SFTSV chimeric attenuated strain and application thereof

Abstract

The application belongs to the technical field of biology and specifically relates to a SFTSV chimeric attenuated strain, nucleotide sequences of S, M and L segments of the SFTSV chimeric attenuated strain are respectively GenBank sequence numbers KR698324, KR698337 and KR698350, and the application further provides application of the SFTSV chimeric attenuated strain in preparation of a SFTSV attenuated vaccine. ‑ / ‑ The strain is obtained through a genetic process and is a STFSV chimeric attenuated strain rNB24, the strain is weaker than other gene strains in pathogenicity on a C57BL / 6 mouse model, has obvious attenuated characteristics, has good immunogenicity, antibodies induced by the strain can resist infection of a fever with thrombocytopenia syndrome virus, has good protection, and can be used as an attenuated vaccine for subsequent clinical research and application.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a chimeric attenuated strain of fever with thrombocytopenia syndrome virus and its applications. Background Technology

[0002] Severe fever with thrombocytopenia syndrome virus (SFTSV) is a newly emerging hemorrhagic fever virus, with Haemaphysalis longicornis as the primary tick host. The main infected population is middle-aged and elderly individuals. Symptoms include high fever, loss of appetite, muscle pain, chills, swollen lymph nodes, decreased white blood cell count, and thrombocytopenia. Severe cases can lead to multiple organ failure, with a mortality rate of 13-30%. Currently, there are no effective vaccines or treatments.

[0003] However, with the increasing number of isolated and discovered strains, more and more chimeric strains have begun to emerge. However, the differences in virulence, pathogenicity, and immunogenicity among different genotype strains or chimeric strains are still unclear.

[0004] Due to the lack of specific drugs and vaccines, SFTS was listed as a priority disease for research by the World Health Organization (WHO) in 2017. Common vaccine types include inactivated vaccines, live attenuated vaccines, recombinant virus vaccines, protein vaccines, and DNA vaccines. Although there is currently research on these different types of vaccines for SFTSV, only some vaccine studies have shown some antiviral activity at the animal level. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a chimeric attenuated SFTSV strain with good immunogenicity and obvious attenuation characteristics, which can be used as an attenuated live vaccine for subsequent clinical research and application.

[0006] The technical solution of the present invention to solve the above-mentioned technical problems is as follows:

[0007] An SFTSV chimeric attenuated strain, wherein the GenBank sequence numbers of the nucleotide sequences of the S, M, and L fragments of the SFTSV chimeric attenuated strain are KR698324, KR698337, and KR698350, respectively.

[0008] Furthermore, the SFTSV chimeric attenuated strain has the following non-synonymous mutation: the 11th position of the NSs protein encoded by the S fragment is mutated from leucine to phenylalanine.

[0009] Furthermore, the S fragment of the SFTSV chimeric attenuated strain has undergone a C59T mutation, and the M fragment has undergone the following mutations: A10C, C30T, and T2598C.

[0010] This invention also provides the application of the above-mentioned SFTSV chimeric attenuated strain in the preparation of SFTSV attenuated vaccines.

[0011] Compared with existing technologies, the beneficial effects of this invention are as follows: The inventors obtained a chimeric attenuated STFSV strain rNB24 through genetic engineering, which exhibits similar growth characteristics to other genotype strains at the cellular level, can stably replicate in vitro at the cellular level, and can grow to a high titer in Vero cells. Experiments show that this strain can be used in IFNAR... - / - The C57BL / 6 mouse model showed weaker pathogenicity than other gene strains, exhibiting significant attenuation characteristics, and also possessed good immunogenicity. Immunization with the chimeric strain rNB24 10 days prior to IFNAR treatment was effective. - / - C57BL / 6 mice survived after being injected with a lethal dose of the C2(HBGS13) strain, suggesting that the antibody induced by the STFSV chimeric attenuated strain rNB24 of this invention can resist infection with fever with thrombocytopenia syndrome virus and has a good protective effect. It is predicted that it can be used as an attenuated vaccine for subsequent clinical research and application. Attached Figure Description

