Stenotrophomonas maltophilia fen and its application in degrading 3-methylindole

Abstract

The application discloses a kind of stenotrophomonas maltophilia FEN and its application in degrading 3-methylindole, the static cell obtained by expanding culture of stenotrophomonas maltophilia FEN is added in inorganic salt culture solution containing 3-methylindole at pH=6-8, is cultured under the condition of 25-35 DEG C, and the degradation of 3-methylindole is realized;The stenotrophomonas maltophilia FEN described in the application can completely degrade 3-methylindole into carbon dioxide and water, and the removal rate of 3-methylindole within 80mg / L is as high as 100%.Therefore, the stenotrophomonas maltophilia FEN has high degradation capacity for skatole (3-methylindole), and can withstand higher concentration of pollutants.

Description

(I) Technical Field

[0001] This invention relates to a Stenotrophomonas maltophilia FEN strain and its application in the degradation of skatole (3-methylindole) in waste gas and wastewater. (II) Background Technology

[0002] Skatole, or 3-methylindole, is a moderately toxic white crystalline organic compound and a derivative of indole. It is found in human and animal feces, emitting an unpleasant fecal odor. Skatole (3-methylindole) is a typical substance contributing to the odor of wastewater and exhaust gases. It is commonly found in domestic sewage, industrial wastewater, and the foul-smelling gases they produce; direct discharge would inevitably cause serious harm to the environment and public health. Skatole (3-methylindole) has complex biochemical mechanisms; at high concentrations, it emits a foul odor, irritates the respiratory system, and threatens the growth and metabolism of organisms. Experiments have shown that skatole can cause pulmonary edema in goats, sheep, rats, and certain breeds of mice.

[0003] Chemical treatment methods, such as photocatalytic oxidation, have been developed to remove skatole (3-methylindole) from wastewater and exhaust gases. However, biological processes are generally considered a cost-effective alternative, in which skatole (3-methylindole) can be oxidized by bacteria into carbon dioxide and water. This is a direct degradation method for odorous substances that is green, environmentally friendly, safe, and has a good deodorization effect with virtually no secondary pollution.

[0004] Therefore, screening for highly efficient skatole (3-methylindole) degrading strains from the environment is essential for environmental health. Literature review currently focuses on the degradation of skatole (3-methylindole) in wastewater by *Rhodococcus pyridinivorans*, *Rhodococcus pyridinivorans*, and *Pseudomonas aeruginosa*. No reports have been found regarding the efficient degradation of skatole (3-methylindole) by *Stenotrophomonas maltophilia* using it as a carbon source. (III) Summary of the Invention

[0005] The purpose of this invention is to provide an application of Stenotrophomonas maltophilia FEN in the degradation of 3-methylindole. This Stenotrophomonas maltophilia FEN can degrade skatole (3-methylindole) using a carbon source, producing carbon dioxide and water, and is easily cultured on a large scale. The discovery of this degrading bacterium is of great significance for the efficient purification of skatole-like pollutants in industrial wastewater.

[0006] The technical solution adopted in this invention is:

[0007] This invention provides a 3-methylindole degrading bacterium, Stenotrophomonas maltophilia FEN, deposited at the China Center for Type Culture Collection (CCTCC), accession number: CCTCC NO: M2023363, deposit date: March 20, 2023, address: Wuhan University, Wuhan, China, 430072.

[0008] The basic characteristics of Stenotrophomonas maltophilia FEN of this invention are: the colonies are orange-yellow with neat edges, opaque, easy to pick up, and the bacterial growth follows the streaks; it is aerobic and Gram-negative.

[0009] This invention also provides an application of Stenotrophomonas maltophilia FEN in the degradation of 3-methylindole. Specifically, the application involves adding resting cells obtained by expanding the culture of Stenotrophomonas maltophilia FEN to an inorganic salt culture medium containing 3-methylindole at pH 6-8, and culturing at 25-35°C to achieve the degradation of 3-methylindole.

[0010] Furthermore, the 3-methylindole can be wastewater or waste gas containing 3-methylindole.

[0011] Furthermore, in the inorganic salt culture medium, the amount of resting cells added is 20-80 mg / L based on the dry weight of the cells, preferably 50 mg / L.

[0012] Furthermore, the initial concentration of 3-methylindole in the inorganic salt culture medium is 50-150 mg / L, preferably 80 mg / L.

