low-virulence strains mostly show no clinical symptoms or only mild symptoms.

[0004] Historically, African swine fever (ASF) has primarily existed on the African continent. Currently, 24 genotypes of the virus are known to exist within Africa, while only genotypes I and II exist outside the continent. Currently, two different genotypes of ASFV, genotype I and genotype II, exist in China, and both genotypes exhibit varying degrees of deletion or mutation, leading to significant differences in virulence and clinical symptoms between the different strains.

[0005] Since there is currently no effective vaccine for ASF, preventing the spread of the disease relies on rapid response after an outbreak. This depends on rapid and reliable diagnostic techniques, which are crucial for controlling and eradicating the disease. In clinical testing, it is essential to differentiate between different genotypes. Rapid identification and analysis of genotype differences can further reveal the distribution and prevalence of the strain in the relevant regions, trace the source of the outbreak and its possible transmission routes, and enable timely countermeasures.

[0006] Currently reported methods for distinguishing between genotype I and genotype II ASFV mainly include: First, amplification and sequencing of the B646L gene (p72 protein). This method requires sequencing, demands sophisticated equipment, has a long processing time, is expensive, and can only sequence one strain when multiple strains are present in the sample. Second, identification methods targeting the EP402R gene (CD2v protein). However, the EP402R gene is highly variable, and the National African Swine Fever Reference Laboratory of the Harbin Veterinary Research Institute of the Chinese Academy of Agricultural Sciences has reported some strains clinically lacking this gene, thus this method has significant limitations. Another method involves detecting ASFV genotypes I and II using two primer pairs and two probes. Universal primers and probes for the B646L gene are used to determine if a sample is infected with ASFV, while primers and probes for the E183L gene are specific to genotype I. Therefore, this method distinguishes between genotype I and II strains by specifically amplifying the E183L gene. However, only the detection of the B646L gene can confirm ASFV positivity in the sample. Furthermore, the minimum detectable copy number for recombinant plasmids using this method is 1.07 × 10⁻⁶. 2 copies / μL and 3.13×10 4 The sensitivity is low, and it is prone to false negatives. Summary of the Invention

[0007] This invention addresses the shortcomings of existing technologies by developing a previously unreported ASFV detection site. Primers designed for this site can not only identify ASFV, but also quickly and conveniently distinguish between different ASFV genotypes (genotype I and genotype II), and can be used for quantification.

[0008] To achieve the above objectives, the technical solution of the present invention is as follows:

[0009] Through extensive comparison and repeated verification of ASFV whole genome sequences currently available in NCBI and ASFV sequences obtained in our laboratory, the applicant discovered a very stable non-coding region between ASFV strains MGF505-9R and MGF505-10R. This non-coding region is stably present in ASFV strains with different genotypes, and ASFV genotype I and genotype II show different expression in this region. Therefore, this invention uses Primer Premier 6 to analyze the differentially expressed regions and designs the following detection primers:

[0010] MGF505-9R-10R-F: CAGGCTAATTGTAAATAGTTG (SEQ ID NO.1)

[0011] MGF505-9R-10R-R:AACTAATGTATTAGCAGAACT(SEQ ID NO.2)

[0012] The ASFV DNA was amplified using the primers described above. For ASFV genotype II, a 331 bp fragment was amplified. The target fragment sequence is as follows:

[0013] CAGGCTAATTGTAAATAGTTGTAGATACCATATAATGAATGTTTTATTAGGATAGTAG

[0014] TTCAGTTAAGATAGTAGTTTAGTTAAGATAGTAGTTTAGTTAAGATAGTAGTTATGTT

[0015] AAGATAGTAGTTCTGTTAAGATAATAGTTTAGTTAAAACTAGTTCATGTTAAGTTAAT

[0016] AGTTTTGTTAAGACAATAGTTCATTTAAGTCAATAGTTCAGTTAAGTCAATAGTTTT

[0017] GTTAAGTCAATAGTTTAGTTAAGTCAATAGTTTAGTTAAGTCAATAGTTTAGTTAAGTCAATAGTTATATTAAGACATTAGTTCTGCTAATACATTAGTT(SEQ ID NO.3)