[0012] Figure 1 The characteristic results of the SFTSV chimeric attenuated strain rNB24 prepared in Example 1 of this invention are as follows: Figure 1 A represents the infectivity of supernatants collected from passage 0 (P0) to passage 7 (P7) by immunofluorescence detection. Anti-NS antibodies were used for P0-P2, and anti-NP antibodies were used for P3-P7. Figure 1 B represents the visualization of viral particles in cell culture supernatant using negative staining EM analysis. Figure 1 Image C obtained by TEM shows viral particles in the cytoplasm of infected Vero cells. A magnified image of the viral particles is shown on the right, with N, nucleus, C in the cytoplasm, and NM, nuclear membrane.

[0013] Figure 2 This is a phylogenetic tree of the SFTSV chimeric attenuated strain rNB24 prepared according to the present invention, wherein... Figure 2 A, 2B, and 2C are phylogenetic trees of the L, M, and S segments, respectively;

[0014] Figure 3 This is a one-step growth curve of different genotypes of SFTSV in Example 4 of the present invention.

[0015] Figure 4 IFNAR of different genotype SFTSV strains in Example 5 of this invention - / - C57BL / 6 mouse infection model, in which Figure 4A, 4B, 4C, and 4D represent IFNARs infected with HBGS13 (C2), HBMC5 (C3), WCH (C4), and rNB24 (C6 / J2 / J2), respectively. - / - Changes in body weight (left) and survival rate (right) of C57BL / 6 mice. Mice inoculated with PBS served as the control group. The body weight of mice on the day of infection (day 0) was set as 100%, and the body weights of mice on days 1-14 post-infection were compared with those of mice on day 0.

[0016] Figure 5 This is the C57BL / 6 infected mouse model in Example 6 of the present invention, wherein... Figure 5 A represents the determination of SFTSV load in the serum of infected mice. Figure 5 B represents IgM and IgG antibodies in the serum of infected mice. Figure 5 C represents neutralizing antibodies in the serum of infected mice.

[0017] Figure 6 This refers to the results of the cross-recognition ability of serum IgG antibodies of different genotypes in Example 7 of the present invention, wherein... Figure 6 A, 6B, 6C, and 6D represent the IgG antibody recognition efficacy of C2, C3, C4, and J type antibodies against different genotype SFTSV strain antigens, respectively.

[0018] Figure 7 This refers to the cross-neutralization results of serum from different genotypes in Example 7 of the present invention, wherein... Figure 7 A, 7B, 7C, and 7D represent the serum cross-neutralization results of C2, C3, C4, and J type antibodies against different genotypes of SFTSV strains, respectively.

[0019] Figure 8 The protective evaluation results of the SFTSV chimeric attenuated strain as an attenuated vaccine in Example 8 of this invention are as follows: Figure 8 A and 8B are respectively infected with 1TICD 50 and 10TICD 50 / IFNAR of mouse HBGS13(C2) - / - Changes in body weight (left) and survival rate (right) of C57BL / 6 mice. Detailed Implementation

[0020] The principles and features of the present invention are described below with reference to the accompanying drawings and specific embodiments. The examples given are only for explaining the present invention and are not intended to limit the scope of the present invention.

[0021] Cells, strains, plasmids, antibodies, and mice

[0022] Vero cells were purchased from the American Technology and Care Center (ATCC, ATCC numbers: CCL-81) and cultured in DMEM medium containing 10% FBS (Gibco, Grand Island, NY, USA) (Xinzongke, Wuhan). The construction method of BSR-T7 cells stably expressing T7 RNA polymerase and the T7 plasmid is described in the published article "Calcium channel blockers reduces evere fever with thrombocytopenia syndrome virus (SFTSV) related fatality." BSR-T7 cells stably expressing T7 RNA polymerase were cultured in DMEM medium supplemented with 10% FBS and 1 mg / mL G418 (Gibco, NY, USA) (Xinzongke, Wuhan). Both cell lines were grown in an incubator at 37°C and 5% CO2.

