Engineered bacteria capable of increasing the yield of antigen polysaccharide-protein bioconjugate products and uses thereof

Abstract

The application discloses an engineering bacterium capable of improving the yield of an antigen polysaccharide-protein bio-coupling product, which takes Escherichia coli as a starting strain, and knocks out a yfdGHI gene cluster on the genome of the Escherichia coli, wherein the nucleotide sequence of the yfdGHI gene cluster is shown as SEQ ID NO. 25. An expression plasmid containing genes for expressing glycosyltransferase and substrate protein is introduced into the engineering strain, and the biosynthesis of a polysaccharide binding vaccine is carried out by using the strain, so that the yield of the antigen polysaccharide-protein bio-coupling product can be effectively improved. Moreover, the beneficial effect of the yfdGHI gene cluster is verified in different engineering strains.

Description

Technical Field

[0001] This application relates to the field of genetic engineering technology, specifically to engineered bacteria capable of increasing the yield of antigen polysaccharide-protein bioconjugates and their applications. Background Technology

[0002] In recent years, with the continuous analysis of bacterial protein glycosylation systems, a biological method for preparing polysaccharide conjugate vaccines, known as protein-glycan coupling technologies (PGCT), has gradually replaced chemical cross-linking methods as a new and popular research area. The production of biological conjugate vaccines requires four key components: glycosyl engineered strains, glycosyltransferases, glycan expression gene clusters, and substrate proteins. Based on the different glycosyltransferases, biological production of polysaccharide conjugate vaccines is mainly divided into two categories: N-glycosylated conjugate vaccines based on the N-oligosaccharide transferase PglB from Campylobacter jejuni, and O-glycosylated conjugate vaccines based on the O-oligosaccharide transferase PglL from Neisseria meningitidis. This method involves the biocatalytic coupling of recombinantly expressed polysaccharides with proteins using glycosyltransferases in bacterial host cells. Compared to chemical cross-linking methods, the main advantage of PGCT is that in vivo conjugation can complete the production of glycoproteins in a single step. Only further purification is needed to obtain a relatively homogeneous final product, eliminating the cumbersome process of separately purifying the carrier protein and polysaccharide before further purification and cross-linking to obtain the final product. Therefore, its production cost for conjugate vaccines is lower, its scalability is stronger, and it requires fewer downstream purification steps, eliminating the need for repeated purification and quality control, making quality control more convenient. PglB is mainly used to develop biological conjugate vaccines containing HexNAc sugars at the reducing end, such as those for Shigella, Staphylococcus aureus, and extra-enteric pathogenic Escherichia coli (ExPEC). PglL, on the other hand, has more relaxed substrate specificity, capable of transferring almost any sugar from the undecenyl pyrophosphate carrier to the protein, thus overcoming the limitations of the Campylobacter jejuni N-linked glycosylation system.

[0003] On the other hand, with the rise of CRISPR gene editing technology, gene editing has become faster and more convenient. The rapid development and rise of synthetic biology technology has provided new ideas for the construction of glycosylation-engineered chassis cells. The development of microbial chassis is a key topic in the field of synthetic biology, providing a foundation for building cell factories with improved biomanufacturing efficiency. Escherichia coli, as a model strain for studying microbial genetics, physiology, and metabolism, has become one of the important chassis cells due to its diverse genetic manipulation tools and clear genetic background. Currently, the modification of E. coli is very extensive, including genome simplification and intracellular reconstruction of biosynthetic pathways for compound production. Intracellular reconstruction of biosynthetic pathways is the result of synergistic metabolic regulation at multiple levels, including gene expression, xenobiotic regulation, and post-translational modification, and has been widely used to optimize target pathways, enabling E. coli to controllably produce products that people need. Neuhard and Thomassen et al. were the first to perform glycosylation engineering on E. coli; they deleted the O antigen and CPS gene cluster of E. coli, constructing strain SO874. Furthermore, Perez et al. deleted waaL from the SO874 strain to construct strain SO874△waaL, while Feldman et al. also deleted waaL from the E. coli W3110 strain to construct strain CLM24. The O-antigen ligase WaaL transfers sugars to the lipid A core, competing with OST for surrounding LLO substrates. Deleting WaaL eliminates competition with exogenous glycosyltransferases, promoting the coupling of sugars and proteins. Additionally, Linton et al. deleted the initiating glycosyltransferase WecA from the W3110 strain, which is involved in the first biosynthetic step of the Enterobacterial Common Antigen (ECA) synthesis pathway and the E. coli O antigen synthesis pathway, to construct strain CLM37. The deletion of WecA eliminates the transfer of the reducing GlcNAc to Und-P, thereby preventing the assembly of Enterobacterial Common Antigen (ECA) and E. coli Endogenous O-antigen starting from GlcNAc residues. This ultimately facilitates the assembly of heterologously expressed glycosomes with their own reducing sugars. After a series of modifications, E. coli has increased the ability of UndPP, a protein glycosylation enzyme, to link sugar substrates and partially eliminates interference from endogenous sugars, resulting in a certain improvement in the yield of the final product. This technology has been widely applied in the field of PGCT. Summary of the Invention

