A mouse colon cancer sotorasib drug-resistant cell line, and a preparation method and application thereof

Abstract

The present application relates to a kind of mouse colon cancer sotorasib drug-resistant cell strains and preparation method and application, belong to biological medicine technical field.The present application provides a kind of mouse colon cancer sotorasib drug-resistant cell strains and its construction method;Drug-resistant cell strains have been preserved in China typical culture collection on December 27, 2022, and the preservation number is CCTCC NO:C2022377.By the present application, the molecular mechanism of tumor to sotorasib drug resistance and the method for reversing drug resistance and screening other antitumor drugs are provided Researchable biological materials;It has high scientific research and clinical application value.

Description

Technical Field

[0001] This invention relates to a sotorasidib-resistant mouse colon cancer cell line, its preparation method, and its application, belonging to the field of biomedical technology. Background Technology

[0002] Colorectal cancer causes 900,000 deaths globally each year, making it the fourth leading cause of cancer death worldwide. In China, colorectal cancer ranks second among all cancers, and its incidence is increasing annually. Gene mutations are a crucial initiating factor in colorectal cancer development, primarily involving mutations in oncogenes (RAS, RAF) and tumor suppressor genes (APC, p53, etc.). There are three variants of RAS, with KRAS (Kirsten-RAS) mutations being the most common. The KRAS gene mutation rate is as high as 35%-45% in colorectal cancer patients, with the most prevalent mutations occurring in codons 12 and 13 of exon 2. KRAS G12C mutations account for approximately 11% of KRAS mutations. This mutation impairs GTPase activity, leading to continuous activation of the RAS protein, which in turn activates downstream targets including MEK, ERK, and AKT, causing cell proliferation, differentiation, and ultimately tumor formation. However, due to the smooth structure of the KRAS protein and the lack of obvious binding sites, it is difficult to synthesize a compound that can specifically target and inhibit its activity.

[0003] Recently, a small molecule compound, sotorasib (AMG510), has been successfully developed. Sotorasib can "lock" the KRAS G12C mutant in an inactive conformation, thereby effectively inhibiting KRAS G12C-mutant tumors. A global phase II clinical trial showed that in patients with KRAS G12C-mutant colorectal cancer, sotorasib achieved a treatment control rate of 73%, but the response rate was only 9.7%. This indicates a high rate of resistance to sotorasib in colorectal cancer, limiting patient benefit. Therefore, exploring the resistance mechanism of sotorasib in KRAS G12C-mutant colorectal cancer and developing synergistic strategies are of significant clinical importance. Currently, there are no mouse cells with KRAS G12C mutations, nor are there mouse colorectal cancer cell lines or drug-resistant animal models resistant to sotorasib. Furthermore, methods for constructing drug-resistant tumor cell lines urgently need improvement. Summary of the Invention

[0004] The purpose of this invention is to solve the technical problem of how to obtain sotorazib-resistant mouse colon cancer cell lines and their applications.

[0005] To address the aforementioned problems, the present invention provides a sotoprazib-resistant mouse colon cancer cell line. This resistant cell line was deposited at the China Center for Type Culture Collection on December 27, 2022, with the culture name CT26-KRAS G12C / AR, a sotoprazib-resistant mouse colon cancer mutant cell line, and the accession number C2022377.

[0006] Preferably, the drug-resistant cell line is the KRASG12C-mutated mouse colon cancer cell line CT26, which can still grow rapidly after 6 months of stimulation with 2 μM sotorasidib.

[0007] Preferably, the maximum resistance concentration of sotorasidib in the drug-resistant cell line is 6.2 μM.