[0023] The SFTSV strains HBGS13 (genotype C2) and HBMC5 (genotype C3) were provided by the National Virus Resource Center (NVRC) (preservation numbers: HBGS13: CSTR: 16533.06IVCAS 6.6312; HBMC5: CSTR: 16533.06IVCAS 6.6311). The strain WCH-2011 / HN / China / isolate97 (genotype C4) (preservation number: CSTR: 16533.06.IVCAS 6.6088) was kindly provided by Professor Cao Wuchun of the State Key Laboratory of Pathogens and Biosafety, Beijing Institute of Microbiology and Epidemiology, and is preserved in the National Virus Resource Center (NVRC).

[0024] The full-length L, M, and S fragments (GenBank numbers: KR698324, KR698337, and KR698350) of the SFTSV strain NB24 / CHN / 2013 were synthesized by BGI Genomics and cloned into the T7 vector. The synthesized plasmids were named pT7-NB24-L, pT7-NB24-M, and pT7-NB24-S, respectively.

[0025] The expression plasmids pCAGGS-NP and pCAGGS-RdRp, which can express the NP and RdRp proteins of SFTSV, were constructed and preserved in our laboratory. The construction method can be found in the published article "Establishment of a Reverse Genetic System of Severe Fever with Thrombocytopenia Syndrome Virus Based on a C4 Strain".

[0026] Rabbit polyclonal antibodies recognizing SFTSV NSs and NP proteins were prepared and preserved in our laboratory. The preparation methods are described in the published articles "Isolation, characterization, and phylogenic analysis of three new severe fever with thrombocytopenia syndrome bunyavirus strains derived from Hubei Province, China" and "Disruption of type I interferon signaling by the nonstructural protein of severe fever with thrombocytopenia syndrome virus via the hijacking of STAT2 and STAT1 into inclusion bodies".

[0027] IFNAR - / - The C57BL / 6 mouse is a C57BL / 6 mouse lacking the type I interferon receptor, bred in our laboratory at the genetically engineered mouse breeding room of the Animal Experiment Center of the Wuhan Institute of Virology. C57BL / 6 mice are purchased uniformly from the Animal Experiment Center of the Wuhan Institute of Virology.

[0028] Example 1: Construction of STFSV chimeric attenuated strain rNB24

[0029] 1) Obtain the SFTSV-rNB24 strain using cDNA cloning.

[0030] BSR-T7 cells (12,000 cells / well) were pre-seeded in 12-well plates and incubated in DMEM medium containing 2% FBS at 37°C and 5% CO2. Before transfection, the cell culture medium was replaced with serum-free DMEM medium. Plasmids pCAGGS-NP (0.5 μg), pCAGGS-RdRp (0.5 μg), pT7-NB24-L (1 μg), pT7-NB24-M (1 μg), and pT7-NB24-S (1 μg) were mixed and transfected into the 12-well BSR-T7 cells using Lipofectamine™ 3000 transfection reagent (Invitrogen, Grand Island, NY, USA). After 4-6 hours, the supernatant was discarded, and the cells were replaced with 2% FBS DMEM medium and cultured for another 6 days at 37°C and 5% CO2. The culture supernatant was then harvested (Passage 0, P0), and half of the BSR-T7 cells from each well were transferred to a 12-well plate containing Vero cells (approximately 30% density) and 1 mL of fresh 10% FBS DMEM medium. The cells were incubated at 37°C for 12 h in a 5% CO2 incubator. After cell attachment, the medium was removed, and 1 mL of P0 culture supernatant was added. The cells were then infected at 37°C for 1 h in a 5% CO2 incubator. The supernatant was then replaced with 2 mL of fresh medium, and the cells were cultured at 37°C for 4–5 days (Passage 1, P1). The remaining P0 supernatant was centrifuged at 5000 rpm for 5 min, aliquoted, and stored at -80°C. The other half of the BSR-T7 cells from the original P0 wells were incubated at 37°C for 3 h. After cell reattachment, IFA analysis was performed to determine viral amplification by detecting the expression of SFTSV NSs or NP proteins. Subsequent passages were performed following the same procedure from P0 to P1. The cells were passaged a total of 8 times. After each passage, the supernatant was collected and aliquoted at -80°C for storage. The remaining cells were used for IFA detection of SFTSV-related protein expression.