[0018] ASFV genotype I can amplify a 241 bp fragment, with the target fragment sequence being: CAGGCTAATTGTAAATAGTTGTAGATACCATATAATGAATGTTTTATTAGGATAGTAGTTAATAGTTTAGTTAAGACAGTAGTTCTTTCTGTTAAGATAGTAGTTCTGTTAAGATAGTAGTTTAGTTATGATAGTGGTTTAGTTAAGACAATAGTTTTGTTAAGACAGTAGTTCTGTTAAGTCAATAGTTCAGTTAAGTCAATAGTTTTGTTAAGTCAATAGTTCTGCTAATACATTAGTT (SEQ ID NO.4)

[0019] Based on the amplification of differentially expressed genes, ASFV can be identified and two different genotypes, genotype I and genotype II, can be distinguished.

[0020] Furthermore, this invention utilizes the designed PCR primers to establish a SYBR Green PCR detection method, which includes the following two steps:

[0021] Step one involves using the extracted sample DNA as a template and amplifying it using the SYBR green fluorescent dye method with the primers described above. Fluorescence signals are collected, and the Ct value is observed. This step determines whether the sample contains African swine fever virus (ASFV), thus determining the virus positivity or positivity. Experimental verification showed that the designed primers, except for ASFV-positive samples, did not specifically amplify other samples such as porcine circovirus type II (PCV2), porcine reproductive and respiratory syndrome virus (PRRSV), porcine epidemic diarrhea virus (PEDV), and getta virus (GETV), indicating good primer specificity.

[0022] Step two: Take the positive PCR product (with Ct value amplified in the previous step), add it to the wells of an agarose gel plate, add 2000 DNA markers as a molecular weight reference, and perform agarose gel electrophoresis. Observe and record the results using a gel imaging system. This step can further identify genotype I and genotype II ASFV based on the size of the amplified bands. If the amplified band is 241 bp (lower than 250 bp), it is a genotype I strain; if the amplified band is 331 bp (higher than 250 bp), it is a genotype II strain.

[0023] The detection methods applicable to this invention are not limited to the fluorescent dye method provided. Based on the detection sites and primers provided above, a series of other detection methods based on the PCR principle are all within the protection scope of this invention.

[0024] The method established in this invention can be used for both clinical diagnosis of African swine fever (ASF) and laboratory screening and identification of ASF virus for non-clinical diagnostic purposes. This method features high accuracy, specificity, and good repeatability, and can accurately, rapidly, and efficiently detect ASFV and distinguish between genotypes I and II. Specifically, the minimum detection concentration for standard plasmids of both genotype I and genotype II ASFV is 1 copy / μL, and the detection limit for both genotype I and genotype II ASFV virus is 1 TCID. 50 .

[0025] For more detailed technical solutions, please refer to the specific embodiments. Attached Figure Description

[0026] Figure 1 The primer pairs designed in this invention amplify nucleic acid bands of genotype I and genotype II strains.

[0027] Figure 2: Construction patterns of positive plasmids ASFVⅠ and ASFVⅡ.

[0028] Figure 3 The method developed in this invention was used to identify the results of agarose gel electrophoresis of different ASFV genotypes.

[0029] Figure 4 The present invention provides specific test results for detecting ASFV.

[0030] Figure 5 Results of sensitivity test for standard plasmids of different ASFV genotypes using conventional PCR method.

[0031] Figure 6 Results of sensitivity test of SYBR Green method for detecting standard plasmids of different ASFV genotypes.

[0032] Figure 7 Results of sensitivity test for ASFV genotype I virus using the SYBR Green method.

[0033] Figure 8 Results of sensitivity test for ASFV genotype II virus using the SYBR Green method. Detailed Implementation

[0034] The present invention will be further described in detail below with reference to specific embodiments.