[0008] This invention provides a method for constructing a sotoraraciba-resistant mouse colon cancer cell line, comprising the following steps:

[0009] Step 1: Take the mouse colon cancer cell line CT26 and perform CRISPR / Cas9 gene editing to edit the original KRASG12D mutation into a G12C mutation, and name it CT26-KRAS G12C cell;

[0010] Step 2: Resuscitate CT26-KRAS G12C cells and culture them in DMEM containing 10% FBS in a 37°C, 5% CO2 incubator until the logarithmic growth phase;

[0011] Step 3: Take the CT26-KRAS G12C mouse colon cancer cell line in the logarithmic growth phase, add 5 μM sotoprazib to the culture medium for high-concentration shock screening, and passage or change the medium as appropriate; after 2 months of culture, reduce the concentration of sotoprazib to 0.5 μM, and increase the drug concentration by 0.2 μM every 2 weeks until the mouse colon cancer cell line CT26-KRAS G12C that can still grow rapidly at 2 μM or higher is screened, which is the sotoprazib-resistant mouse colon cancer cell line.

[0012] This invention provides the application of a mouse colon cancer sotoprazib-resistant cell line in the preparation or screening of antitumor drugs.

[0013] This invention provides the application of a mouse colon cancer sotorasibride-resistant cell line in the preparation of a detection kit for evaluating the therapeutic effect of antitumor drugs.

[0014] This invention provides the application of a mouse colon cancer sotorasidib-resistant cell line in non-diagnostic and non-therapeutic methods.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] This invention provides a valuable biological material for studying the molecular mechanisms of sotoprazib resistance in tumors, methods for reversing resistance, and screening other antitumor drugs. It also enables the screening of tumor markers for sotoprazib resistance and the screening and evaluation of novel antitumor drugs, thus possessing high scientific research and clinical application value.

[0017] Preservation Information

[0018] On December 27, 2022, the culture was deposited at the China Center for Type Culture Collection (CCTCC). The address of CTCC is: Wuhan University Collection Center, No. 299 Bayi Road, Wuchang District, Wuhan, Hubei Province, 430072, China. The culture name is CT26-KRAS G12C / AR mouse colon cancer mutant cells resistant to sotoporacitabine, and the accession number is CCTCC NO: C2022377. Attached Figure Description

[0019] Figure 1 The graph shows the IC50 values ​​of sotoraraciib in inhibiting CT26, CT26-KRAS G12C, and CT26-KRAS G12C / AR cells, respectively.

[0020] Figure 2 This is a sequencing result of the cds region of the KRAS gene in CT26-KRAS G12C and CT26-KRAS G12C / AR cells.

[0021] Figure 3 These are cell morphology images of CT26-KRAS G12C and CT26-KRAS G12C / AR cells under an optical microscope.

[0022] Figure 4 The image shows the effect of CT26-KRAS G12C and CT26-KRAS G12C / AR cells being inoculated into Balb / c mice and treated with sotorasidib (50 mg / kg / day) for 14 days.

[0023] Figure 5 These are Western blot images of proteins from CT26-KRAS G12C and CT26-KRAS G12C / AR cells. Detailed Implementation

[0024] To make the present invention more apparent and understandable, preferred embodiments are described in detail below with reference to the accompanying drawings:

[0025] like Figure 1-5As shown, this invention provides a sotoprazib-resistant mouse colon cancer cell line. The resistant cell line was deposited at the China Center for Type Culture Collection on December 27, 2022. The culture name is CT26-KRAS G12C / AR mouse colon cancer mutant cells resistant to sotoprazib, and the accession number is CCTCC NO:C2022377.

[0026] The purpose of this invention is to provide a sotorasibel-resistant KRAS G12C mutant mouse colon cancer cell line, its preparation method, and its application. To achieve the above objective, this invention provides a sotorasibel-resistant KRAS G12C mutant mouse colon cancer cell line, named CT26-KRAS G12C / AR mouse colon cancer cell line. The resistant cell line is the CT26 cell line, a KRAS G12C mutant mouse colon cancer cell line that continues to grow rapidly after 6 months of stimulation with 2 μM sotorasibel. The maximum resistance concentration of sotorasibel to the KRAS G12C mutant mouse colon cancer cell line is 6.2 μM.