[0031] 2) Immunofluorescence assay (IFA)

[0032] Cells were fixed with 4% paraformaldehyde (prepared in PBS) at room temperature for 10-20 min, followed by washing three times with PBS. Cells were then permeabilized with 0.2% Triton X-100 (prepared in PBS) at room temperature for 12-15 min, followed by washing five times with PBS. After blocking with 5% BSA (BioFrox, Germany) at 37°C for 1 hour, the supernatant was discarded, and the cells were incubated with the target primary antibody. To verify the expression of SFTSV NSs and NP proteins, polyclonal antibodies against SFTSV NPs (anti-NP) or NSs (anti-NSs) prepared in our laboratory were used as primary antibodies, diluted 1:1000 with 1% BSA (prepared in PBS). Incubate with primary antibody overnight at 4°C or for 2 hours at 37°C. After washing three times with PBS, incubate with FITC-labeled goat anti-rabbit fluorescent secondary antibody (ab150077; Abcam, Cambridge, UK), prepared with 1% BSA (diluted in PBS, 1:2000). Incubate at 37°C for 1-1.5 hours, then wash three times with PBS. Stain cell nuclei using a Hoechst 33258 (Beyotime, Shanghai, China) at room temperature for 5-10 minutes. After washing three times with PBS, cover cells with an appropriate amount of PBS, and then capture images using an inverted fluorescence microscope (ECLIPSE TE2000-S; Nikon, Japan) to observe protein expression.

[0033] The expression of SFTSV NSs or NP proteins in cells during the amplification process is as follows: Figure 1 As shown in Figure A, SFTSV NSs protein expression in transfected cells (P0) and passaged cells (P1-P2) was detected by IFA. The green fluorescence observed in P0 cells indicates that SFTSV RNA initiated transcription and replication, triggering NSs protein expression. IFA results in P1 and P2 cells showed an increased number of cells expressing NSs protein, indicating that viral particles were released and infected new cells. SFTSV NP expression was detected in subsequent passaged cells (P3, P5, and P7), indicating that all cells were infected and that the progeny virus had effectively proliferated.

[0034] 3) Virus particle purification and electron microscopy of cell sections

[0035] Virus particle purification: The SFTSV strain rNB24, obtained through genetic engineering, was used to infect Vero cells (density 30-50%) with an MOI of 1. Cell supernatant was collected 3-4 days after infection, and approximately 100 mL of cell supernatant was used for virus purification. β-propiolactone (1:2000) was added, and the virus was inactivated overnight at 4°C, followed by hydrolysis at 37°C for 1 h. Cell supernatant was centrifuged at 5000 rpm for 5 min to remove cell debris. The supernatant was then filtered through a 0.45 μm filter to remove large cell debris. The filtered cell supernatant was added to an SW28 ultrafiltration tube (approximately 26 mL / tube). Then, using a long-needle syringe, 10 mL of 10% sucrose solution (prepared with PBS and filtered through a 0.45 μm filter) was slowly injected into the bottom of the ultrafiltration tube by inserting the long needle into the tube. Centrifuge at 28,000 rpm for 3 h (4℃, SW28 rotor, Beckman). After centrifugation, discard the supernatant, resuspend the precipitate in 1 mL of sterile NTE (NaCl-Tris-Ethylenediaminetetraacetic acid buffer, pH=8), add to a 10-60% (w / v) discontinuous sucrose density gradient, centrifuge at 150,000 × g for 3 h (4℃, SW41 rotor, Beckman). Collect the solutions from different layers, take a small amount of the layered solution to determine the sucrose concentration of SFTSV by Western blot, dilute the layer containing SFTSV with NTE buffer (pH=8), and desugar by centrifugation at 28,000 rpm for 2 h (4℃, SW28 rotor, Beckman). Discard the supernatant, resuspend the precipitate in 100 μL of NTE buffer for subsequent negative staining experiments.