[0004] In PGCT technology research, a series of experiments revealed that the deletion of a gene cluster, yfdGHI, can effectively improve the biosynthetic yield of the final product—the antigen polysaccharide-protein bioconjugate. This gene cluster, yfdGHI (yfdG, yfdH, yfdI), belongs to the O antigen side-chain modification gene cluster. It consists of yfdG glucose translocase, yfdH protein, and yfdI glucosyltransferase, with the nucleotide sequence shown in SEQ ID NO. 25. Before translocation via yfdG, yfdH transfers glucose from UDP glucose to undecylene pyrophosphate. Deletion of this gene cluster may release more undecylene pyrophosphate, which can be used for the synthesis of the target glycan chain, thus promoting the yield of the final product, the antigen polysaccharide-protein bioconjugate.

[0005] Therefore, the present invention provides an engineered bacterium that can increase the yield of antigen polysaccharide-protein bioconjugate products. The engineered bacterium is based on Escherichia coli and the yfdGHI gene cluster on the Escherichia coli genome is knocked out.

[0006] Furthermore, in order to eliminate the interference of background glycosyltransferases and enable carbohydrates and proteins to couple into glycoproteins under the action of exogenous glycosyltransferase PglL, thereby initially increasing the yield, the engineered bacteria also knocked out the waaL gene and / or wbbH-L gene cluster on the Escherichia coli genome.

[0007] The engineered bacteria also contain recombinant expression plasmids, which contain genes expressing glycosyltransferases and substrate proteins.

[0008] Specifically, the glycosyltransferase is PglL (nucleotide sequence as shown in SEQ ID NO. 22); the substrate protein is the SpyCatcher protein (nucleotide sequence as shown in SEQ ID NO. 21) with a modified glycosylation site. The vector containing the recombinant expression plasmid expressing the genes for the glycosyltransferase and the substrate protein is pET28a.

[0009] The engineered bacteria also contain a recombinant expression plasmid carrying a gene cluster for the synthesis of pathogenic bacterial surface polysaccharide antigens (nucleotide sequence shown in SEQ ID NO. 23). The vector for the recombinant expression plasmid carrying the gene cluster for the synthesis of pathogenic bacterial surface polysaccharide antigens is pACYC184.

[0010] Furthermore, the engineered bacteria are based on Escherichia coli W3110 as the starting strain.

[0011] The present invention also provides the application of the aforementioned engineered bacteria in the preparation of antigen polysaccharide-protein bioconjugate products.

[0012] Beneficial effects of the present invention

[0013] This invention constructed the W3110△waaL△wbbH-L△yfdGHI engineered strain, and transformed this strain with expression plasmids containing genes expressing glycosyltransferases and substrate proteins. Using this strain for the biosynthesis of polysaccharide conjugate vaccines, the yield of antigen-polysaccharide-protein bioconjugates was effectively increased. Furthermore, the beneficial effects of the yfdGHI gene cluster were verified in different engineered strains. Attached Figure Description

[0014] Figure 1 This image shows a comparison of SpyCatcher-KPO1 glycoprotein expression levels before and after the deletion of the yfdGHI gene cluster in chassis strain W3110△waaL△wbbH-L. "+" indicates strains without the yfdGHI gene cluster deletion, "-" indicates strains with the yfdGHI gene cluster deletion, and "M" represents MARKER.