[0027] The present invention provides a method for constructing a sotoprazib-resistant KRAS G12C mutant mouse colon cancer cell line as follows:

[0028] 1. The mouse colon cancer cell line CT26 was used for CRISPR / Cas9 gene editing, changing the original KRAS G12D mutation to a G12C mutation, and named CT26-KRAS G12C cells.

[0029] 2. Resuscitate CT26-KRAS G12C cells and culture them in DMEM containing 10% FBS in a 37°C, 5% CO2 incubator until the logarithmic growth phase;

[0030] 3. Take the CT26-KRAS G12C mouse colon cancer cell line in the logarithmic growth phase, add 5 μM sotorasid to the culture medium for high-concentration shock screening, and passage or change the medium as appropriate; after 2 months of culture, reduce the concentration of sotorasid to 0.5 μM, and increase the drug concentration by 0.2 μM every 2 weeks until the mouse colon cancer cell line CT26-KRAS G12C that can still grow rapidly at 2 μM or higher is screened, which is the sotorasid resistant colon cancer cell line.

[0031] This invention provides the application of a mouse colon cancer sotoprazib-resistant cell line in the preparation or screening of antitumor drugs.

[0032] This invention provides the application of a mouse colon cancer sotorasibride-resistant cell line in the preparation of a detection kit for evaluating the therapeutic effect of antitumor drugs.

[0033] This invention provides the application of a mouse colon cancer sotorasidib-resistant cell line in non-diagnostic and non-therapeutic methods.

[0034] Example

[0035] The mouse colon cancer cells CT26 used in the examples were purchased from the Cell Bank of the Chinese Academy of Sciences and underwent CRISPR / Cas9 gene editing, changing the original KRAS G12D mutation to a G12C mutation. The sotorasib used in the examples was commercially available Sotorasib (AMG510) 25mg from Selleck Chemicals.

[0036] Example 1

[0037] Establishment of sottorazib-resistant mouse colon cancer cell line CT26-KRAS G12C / AR:

[0038] 1. The mouse colon cancer cell line CT26 was used for CRISPR / Cas9 gene editing, changing the original KRAS G12D mutation to a G12C mutation, and named CT26-KRAS G12C cells.

[0039] 2. Resuscitate CT26-KRAS G12C cells and culture them in DMEM containing 10% FBS in a 37°C, 5% CO2 incubator until the logarithmic growth phase;

[0040] 3. Take the CT26-KRAS G12C mouse colon cancer cell line in the logarithmic growth phase, add 5 μM sotorasid to the culture medium for high-concentration shock screening, and passage or change the medium as appropriate; after 2 months of culture, reduce the concentration of sotorasid to 0.5 μM, and increase the drug concentration by 0.2 μM every 2 weeks until the mouse colon cancer cell line CT26-KRAS G12C that can still grow rapidly at 2 μM or higher is screened, which is the sotorasid resistant mouse colon cancer cell line.

[0041] Example 2

[0042] IC50 values ​​of sottorazib for inhibiting mouse colon cancer cells CT26, CT26-KRAS G12C, and CT26-KRAS G12C / AR:

[0043] CT26, CT26-KRAS G12C, and CT26-KRAS G12C / AR were seeded in 96-well plates (3 x 10⁶ cells per well). 3 (cells), and added sotorrazib at different concentration gradients (10) over 24 hours. -5 -10 2After 96 hours, the cells were incubated with serum-free DMEM (containing 10% CCK8, purchased from Dojin Chemical Research Institute, Japan) at 37°C for 0.5 hours. The OD value of each well was then measured at 450 nm using a microplate reader, and the remaining cell viability was calculated. An IC50 curve was plotted using Prism 9 (Version 9.4.1) with drug concentration on the x-axis and remaining cell viability on the y-axis, and the IC50 value was calculated. Remaining cell viability (%) = [a(drug treatment) - b(control)] / [c(no drug treatment) - d(control)] * 100%.