[0036] Negative staining and electron microscopy observation of virus particles: 20 μL of the virus suspension obtained above was dropped onto a sealing film. A copper mesh was immersed in the suspension for 5 min to absorb the liquid, and excess liquid was carefully absorbed from the sides of the mesh using filter paper. The copper mesh was then placed in ddH2O and immediately removed, with excess liquid again carefully absorbed from the sides using filter paper. Finally, the copper mesh was immersed in 20 μL of PTA for 1 min to stain, the PTA was absorbed with filter paper, and the mesh was air-dried. The results were observed under a 200 kV transmission electron microscope (Tecnai G220 TWIN, FEI, USA). Figure 1 As shown in Figure B, coated spherical particles with a diameter of 80-120 nm were observed.

[0037] Electron microscopy of cell sections: Vero cells at a density of approximately 70% were seeded in 33 mm diameter dishes and infected with 10 MOI rNB24 strain for 3 days. The supernatant was discarded, and the cells were fixed overnight at 4°C with 2.5% glutaraldehyde solution prepared with 800 μL PBS (pH = 7.4). Cells were collected using a cell scraper, transferred to 1.5 mL EP tubes, and sent to the Wuhan Institute of Virology's sub-testing center for cell section preparation. The sections were then observed using a 200 kV transmission electron microscope (Tecnai G220 TWIN, FEI, USA). The results are as follows: Figure 1 As shown in Figure C, viral particles were observed in the cytoplasmic vesicles of the infected cell section.

[0038] The results of IFA detection, viral particle negative staining, and electron microscopy observation show that the present invention successfully obtained SFTSV through reverse genetics.

[0039] Example 2: Viral RNA Whole Genome Sequencing

[0040] Take 200 μL of the supernatant from the rNB24 strain (P8), add 700 μL of TRIzol (Invitrogen, Carlsbad, USA) to an RNase-free EP tube, and vortex for 5 min. Then add 500 μL of pre-chilled chloroform and vortex vigorously for 2-3 min, centrifuge at 12000 rpm for 15 min at 4 °C. In a biosafety cabinet, transfer the supernatant to a new RNase-free EP tube, add 1 mL of pre-chilled isopropanol and mix well. Incubate the EP tube at -20 °C overnight or -80 °C for 30 min to allow sedimentation. Centrifuge at 12000 rpm for 15 min at 4 °C and discard the supernatant. Add 1 mL of 75% ethanol (pre-chilled) prepared with DEPC H2O, invert to mix, centrifuge at 12000 rpm for 5 min at 4 °C, and then discard the supernatant. Add 1 mL of 75% ethanol (pre-cooled) prepared with DEPC H2O, repeat the previous steps, discard the supernatant, and centrifuge briefly for 30 seconds. Discard the supernatant remaining at the bottom of the EP tube using a pipette, and then place the EP tube in a 55°C desiccator for 5-10 minutes to dry the sample. Add 40 μL of DEPC H2O and place in a 55°C desiccator for 5 minutes to dissolve. Measure the concentration and set aside for later use.