[0013] Furthermore, the inorganic salt culture medium is composed of: K2HPO4·3H2O 1.0 g / L, KH2HP4 0.02 g / L, CaCl2 0.05 g / L, MgCl2 0.5 g / L, FeCl2 0.01 g / L, (NH4)2SO4 1.0 g / L, NaCl 5.0 g / L, and deionized water as the solvent.

[0014] Furthermore, the resting Stenotrophomonas maltophilia FEN cells were prepared according to the following steps:

[0015] (1) Slant culture:

[0016] Stenotrophomonas maltophilia FEN was inoculated onto an inorganic salt solid medium and cultured at 30°C for 24–36 h to obtain slant cells. The final concentration of the inorganic salt solid medium was: K₂HPO₄·3H₂O 1.0 g / L, KH₂HP₄ 0.02 g / L, CaCl₂ 0.05 g / L, MgCl₂ 0.5 g / L, FeCl₂ 0.01 g / L, (NH₄)₂SO₄ 1.0 g / L, NaCl 5.0 g / L, agar 18–20 g / L, deionized water as solvent, pH 6–8.

[0017] (2) Expanded cultivation:

[0018] Pick up the slant cells obtained in step (1) with an inoculation loop and inoculate them into an inorganic salt culture medium. Incubate at 30°C for 24–36 h to obtain an expanded culture medium. Centrifuge, collect the wet cells, wash with inorganic salt culture medium, and obtain resting cells of Stenotrophomonas maltophilia FEN.

[0019] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in:

[0020] The Stenotrophomonas maltophilia FEN strain provided by this invention is derived from activated sludge in wastewater treatment plants. It exhibits highly efficient degradation of skatole (3-methylindole), and can relatively completely convert pollutants into recyclable substances such as carbon dioxide and water. Therefore, it has broad application prospects in the biological purification of industrial waste gas and wastewater.

[0021] The Stenotrophomonas maltophilia FEN strain described in this invention can completely degrade 3-methylindole into carbon dioxide and water, and the removal rate of 3-methylindole up to 80 mg / L is as high as 100%. Therefore, this Stenotrophomonas maltophilia FEN strain has a highly efficient degradation ability for skatole (3-methylindole) and can withstand high concentrations of pollutants. (iv) Description of the attached drawings

[0022] Figure 1 This is a photograph of the colony morphology of strain FEN on an inorganic salt solid medium.

[0023] Figure 2 This is a phylogenetic tree diagram of strain FEN.

[0024] Figure 3 The standard line for high performance liquid chromatography is given for different concentrations of 3-methylindole.

[0025] Figure 4The degradation curve of Stenotrophomonas maltophilia FEN at 80 mg / L of 3-methylindole.

[0026] Figure 5 The concentration change curve of 80 mg / L 3-methylindole in the same environment when Stenotrophomonas maltophilia FEN is absent. (V) Detailed Implementation

[0027] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto:

[0028] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0029] The inorganic salt culture medium consisted of: K2HPO4·3H2O 1.0 g / L, KH2HP4 0.02 g / L, CaCl2 0.05 g / L, MgCl2 0.5 g / L, FeCl2 0.01 g / L, (NH4)2SO4 1.0 g / L, and NaCl 5.0 g / L. The solvent was deionized water, and the pH was 6-8.

[0030] The final concentration of the inorganic salt solid culture medium is as follows: K2HPO4·3H2O 1.0 g / L, KH2HP4 0.02 g / L, CaCl2 0.05 g / L, MgCl2 0.5 g / L, FeCl2 0.01 g / L, (NH4)2SO4 1.0 g / L, NaCl 5.0 g / L, agar 18–20 g / L, deionized water as solvent, pH 6–8.

[0031] Example 1: Isolation, purification and identification of Stenotrophomonas maltophilia FEN.

[0032] 1. Isolation and purification of Stenotrophomonas maltophilia FEN.