[0035] Comparison of ASFV genes with different genotypes revealed stability differences between MGF505-9R and MGF505-10R, leading to different expression of this gene fragment. The study also found that this non-coding region is very stable in the ASFV genome, and it is present in ASFV with different gene characteristics.

[0036] Therefore, this fragment is expected to serve as a target gene for distinguishing between genotype I and genotype II. Based on this, this study designed a pair of PCR amplification primers. These primers have high sensitivity and specificity, and can accurately identify ASFV and its different genotypes. Subsequently, a fluorescent dye PCR method was developed using these primers. Clinical validation showed results consistent with the probe-based quantitative PCR method recommended by WOAH. The quantitative amplification products of positive samples could be directly identified by agarose gel electrophoresis to determine the fragment length, and the genotype could be identified based on the different fragment lengths. In genotype I strains, the fragment is 241 bp long, and in genotype II strains, the fragment is 331 bp long. Sequencing analysis of the amplification products showed that the sequencing results were identical to the designed target fragment gene sequence.

[0037] The experimental materials and procedures are as follows:

[0038] (1)Virus strain

[0039] All ASFV strains used in this study were isolated from our laboratory and are stored in the Animal Biosafety Level 3 Laboratory of Huazhong Agricultural University.

[0040] (2) Nucleic acid extraction method

[0041] The nucleic acid extraction kit used in this study was purchased from Tiangen Biotech Co., Ltd., and the specific procedures are as follows:

[0042] a. Take 200 μL of virus solution and add 20 μL of protein K, then mix well;

[0043] b. Add 200 μL GB, invert the container to mix well, place at 70°C for 10 min, and briefly centrifuge;

[0044] c. Add 200 μL of anhydrous ethanol, immediately shake to mix for 15 seconds (flocculated precipitate may appear), and briefly centrifuge;

[0045] d. Place the adsorption column, transfer the above solution into the adsorption column, centrifuge at 12000 rpm for 30 s, and discard the waste liquid;

[0046] e. Add 500 μL GD (with anhydrous ethanol added) to the adsorption column, centrifuge at 12000 rpm for 30 s, and discard the waste liquid;

[0047] f. Add 600 μL of washing buffer PW (prepared with anhydrous ethanol) to the adsorption column, centrifuge at 12000 rpm for 30 s, and discard the waste liquid;

[0048] g. Repeated operation f

[0049] h. Centrifuge at 12000 rpm for 2 min, discard the waste liquid, and let it stand at room temperature for about 2 min to dry the washing liquid in the adsorption column;

[0050] i. Transfer the adsorption column into a clean EP tube, add 50-200 μL of elution buffer TE to the inner membrane in the center of the adsorption column, incubate at room temperature for 2-5 min, and centrifuge at 12000 rpm for 2 min.

[0051] j. Add the liquid obtained from centrifugation back onto the inner membrane of the adsorption column, and repeat step i;

[0052] k. Store the product at 4°C for later use.

[0053] (3) Construction of ASFV-MGF505 plasmids of different genotypes

[0054] The primers designed in this study were used to amplify the nucleic acids of genotype I and genotype II strains isolated in our laboratory. Amplification showed that a band appeared at 241 bp in the genotype I sample and at 331 bp in the genotype II sample (e.g., ...). Figure 1 The DNA fragments amplified from genotype I and genotype II were recovered using the Biomiga Gel / PCR Extraction Kit.

[0055] Using T4 DNA Ligase (2001A) and pMD TM The 18-T Vector Cloning Kit (6011) consists of two kits that ligate the amplified and recovered genotype I and genotype II DNA target fragments into the pMD18-T vector (e.g., ...). Figure 2 The ligation product was then converted into DH5α competent cells.

[0056] After transformation, larger recombinant colonies of genotype I and genotype II were selected and inoculated into 5 mL LB broth containing ampicillin. The colonies were then incubated overnight at 37°C with a shaker speed of 180 rpm. Recombinant plasmids were extracted from the overnight culture according to the instructions of the plasmid extraction kit. The plasmid extraction kit used in this study was purchased from Tiangen Biotech Co., Ltd.