[0044] Experimental results show (e.g.) Figure 1 As shown: Wild-type CT26 cells are KRAS G12D mutated, therefore sotoprazib has a very poor inhibitory effect on them, with an IC50 value of 27.39 μM; CT26-KRAS G12C cells are KRAS G12C mutated and can be targeted and inhibited by sotoprazib, with an IC50 value of 0.11 μM; The IC50 value of CT26-KRAS G12C / AR cells against sotoprazib is 6.20 μM, which is more than 50 times that of CT26-KRAS G12C cells. Therefore, CT26-KRAS G12C / AR cells can be considered resistant to sotoprazib and have value in studying sotoprazib-resistant KRAS G12C mutated colorectal cancer.

[0045] Example 3

[0046] Identification of KRAS mutation sites in CT26-KRAS G12C and CT26-KRAS G12C / AR:

[0047] Since sotorasidib targets and inhibits the KRAS protein mutated by KRAS G12C, and its inhibitory effect on resistant strains is weakened, sequencing is needed to identify whether the resistant strains still have the KRAS G12C mutation. CT26-KRAS G12C and CT26-KRAS G12C / AR were seeded in 10cm culture dishes and cultured in DMEM containing 10% FBS at 37°C and 5% CO2 until the cell density reached 80%. After discarding the culture medium, the cells were washed three times with PBS buffer at 4°C. Cells were scraped from the bottom of the culture dish using a cell scraper and collected, then sent to Suzhou Genewiz Biotechnology Co., Ltd. for DNA extraction, PCR amplification, and Sanger sequencing. The first primer sequence for PCR amplification was ATACCGCAAGGGTAGGTGTT, and the tail primer sequence was TAGTTGAGTTCTAGGCCGGTC.

[0048] Experimental results show (e.g.) Figure 2As shown in the figure: The CDS (Coding sequence) region of CT26-KRAS G12C cells and CT26-KRAS G12C / AR cells is C (Cycteine) from the ATG promoter sequence to the 12th amino acid. Therefore, it can be considered that the drug-resistant strain is still a KRAS G12C mutation after construction, and the drug resistance induction process does not change the KRAS genotype.

[0049] Example 4

[0050] Cell morphology of CT26-KRAS G12C and CT26-KRAS G12C / AR cells under an optical microscope:

[0051] CT26-KRAS G12C and CT26-KRAS G12C / AR were seeded in 10cm culture dishes and cultured in DMEM containing 10% FBS at 37℃ and 5% CO2 until the cell density reached 50%. After discarding the culture medium, the cells were washed three times with PBS buffer and their morphology was observed under an inverted microscope (100*). Cell morphology could be observed (e.g.) Figure 3 As shown, most CT26-KRAS G12C cells are spindle-shaped with numerous pseudopodia extending outwards. Most CT26-KRAS G12C / AR cells are polygonal with fewer pseudopodia.

[0052] Example 5

[0053] Balb / c mouse subcutaneous tumor model using CT26-KRAS G12C and CT26-KRAS G12C / AR cells:

[0054] Log-phase CT26-KRAS G12C and CT26-KRAS G12C / AR cells were seeded into the groin area of ​​12 six-week-old Balb / c mice (1*10⁻⁶ cells per cell). 7 (each individual). After 10 days, each group was randomly divided into a drug treatment group and a PBS group. The drug treatment group was given 50 mg / kg sotorasid via gavage daily, while the PBS group was given 100 μL of PBS via gavage daily. The tumor was removed after 14 days.

[0055] The results show (e.g.) Figure 4 As shown in the figure, the growth rate of CT26-KRAS G12C subcutaneous tumors is significantly slower than that of CT26-KRAS G12C / AR subcutaneous tumors; sotoraraxib has a significant therapeutic effect on CT26-KRAS G12C subcutaneous tumors, but a poor effect on CT26-KRAS G12C / AR subcutaneous tumors.