[0041] Using the viral nucleic acid extracted above as a template, a 20 μL reverse transcription system was prepared using the Promega GoScript (Promega, Madison, WI, USA) reverse transcription kit. A PCR sample containing 2 μg of RNA (10 μL total volume) was placed at 70°C for 5 min, then immediately placed on ice for 5 min, followed by a brief centrifugation for 5 s. A Reverse Mix system was prepared, consisting of 4 μL Random primer (50 ng / μL), 4 μL DEPC H2O, and 2 μL Enzyme Mix. The pre-treated RNA (10 μL) and Reverse Mix (10 μL) were then gently mixed. The reaction program on a gene amplification instrument was as follows: Step 1: Anneal primer (25°C, 5 min, 1 cycle); Step 2: Extension (42°C, 60 min); Step 3: Inactive (70°C, 15 min; 16°C, +∞). The cDNA samples after reaction were aliquoted and stored at -80°C.

[0042] RT-PCR amplification was performed using Taq Master Mix (Novizan, Nanjing, China). Products were detected by 0.8% agarose gel electrophoresis. The target band was excised from the gel and sent for sequencing (Sangon Biotech, Wuhan). Reaction components are shown in Table 1, reaction conditions in Table 2, and primers used in the reaction in Table 3. The primers used were universal primers for determining the SFTSV sequence in our laboratory. The sequencing fragments were assembled using DNAstar 7.1 SeqMan software.

[0043] Table 1 SFTSV RT-PCR reaction components

[0044] 2×Rapid Taq Master Mix 25 F primer (10μM) 2 R primer (10μM) 2 cDNA 2-5 dd H2O Up to 50

[0045] Table 2. SFTSV RT-PCR Reaction Conditions

[0046]

[0047] Table 3. SFTSV RT-PCR Primers

[0048]

[0049]

[0050]

[0051] * indicates mixed primers, mixed in a 1:1 ratio.

[0052] *Primers were mixed in a ratio of 1:1.

[0053] This invention extracted RNA from the supernatant of P8 generation virus and performed viral genome sequencing. Compared with the reference virus NB24, rNB24 showed sequence identity of 99.94%, 99.91%, and 100% for the S, M, and L fragments, respectively. A nucleotide mutation was found at position 59 of the rNB24 S fragment, resulting in a change from Leu to Phe at amino acid position 11 of the NSs protein. Simultaneously, three mutations were found in the M fragment: the A10C mutation in the 5'UTR and C30T and T2598C in the GP ORF, resulting in synonymous mutations at amino acids 4 of Gn and 816 of Gc, respectively.

[0054] Example 3: Phylogenetic Tree Analysis

[0055] The complete sequences of the S, M, and L segments of SFTSV were downloaded from the NCBI website and combined with the sequencing sequence of the rNB24 strain. The viral sequences were aligned using Clustal Omega (https: / / www.ebi.ac.uk / ), and then phylogenetic analysis was performed using MEGA 6.0 with maximum likelihood (ML) and a bootstrap of 500.

[0056] The phylogenetic tree of rNB24 is as follows: Figure 2 As shown, rNB24 and the reference strain NB24 have the same phylogenetic structure, and they cluster in the C6, J2 and J2 genotypes of the L, M and S trees, respectively.

[0057] Example 4: Determination of one-step growth curves of different genotype SFTSV strains

[0058] Vero cells were loaded at 4 × 10 5 Seeded into 6-well plates at a density equal to the specified density, each well containing 2 mL of DMEM medium with 2% FBS, 100 U / mL penicillin, and 100 μg / mL streptomycin, and incubated overnight at 37°C with 5% CO2. After cell adhesion, Vero cells were infected with different genotypes of SFTSV at 5 MOI and incubated at 37°C with 5% CO2 for 1 h. After virus adsorption, the supernatant was discarded, and the cells were washed three times with sterile PBS or culture medium. 2 mL of DMEM medium containing antibiotics and 2% FBS was added, and three replicates were performed. 50 μL samples were collected from each well at 0 h, 6 h, 12 h, 24 h, 48 h, 72 h, and 96 h post-infection and stored at -80°C. Finally, the viral titer was determined.