[0057] Example 1: Establishment of a real-time PCR detection method

[0058] 1. Primer sequence:

[0059] MGF505-9R-10R-F:CAGGCTAATTGTAAATAGTTG

[0060] MGF505-9R-10R-R:AACTAATGTATTAGCAGAACT

[0061] 2. Testing steps:

[0062] (1) Use adsorption column method or magnetic bead method to extract viral DNA from tissue, blood, environmental and other samples;

[0063] (2) Using the extracted DNA as a template, amplify it using the above primers and SYBR green fluorescent dye method. The amplification conditions are shown in Table 1. Observe the amplification Ct value to determine whether it contains African swine fever virus and to determine the virus positive or negative.

[0064] (3) Take 5 μL of the positive PCR product (with Ct value amplified in the previous step) and add it to the well of a 1.5% agarose gel plate. Add 5 μL of 2000 DNA Marker as a molecular weight reference. Electrophore at 180V until the plate is 2 / 3 full. Observe the results using a gel imaging system and record them (e.g., ...). Figure 3 );

[0065] (4) If the amplified band is 241bp (less than 250bp), it is a type I strain; if the amplified band is 331bp (more than 250bp), it is a type II strain.

[0066] The amplification system described in step (2) is as follows:

[0067] Table 1 PCR reaction system

[0068] 2×SYBR green Mix 10.0 Upstream primer (10 μmol / L) 0.90 Downstream primer (10 μmol / L) 0.90 template 5.0 ddH2O 3.2 Total volume 20.0

[0069] The reaction conditions are as follows:

[0070] Pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 15 s; extension at 61.4℃ for 30 s; fluorescence signal collected; cycle 40 times.

[0071] 3. Optimization of reaction temperature and primer concentration

[0072] To further determine the optimal annealing temperature, PCR amplification was performed in eight temperature ranges from 55 to 65℃. The results showed that after verification with different annealing temperatures, the amplification efficiency was highest at 61.4℃; therefore, the optimal annealing temperature is 61.4℃ (Table 2).

[0073] Table 2 Annealing Temperature Optimization

[0074]

[0075]

[0076] PCR reactions were performed with primer concentrations of 10 μmol / L at 0.1 μL, 0.2 μL, 0.3 μL, 0.4 μL, 0.5 μL, 0.6 μL, 0.7 μL, 0.8 μL, 0.9 μL, and 1.0 μL to determine the optimal primer volume. The results showed that a 0.9 μL volume of primer at a concentration of 10 μmol / L yielded the lowest Ct value and the best performance (Table 3).

[0077] Table 3 Optimization of different primer concentrations

[0078]

[0079] Example 2 Evaluation of Detection Results

[0080] 1. Specificity verification

[0081] Using the SYBR Green I quantitative fluorescence reaction system, positive samples of porcine circovirus type II (PCV2), porcine reproductive and respiratory syndrome virus (PRRSV), porcine epidemic diarrhea virus (PEDV), getta virus (GETV), ASFV type I, and ASFV type II were used, with DEPC water as a negative control, to verify primer specificity.

[0082] The results showed that, except for the ASFV-positive samples, none of the other samples exhibited specific amplification (e.g., Figure 4 ).

[0083] 2. Sensitivity Verification

[0084] The standard plasmid was prepared at 1×10 10 The initial copy number was serially diluted 10-fold, and compared with conventional PCR. The results are visible. Figure 5 The lowest concentration of the standard plasmid for genotype I that can be detected by conventional PCR is 1×10⁻⁶. 9 The minimum concentration for detecting type II plasmids is 1 × 10 copies / μL. 7 copies / μL.

[0085] The standard plasmid was prepared at 1×10 10 The copies / μL ratio was used to perform 10-fold serial dilutions. The constructed standard plasmids were then quantitatively amplified using this method, followed by agarose gel electrophoresis. The results are shown below. Figure 6 The minimum concentration at which this method can detect both type I standard plasmids and type II plasmids is 1 copy / μL.