[0033] Stenotrophomonas maltophilia FEN is a Gram-negative bacterium that was domesticated and isolated from activated sludge. The specific steps are as follows:

[0034] Add 50 mL of inorganic salt culture medium to a 300 mL shake flask, along with 10 mL of activated sludge collected from a wastewater treatment plant and 11.07 g / L of 3-methylindole. Incubate at 30 °C for enrichment. When the 3-methylindole concentration reaches 50% of the initial concentration, take 5 mL of the enriched solution and add it to 50 mL of fresh inorganic salt culture medium. Add the same amount of 3-methylindole. Repeat this enrichment process 5 times. Then, serially dilute the final enriched solution and spread it onto an inorganic salt solid culture medium. Purify the culture by streaking on single-colony isolation plates. Figure 1 Single colonies were obtained and added to an inorganic salt culture medium. 11.07 g / L 3-methylindole was added as the sole carbon and energy source. The mixture was then placed in a shake flask and incubated on a shaker at 30°C for 24-36 hours. Samples were taken for verification, specifically by detecting the peak area of ​​3-methylindole using high-performance liquid chromatography (HPLC) and analyzing the 3-methylindole standard curve. Figure 3 The concentration of 3-methylindole was obtained, the degradation rate of 3-methylindole was calculated, and the strain with the highest degradation rate of 100% was selected and denoted as strain FEN.

[0035] High performance liquid chromatography parameters: Waters 2695 high performance liquid chromatography instrument, 250 mm long C18 column, mobile phase: methanol:water = 3:7, flow rate: 0.6 mL / min, injection volume: 15 μL, detection wavelength: 225 nm, column temperature: 30 °C.

[0036] 2. Identification of strain FEN

[0037] (1) Characteristics of strain FEN: When strain FEN is inoculated into inorganic salt solid medium and cultured at 30℃ for 24-36h, the colonies are milky white, with irregular edges, opaque, easy to pick up, and Gram staining negative.

[0038] (2) 16S rRNA sequence analysis of strain FEN

[0039] DNA from strain FEN was extracted and purified using the Ezup column-based bacterial genomic DNA extraction kit and stored at 4°C. The purified DNA was amplified by PCR using universal primers for bacteria: 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCTTGTTACGACTT). The PCR reaction program was set as follows: 94°C pre-denaturation for 4 min, followed by 94°C denaturation for 45 s, 55°C annealing for 45 s, and 72°C extension for 1 min, for 30 cycles, and a final 72°C repair extension for 10 min. The PCR product was purified and recovered, and then sequenced (Zhejiang Tianke High-Tech Development Co., Ltd. (formerly Zhejiang Institute of Microbiology)). The 16S rRNA sequencing results (nucleotides as shown in SEQ ID NO.1) were uploaded to NCBI, obtaining accession number OQ690630. This sequence was also compared with gene sequences in the NCBI database using BLAST. It was found to belong to the genus *Stenotrophomonas*, and showed 99% homology with *Stenotrophomonaspanacihumi* strain MK06, *Stenotrophomonas rhizophila* strain e-p10, and *Stenotrophomonas bentonitica* strain BII-R7. Ten representative *Stenotrophomonas* strains were selected from the results, and a phylogenetic tree was constructed using MEGA 7.0 software based on 16S rRNA gene sequence homology. Figure 2 .

[0040] 16S rRNA:

[0041]

[0042]

[0043] (3) The ability of strain FEN to utilize 63 carbon sources on bioMérieux GN card.

[0044] The metabolic activity of strain FEN for 63 different carbon sources was investigated using a bioMérieux automated identification system (contracted to Zhejiang Tianke High-Tech Development Co., Ltd. (formerly Zhejiang Institute of Microbiology)). The identification results are shown in Table 1. Using the VITEK biochemical reaction system, strain FEN showed strong utilization of 12 carbon sources, but could not utilize the other 51 carbon sources.

[0045] Based on strain characteristics, genetic distance, and 16S rRNA sequence comparison, strain FEN was identified as Stenotrophomonas maltophilia and named Stenotrophomonas maltophilia FEN. It is deposited at the China Center for Type Culture Collection (CCTCC), accession number: CCTCC M:2023363, deposit date: March 20, 2023, address: Wuhan University, Wuhan, China, 430072, China.

[0046] Table 1. Biochemical reaction results of strain FEN using the VITEK automated identification system (GN card) from bioMérieux.

[0047]

[0048]

[0049] Note: + indicates a positive reaction; - indicates a negative reaction.

[0050] Example 2: Obtaining resting cells of Stenotrophomonas maltophilia FEN

[0051] 1. Slant culture

[0052] Stenotrophomonas maltophilia FEN was inoculated into an inorganic salt culture medium and cultured at 30°C and 160 rpm for 24–36 h. The activated bacteria were then streaked onto inorganic salt solid plates and incubated at 30°C. Single colonies were taken and streaked again to test the purity of the bacteria. The bacteria were then stored in inorganic salt solid test tube slants at 4°C using standard procedures.