[0056] Example 6

[0057] Western blot images of CT26-KRAS G12C and CT26-KRAS G12C / AR cells:

[0058] Protein preparation: CT26-KRAS G12C and CT26-KRAS G12C / AR cells in logarithmic growth phase were seeded in 6cm culture dishes. When the cell density reached approximately 80%, all cells were scraped off using a cell scraper and transferred to 15mL centrifuge tubes. After centrifugation at 1000rpm, the supernatant was discarded. The cells were resuspended in PBS buffer and centrifuged at 1000rpm for 3 minutes, then the supernatant was discarded. 300µl of RIPA lysis buffer (purchased from Beyotime) was added, and the mixture was pipetted 50 times. The mixture was incubated at 4°C for 15 minutes, then centrifuged at 13500rpm for 15 minutes. Approximately 300µl of supernatant was aspirated, and 5*loading buffer was added. The mixture was then boiled in a 92°C metal bath for 15 minutes.

[0059] Rubber Mixture:

[0060]

[0061]

[0062] Insert a 15-hole comb into the concentrated glue and wait for the glue to solidify.

[0063] Prepare 5* SDS-PAGE electrophoresis buffer and 10* transfer buffer:

[0064]

[0065] Electrophoresis: Insert the prepared gel into the electrophoresis tank. Dilute 5*SDS-PAGE electrophoresis buffer with ddH2O to a final concentration of 1*SDS-PAGE electrophoresis buffer and add it to the electrophoresis tank. Remove the comb and add 10 μL of protein sample to each well. Run the stacking gel at a constant voltage of 70V. After the protein enters the separating gel, run the gel at 130V until it reaches the bottom.

[0066] Transfer: Using transfer clamps, hold the sponge pad, filter paper, gel, NC membrane (nitrocellulose membrane), filter paper, and sponge pad in sequence, and insert them into the electroporation cell. Place the white plate near the red positive electrode and the black plate near the black negative electrode. Transfer the membrane for 90 minutes in an ice bath at a constant current of 300mA. After transfer, seal the NC membrane in 5% BSA for 1 hour.

[0067] After blocking, rinse three times with TBST buffer for 30 seconds each time. Cut the band and incubate overnight in a shaker at 4°C with the primary antibody.

[0068]

[0069] After incubating the bands overnight with primary antibody, wash the bands three times in TBST buffer, 10 minutes each time. Dilute the secondary antibody (SA00001-1 / SA00001-2, Proteintech) at a ratio of 1:5000 with TBST buffer and incubate the bands at room temperature for 1 hour. Rinse three times with TBST buffer, 10 minutes each time. Expose and develop using ultrasensitive ECL chemiluminescence solution (Abbkine).

[0070] Result prompts (e.g.) Figure 5 As shown in the figure: CT26-KRAS G12C / AR cells showed increased expression of HIF1α, c-Kit, PD-L1, and Cyclin D2 proteins compared to CT26-KRAS G12C cells, suggesting that this may be related to the resistance of CT26-KRAS G12C / AR cells to sotoprazib in in vitro and in vivo models.

[0071] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any form or substance. It should be noted that those skilled in the art can make various improvements and additions without departing from the present invention, and these improvements and additions should also be considered within the scope of protection of the present invention. Any modifications, alterations, and equivalent changes made by those skilled in the art based on the above-disclosed technical content without departing from the spirit and scope of the present invention are equivalent embodiments of the present invention. Furthermore, any modifications, alterations, and evolutions made to the above embodiments based on the essential technology of the present invention still fall within the scope of the technical solution of the present invention.

Claims

1. A mouse colon cancer cell line resistant to sotoraraciba, characterized in that, The drug-resistant cell line was deposited at the China Center for Type Culture Collection on December 27, 2022. The culture name is CT26-KRAS G12C / AR mouse colon cancer mutant cells resistant to sotoprazib, and the accession number is CCTCC NO: C2022377.

2. The sotorasirb-resistant mouse colon cancer cell line according to claim 1, characterized in that, The drug-resistant cell line was the CT26 cell line, a mouse colon cancer cell line with KRAS G12C mutation, which could still grow rapidly after 6 months of stimulation with 2 μM sotorasidib.

3. The sotorasidib-resistant mouse colon cancer cell line according to claim 1, characterized in that, The maximum resistance concentration of sotorasidib in the drug-resistant cell line was 6.2 μM.

Images