[0086] With 200 TCID 50 100 TCID 50 50 TCIDs 50 10 TCIDs 50 5 TCIDs 50 1 TCID 50 Using a specific concentration of the virus as a template, quantitative real-time PCR was performed, with a negative control included. Each concentration was tested in triplicate, and the lowest detection concentration was defined as the concentration at which an S-shaped fluorescence curve appeared. The results show that the detection limit of the ASFV I quantitative real-time PCR method is 1 TCID. 50 ( Figure 7 The detection limit of the ASFV II type real-time PCR method is 1 TCID. 50 ( Figure 8 ).

[0087] 3. Repeatability verification

[0088] Three ASFV types I and II were randomly selected and diluted at different ratios for three replicate experiments. The mean, standard deviation, and coefficient of variation were calculated. The results showed that the coefficient of variation of the CT values ​​of ASFV type I across three amplifications was less than 1.2%, and that of ASFV type II was less than 1.0%. The error for the same concentration experimental group was less than one cycle. This indicates that the constructed method has high reproducibility, as detailed in Table 4.

[0089] Table 4. Repeatability analysis of CT values ​​at different concentrations in SYBR Green I real-time fluorescence PCR

[0090]

[0091] 4. Clinical sample testing

[0092] One hundred clinical samples were collected and tested using the established SYBR Green real-time PCR method, and compared with the WOAH and national standard methods.

[0093] The recommended methods in the Terrestrial Animal Health Code (WOAH) are as follows:

[0094] (1) Nucleic acid extraction

[0095] Viral nucleic acid was extracted from various samples using a DNA extraction kit.

[0096] (2) Primers and probes

[0097] TaqMan probe primers were used to detect the B646L gene of ASFV (encoding the p72 protein).

[0098] Upstream primer qPCR-F: 5′-CTGCTCATGGTATCAATCTTATCGA-3′

[0099] Downstream primer qPCR-R: 5′-GATACCACAAGATCAGCCGT-3′

[0100] TaqMan probe qPCR-probe: FAM-CCACGGGAGGAATACCAACCCAGTG-TAMRA

[0101] (3) The nucleic acid amplification system is shown in Table 5.

[0102] Table 5. Amplification System

[0103] <![CDATA[Premix Ex Taq TM (Probe qPCR)]]> 10.0 Forward Primer (10μM) 0.4 Reverse Primer (10μM) 0.4 probe (10μM) 0.2 Template DNA 2.0 <![CDATA[Rnase Free dH2O]]> 7.0 Total volume 20.0

[0104] (4) Amplification procedure

[0105] The WOAH recommended amplification program is 95℃ for 5 min; 95℃ for 10 sec, 60℃ for 30 sec, for 45 cycles, and then collect the FAM fluorescence signal.

[0106] (5) Conditions for the success of the experiment

[0107] A Ct value ≤ 38 indicates ASFV positivity, and no Ct value indicates negativeness; a Ct value < 38 and < 40 indicates suspected ASFV, requiring a second test. If the Ct value of the second test is still < 40, it is considered positive; otherwise, it is considered negative.

[0108] The fluorescent PCR method in the national standard for African swine fever diagnosis (GB / T 18648-2020) is as follows:

[0109] (1) Nucleic acid extraction

[0110] Viral nucleic acid was extracted from various samples using a DNA extraction kit, as detailed in Experimental Materials (2); each extraction included at least one positive control and one negative control. The positive control was an ASFV nucleic acid-positive sample, and the negative control was nuclease-free water.

[0111] (2) Primers and probes

[0112] A pair of primers and probes were designed targeting the conserved sequence of the ASFV B6464L gene.

[0113] Upstream primer VP72-F1: 5′-GCTTTCAGGATAGAGATACAGCTCT-3′

[0114] Downstream primer VP72-R1: 5′-CCGTAGTGGAAGGGTATGTAAGAG-3′

[0115] TaqMan probe VP72-T1: FAM-CCGTAACTGCTCATGGTATCAATCTTATCG-BHQ1

[0116] (3) Nucleic acid amplification

[0117] Each sample was prepared with 18 μL of fluorescent PCR reaction mixture, as shown in Table 6.