[0015] Figure 2 To compare the expression levels of Spycatcher-KPO1 glycoprotein in chassis strains W3110△waaL△wbbH-L△yfdGHI and W3110△waaL△wbbH-L using grayscale analysis. Detailed Implementation

[0016] The present invention will be further described and illustrated below with reference to embodiments. However, the described embodiments are only a part of the embodiments of the present invention, and not all of them. Based on the present invention and the embodiments, all other inventions and embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0017] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0018] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0019] Example 1: Construction of the engineered strain W3110△waaL△wbbH-L△yfdGHI

[0020] (1) Preparation of the W3110△waaL engineered strain: Escherichia coli W3110 was used as the starting strain. W3110 is a commonly used experimental strain and can be obtained commercially. Deleting the waaL gene in the W3110 strain is the most common strategy in PGCT technology, and can be obtained using point mutation, Red recombination, CRISPR-Cas9, and other biotechnologies. waaL is an O-antigen ligase responsible for transferring sugar chains to the lipid A-core in E. coli. Deleting waaL eliminates competition with the subsequently knocked-in glycosyltransferase PglL, allowing sugars and proteins to couple into glycoproteins under the action of PglL. In this embodiment, the waaL gene was deleted using CRISPR-Cas9 technology to obtain the W3110△waaL engineered strain.

[0021] (2) Recombinant preparation of strain W3110△waaL△wbbH-L: Deletion of the wbbH-L gene cluster involved in the synthesis of OPS in E. coli can increase the yield of heterologously expressed glycans. While heterologously expressing the target glycan, host cells often express many other glycan structures. These non-target glycan synthesis pathways can interfere with the synthesis and assembly of the target polysaccharide antigen by competing for lipid carriers and activating monosaccharide substrates. Therefore, removing the non-essential glycan synthesis gene cluster from the chassis cells will facilitate the correct and efficient expression of the target polysaccharide antigen. The wbbH-L gene cluster was knocked out in the W3110△waaL engineered strain using CRISPR-Cas9 and other biotechnologies to obtain the W3110△waaL△wbbH-L strain.

[0022] (3) Preparation of the engineered strain W3110△waaL△wbbH-L△yfdGHI:

[0023] The yfdGHI gene cluster was knocked out in the engineered strain W3110△waaL△wbbH-L using the CRISPR-Cas9 method, including the following steps:

[0024] 3.1. Fabrication of electrocompetent states

[0025] The target strain W3110△waaL△wbbH-L was cultured at 37℃ and 200 rpm until the OD600 reached approximately 0.8. The cells were washed three times with 10% glycerol and then resuspended in 10% glycerol to obtain the prepared W3110△waaL△wbbH-L competent cells, which were then cryopreserved at -80℃ for later use. The pCas plasmid (commercially available) was electroporated into the competent cells (1.8 kV, 4.5 mS). After thawing for 1 hour, the cells were plated on Kan-resistant LB agar plates and incubated overnight at 30℃. The next day, single colonies were picked. After verifying successful plasmid transfer using the verification primers pCas-U (nucleotide sequence shown in SEQ ID NO. 3) and pCas-D (nucleotide sequence shown in SEQ ID NO. 4), single colonies were picked and inoculated into 5 mL of liquid LB medium, and incubated overnight at 30℃ and 200 rpm. The following day, the cells were seeded into 50 mL of liquid LB medium at a volume ratio of 1:100 and cultured at 30°C and 200 rpm until OD600 reached approximately 0.5. Then, arabinose was added to a final concentration of 10 mmol / L, and the cells were cultured further until OD600 reached approximately 0.8. The cells were washed three times with 10% glycerol and finally resuspended in 10% glycerol. This yielded the prepared W3110ΔwaaLΔwbbH-L / pCas competent cells, which should be cryopreserved at -80°C for later use.

[0026] 3.2. Design of sgRNA sequences

[0027] The gene cluster to be deleted, yfdGHI (nucleotide sequence as shown in SEQ ID NO.25), was entered into the N20 design website http: / / crispor.tefor.net / . A high-scoring N20 sequence (TTACTGAATATCTTGATGCT) was selected to design primers W3110-yfdGHI-N20 (nucleotide sequence as shown in SEQ ID NO.12) and ptf-R (nucleotide sequence as shown in SEQ ID NO.5).

[0028] 3.3. Construct the pTargetF-yfdGHI plasmid.

[0029] Using plasmid pTargetF as a template, PCR amplification was performed using primers W3110-yfdGHI-N20 and ptf-R. After gel extraction, the obtained linear DNA fragments were ligated into circular fragments. The ligation product was transformed into DH5α competent cells, incubated at 37°C and 220 rpm for 1 hour, and then plated on spectinomycin (Spc) resistant LB plates and incubated overnight at 37°C. The next day, single clones were picked and amplified using primers gRNA-U (nucleotide sequence as shown in SEQ ID NO.1) / N20-D (nucleotide sequence as shown in SEQ ID NO.2), followed by sequencing to verify successful plasmid construction. After verification, the bacterial strain was preserved, and the pTargetF-yfdGHI plasmid was extracted using a plasmid miniprep kit (Tiangen) and stored at -20°C for later use.