[0053] 2. Expand training

[0054] The slant cells from step 1 were inoculated into an inorganic salt culture medium and cultured at 30°C and 160 rpm for 24–36 h to obtain an expanded culture medium. The cells were centrifuged, and the wet cells were collected and washed with an inorganic salt culture medium to obtain resting Stenotrophomonas maltophilia FEN cells.

[0055] Example 3: Degradation performance of Stenotrophomonas maltophilia FEN on different concentrations of 3-methylindole.

[0056] Inorganic salt culture medium was dispensed into 300 mL shake flasks (100 mL per flask) and sterilized at 121°C for 20 min. After sterilization, the flasks were left at room temperature for 2 days to confirm the absence of bacterial growth. Resting cells obtained in Example 2 were added to a final concentration of 50 mg / L (based on cell dry weight). Then, 3-methylindole was added as a carbon source to a concentration of 80 mg / L. The shake flasks were sealed and incubated at 30°C and 160 rpm on a shaker. A blank control without bacteria was also included. The concentration of residual 3-methylindole in the shake flasks was periodically measured using high-performance liquid chromatography (HPLC) as described in Example 1. A removal rate curve of 3-methylindole concentration over time was plotted for the presence of strain FEN. The results are shown in [Figure 1]. Figure 4 The removal rate curve of 3-methylindole concentration over time in the blank control (without strain FEN) is shown in the figure. Figure 5 As shown in the figure. The results indicate that strain FEN can rapidly degrade all added substrates when the concentration of 3-methylindole is below 80 mg / L.

[0057] Although the present invention has been disclosed above with reference to embodiments, it is not intended to limit the scope of protection of the present invention. Any modifications and refinements made by those skilled in the art without departing from the concept and scope of the present invention shall fall within the scope of protection of the present invention.

Claims

1. Stenotrophomonas maltophilia FEN, deposited at China Center for Type Culture Collection, accession number: CCTCC NO:M 2023363, deposit date: March 20, 2023, address: Wuhan University, Wuhan, China 430072.

2. The use of Stenotrophomonas maltophilia FEN as described in claim 1 in the degradation of 3-methylindole.

3. The application as described in claim 2, characterized in that, The application involves adding resting cells obtained from the expanded culture of Stenotrophomonas maltophilia FEN to an inorganic salt culture medium containing 3-methylindole at pH 6-8, and culturing at 25-35℃ to achieve the degradation of 3-methylindole.

4. The application as described in claim 3, characterized in that, In the inorganic salt culture medium, the amount of resting cells added is 20-80 mg / L based on the dry weight of the cells.

5. The application as described in claim 3, characterized in that, The initial concentration of 3-methylindole in the inorganic salt culture medium is 50-150 mg / L.

6. The application as described in claim 3, characterized in that, The inorganic salt culture medium consists of: K2HPO4·3H2O 1.0 g / L, KH2PO4 0.02 g / L, CaCl2 0.05 g / L, MgCl2 0.5 g / L, FeCl2 0.01 g / L, (NH4)2SO4 1.0 g / L, and NaCl 5.0 g / L, with deionized water as the solvent.

7. The application as described in claim 3, characterized in that, The resting cells of Stenotrophomonas maltophilia FEN were prepared according to the following steps: (1) Slant culture: Stenotrophomonas maltophilia FEN was inoculated onto an inorganic salt solid medium and cultured at 30°C for 24–36 h to obtain slant cells. The final concentration of the inorganic salt solid medium was: K₂HPO₄·3H₂O 1.0 g / L, KH₂PO₄ 0.02 g / L, CaCl₂ 0.05 g / L, MgCl₂ 0.5 g / L, FeCl₂ 0.01 g / L, (NH₄)₂SO₄ 1.0 g / L, NaCl 5.0 g / L, agar 18–20 g / L, deionized water as solvent, pH 6–8. (2) Expanded cultivation: Pick up the slant cells obtained in step (1) with an inoculation loop and inoculate them into an inorganic salt culture medium. Incubate at 30°C for 24-36 h to obtain an expanded culture medium. Centrifuge, collect the wet cells, wash with inorganic salt culture medium, and obtain resting cells of Stenotrophomonas maltophilia FEN.

Images