[0118] Table 6. Amplification System

[0119] Fluorescent PCR premix (2×) 10.0 VP72-F1 (10 μmol / L) 0.8 VP72-R1 (10 μmol / L) 0.8 VP72-T1 (10 μmol / L) 0.5 Nuclease-free water 5.9 Nucleic acid 2.0 Total volume 20.0

[0120] For each fluorescent PCR amplification, negative, positive, and blank controls were included. The positive and negative controls were derived from the samples, while the blank control used nuclease-free water as a template. After adding the template, the PCR amplification tubes were sealed and briefly centrifuged; all PCR amplification tubes were then placed in a fluorescent PCR instrument.

[0121] (4) Amplification procedure

[0122] Amplification conditions: 50℃ incubation for 2 min; 95℃ pre-denaturation for 5 min; 95℃ denaturation for 15 s; 58℃ annealing extension for 1 min; 45 cycles, with FAM fluorescence signals collected at 58℃ in each cycle.

[0123] (5) Conditions for the success of the experiment

[0124] If the positive control has a Ct value < 30 and shows a specific amplification curve, and the negative control has no Ct value or a Ct value ≥ 40 and shows no specific amplification curve, the test is valid; otherwise, the test should be repeated.

[0125] If the Ct value of the tested sample is ≤38 and a specific amplification curve appears, it is judged as ASFV nucleic acid positive; if there is no Ct value or the Ct value is ≥40, it is judged as ASFV nucleic acid negative; if 38 < Ct value <40 and a specific amplification curve appears, it is judged as suspected. The template amount of the suspected sample is doubled (4.0 μL DNA template) and three replicates are performed. If two Ct values ​​are <40 and a specific amplification curve appears, it is judged as ASFV positive; otherwise, it is judged as negative.

[0126] The results showed that 47 out of 100 samples tested positive, consistent with the results of the WOAH and national standard methods (Table 7). Electrophoretic analysis of the 47 positive products amplified using this method revealed 3 genotype I strains and 44 genotype II strains. Simultaneously, sequencing was used to amplify the B646L gene (p72 protein) in the positive samples, and sequencing analysis yielded results consistent with our findings. However, conventional sequencing methods can only identify 22 strongly positive samples (samples with Ct values ​​below 30), indicating a limitation (Table 8). This demonstrates that our method has a wider range of applications and is more convenient for distinguishing between genotype I and genotype II strains.

[0127] Table 7. Comparison of ASFV positive and negative detection results using different methods

[0128]

[0129]

[0130] Table 8. Comparison of ASFV genotype identification results using different methods

[0131]

Claims

1. A non-diagnostic method for detecting African swine fever virus (ASFV) African Swine fever virus, ASFV The method, characterized in that, The method includes the following steps: Step 1: Using the extracted sample DNA as a template, PCR amplification is performed using the SYBR green fluorescent dye method. Fluorescence signals are collected, and Ct values ​​are observed. The magnitude of the Ct value determines whether the sample contains African swine fever virus. The primer sequences for the PCR amplification are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively. Step 2: Take the positive PCR product and add it to the sample well of an agarose gel plate. Add 2000 DNA Marker as a molecular weight reference and perform agarose gel electrophoresis. Observe and record the results using a gel imaging system. Further identify the African swine fever virus of genotype I and genotype II based on the size of the amplified band. If the amplified band is 241 bp, it is a genotype I strain. If the amplified band is 331 bp, it is a genotype II strain.

2. The method for detecting African swine fever virus as described in claim 1, characterized in that: The PCR amplification system is as follows: 10 µL of 2×SYBR green Mix; 0.9 µL of 10 µmol / L upstream primer; 0.9 µL of 10 µmol / L downstream primer; 5 µL of sample nucleic acid; 3.2 µL of ddH2O, for a total volume of 20 µL.

3. The method for detecting African swine fever virus as described in claim 1, characterized in that: The PCR amplification program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s; 61.4℃ extension for 30 s; 40 cycles.

Images