[0030] 3.4. Constructing the homologous arms AB

[0031] Using the genome of *E. coli* strain W3110 as a template, homologous arms A (nucleotide sequence as shown in SEQ ID NO. 6), B (nucleotide sequence as shown in SEQ ID NO. 7), C (nucleotide sequence as shown in SEQ ID NO. 8), and D (nucleotide sequence as shown in SEQ ID NO. 9) were amplified using primers yfdGHI-AF (nucleotide sequence as shown in SEQ ID NO. 6), yfdGHI-AR (nucleotide sequence as shown in SEQ ID NO. 7), yfdGHI-BF (nucleotide sequence as shown in SEQ ID NO. 8), and yfdGHI-BR (nucleotide sequence as shown in SEQ ID NO. 9), respectively. After gel extraction and recovery, DNA fragments A and B were ligated using a ligation kit. The ligation product was then used as a template to amplify homologous arms AB using primers yfdGHI-AF / yfdGHI-BR. After gel extraction and recovery, the amplified arms were stored at -20°C for later use.

[0032] 3.5. Deletion of the yfdGHI gene cluster

[0033] 400 ng of homologous arm AB and 100 ng of pTargetF-yfdGHI plasmid were simultaneously electroporated (1.8 kV, 4.0 ms) into W3110△waaL△wbbH-L / pCas competent cells. The cells were incubated at 30°C and 200 rpm for 1 h, then plated on Kan / Spc antibiotic plates and cultured overnight at 30°C. The next day, single clones were picked and verified by PCR using primers yfdGHI-checkF1 (nucleotide sequence shown in SEQ ID NO. 10) and yfdGHI-checkR1 (nucleotide sequence shown in SEQ ID NO. 11). Sequencing confirmed the deletion of the yfdGHI gene cluster. This strain carried pCas and pTargetF plasmids and was named W3110△waaL△wbbH-L△yfdGHI / pCas+pTargetF-yfdGHI.

[0034] 3.6. Removal of pTargetF-yfdGHI plasmid and pCas plasmid

[0035] The W3110△waaL△wbbH-L△yfdGHI / pCas+pTargetF-yfdGHI strain was cultured at 30℃ and 220rpm on a shaker until the OD600 reached approximately 0.5. Then, 5μL of IPTG (1mol / L) was added to induce the removal of the pTargetF-yfdGHI plasmid. The next day, the strain was streaked onto Kan resistant plates and incubated overnight at 30℃. After sorting out single clones, they were spotted onto both Kan resistant and Kan / Spc resistant plates. The strain that lost the pTargetF-yfdGHI plasmid grew on Kan resistant plates but not on Kan / Spc resistant plates. Strains that grew on Kan resistant plates but not on Kan / Spc resistant plates were selected; these strains contained only the pCas plasmid. The W3110△waaL△wbbH-L△yfdGHI / pCas strain was then cultured overnight at 42℃ and 220rpm on a shaker. Remove the temperature-sensitive pCas plasmid, streak onto antibiotic-free plates the next day, incubate overnight at 37°C, and sort out single clones. Then, spot-streak onto both antibiotic-resistant and antibiotic-free plates. Strains that have had their pCas plasmid removed will grow on antibiotic-free plates but not on antibiotic-resistant plates. Maintain the correct strain W3110△waaL△wbbH-L△yfdGHI.

[0036] Example 2: The engineered strain W3110△waaL△wbbH-L△yfdGHI can increase the yield of biosynthesized antigen polysaccharide-protein bioconjugate products.

[0037] Using genomic DNA from Klebsiella pneumoniae O1 strain as a template, high-fidelity PCR amplification of the polysaccharide synthesis gene cluster (nucleotide sequence as shown in SEQ ID NO. 13) was performed using specific amplification primers targeting the O antigen polysaccharide synthesis genome: wbby-F (nucleotide sequence as shown in SEQ ID NO. 13) / wbbY-R (nucleotide sequence as shown in SEQ ID NO. 14), wzy-F (nucleotide sequence as shown in SEQ ID NO. 17) / glf-R (nucleotide sequence as shown in SEQ ID NO. 18), wbbN-F (nucleotide sequence as shown in SEQ ID NO. 19) / wbbO-R (nucleotide sequence as shown in SEQ ID NO. 20). The vector pACYC184 was also amplified by PCR using primers ori-F (nucleotide sequence as shown in SEQ ID NO. 15) / ori-R (nucleotide sequence as shown in SEQ ID NO. 16). GoldenGate adapters (GGTCTCA) were added to each primer, and all fragments were ligated into a circular plasmid using the GoldenGate method to construct the expression vector pACYC184-KPO1 for the polysaccharide antigen. Using electroporation, plasmids pACYC184-KPO1, containing the gene cluster for synthesizing the surface polysaccharide antigen of pathogenic bacteria (Klebsiella pneumoniae O1), and pET28a-SC (prepared and preserved in our laboratory), containing the glycosyltransferase PglL (nucleotide sequence shown in SEQ ID NO. 22) and the recombinant protein SpaCather4573 (nucleotide sequence shown in SEQ ID NO. 21) fused with a glycosylation recognition site, were transformed into strains before and after yfdGHI deletion (W3110△waaL△wbbH-L and W3110△waaL△wbbH-L△yfdGHI). Expression was induced using IPTG according to standard methods. Western blotting was performed using an anti-His antibody to verify the synthesis of the antigen polysaccharide-protein bioconjugate. The Coomassie assay was used to check whether the loading amounts were the same. Results are shown below. Figure 1 As shown, under the same sample loading amount, the lane of strain W3110△waaL△wbbH-L△yfdGHI / KPO1 expressing SC-KPO1 glycoprotein was significantly darker in color than that of strain W3110△waaL△wbbH-L / KPO1 expressing SC-KPO1 glycoprotein. The darker the lane color, the higher the protein content. This suggests that in bacterial cultures with the same OD value, strain W3110△waaL△wbbH-L△yfdGHI has a higher glycoprotein expression level than strain W3110△waaL△wbbH-L.

[0038] Simultaneously, image grayscale scanning was used to quantitatively analyze the proportion of expression level differences, and the results are as follows: Figure 2 The results showed that deletion of the yfdGHI gene cluster could increase the yield of biosynthesized antigen polysaccharide-protein bioconjugates.

Claims

1. An engineered bacterium capable of increasing the yield of an antigen-polysaccharide-protein bioconjugate, characterized in that, The engineered bacteria uses Escherichia coli as the starting strain and knocks out the yfdGHI gene cluster on the E. coli genome. The nucleotide sequence of the yfdGHI gene cluster is shown in SEQ ID NO.

25. The engineered bacteria contains a recombinant expression plasmid, which contains genes that overexpress glycosyltransferase and substrate protein. The engineered bacteria also had the waaL gene and wbbH-L gene cluster knocked out in the Escherichia coli genome; The vector for the recombinant expression plasmid containing the gene overexpressing glycosyltransferase and substrate protein is pET28a.

2. The engineered bacteria according to claim 1, capable of increasing the yield of antigen polysaccharide-protein bioconjugate products, is characterized in that, The glycosyltransferase is PglL; and / or the substrate protein is a SpyCatcher protein modified with glycosylation sites.

3. The engineered bacteria according to claim 2, capable of increasing the yield of antigen polysaccharide-protein bioconjugate products, is characterized in that... The nucleotide sequence of the glycosyltransferase PglL is shown in SEQ ID NO.22; and / or, the nucleotide sequence of the SpyCatcher protein carrying the modified glycosylation site is shown in SEQ ID NO.

21.

4. The engineered bacteria according to claim 1, capable of increasing the yield of antigen polysaccharide-protein bioconjugate products, is characterized in that, The engineered bacteria also contain a recombinant expression plasmid carrying a gene cluster for synthesizing surface polysaccharide antigens of pathogenic bacteria.

5. The engineered bacteria according to claim 4, capable of increasing the yield of antigen polysaccharide-protein bioconjugate products, characterized in that, The vector of the recombinant expression plasmid containing the pathogenic bacterial surface polysaccharide antigen synthesis gene cluster is pACYC184, and / or the nucleotide sequence of the polysaccharide antigen synthesis gene cluster is shown in SEQ ID NO.

23.

6. The engineered bacteria according to claim 1, capable of increasing the yield of antigen polysaccharide-protein bioconjugate products, is characterized in that, The starting strain was Escherichia coli W3110.

7. The use of the engineered bacteria according to any one of claims 1-6, which can increase the yield of antigen polysaccharide-protein bioconjugate products, in the preparation of antigen polysaccharide-protein bioconjugate products.

Images