[0059] Before determining the viral titer, prepare 96-well plates with 10,000 Vero cells per well and 100 μL of culture medium per well. Collect viral supernatants from different time points, remove them from a -80°C freezer, thaw at room temperature, and then begin determining the viral titer. Dilute 50 μL of the collected supernatant tenfold, starting from 10... -1 Start gradient dilution to 10 -8 50 μL of the diluted virus solution was transferred to 96-well plates, with six replicates for each dilution. After infection at 37°C and 5% CO2 for 72 h, cells were collected for IFA detection. Viral titers were calculated using the Reed-Muench method, and one-step growth curves were plotted. One-step growth curves were plotted using GraphPad Prism 8.0 (GraphPad Software Inc.) software based on the titers of each virus sample measured at different time points.

[0060] In this embodiment, HBGS13(C2), HBMC5(C3), WCH(C4), and rNB24(C6 / J2 / J2) were selected for one-step growth curve determination. The results are as follows: Figure 3 As shown, strains rNB24 (C6 / J2 / J2), HBMC5 (C3), and WCH (C4) exhibited similar growth characteristics, producing viral titers of 6.88 × 10⁻⁶ at 96 h⁻¹. 7 TCID 50 / mL, 1.31×10 8 TCID 50 / mL and 5.45×10 8 TCID 50 / mL. However, the growth effect of the HBGS13(C2) strain was not as good as other genotypes. The viral titer of the infective progeny produced by the HBGS13(C2) strain at each time point was lower than that of other genotypes, with a titer of 3.12 × 10⁻⁶ at 96 h p⁻¹. 7 TCID 50 / mL (not significant compared to other genotypes, P = 0.1448).

[0061] Example 5: Different genotypes of SFTSV strains IFNAR - / - C57BL / 6 mouse infection model

[0062] To establish infection of IFNAR with different genotypes of SFTSV strains - / - The C57BL / 6 mouse model was used to further determine the median lethal dose (LD50) of the SFTSV strain. 50 Each group of IFNAR - / -C57BL / 6 mice (6-8 weeks old, female, n=5-12) were intraperitoneally injected with 100 μL of different dilutions of different genotypes of SFTSV strains (0.01-1000 TCID). 50 Mice were injected with an equal volume of PBS as a control. Mouse weight, body condition changes, and survival were monitored and recorded for 14 consecutive days after challenge. The daily weight of each mouse was compared with its initial weight before inoculation, and the percentage change in weight was calculated to analyze the weight change. The LD50 of different genotypes of SFTSV strains was calculated using the Reed-Muench method. 50 .

[0063] This embodiment established the infection of IFNAR with different genotypes of SFTSV strains (HBGS13(C2), HBMC5(C3), WCH(C4), rNB24(C6 / J2 / J2)). - / - In the C57BL / 6 mouse model, the changes in body weight and survival rate of IFNAR- / -C57BL / 6 mice infected with different genotypes of SFTSV strains (serially diluted doses) were analyzed. The results are as follows: Figure 4 As shown.

[0064] Results of mice infected with the HBGS13(C2) strain are as follows Figure 4 As shown in A, when using 100, 10, 1, or 0.1 TCID 50 When infected with the specified dose in mice, body weight decreased by 26.03% on day 5, 20.91% on day 6, 17.03% on day 7, and 15.25% on day 9, reaching its lowest point at these time points. By the end of the 14-day monitoring period, in addition to inoculation with 100 TCID45... 50 Outside of the PBS control group, surviving mice in the other groups gradually regained their body weight, consistent with the PBS control group. Infected with 100 TCID... 50 Mice administered the mouse dose began to die on day 5, and all eventually perished. Infections with 10, 1, and 0.1 TCID... 50 The survival rates of the mice in the first three groups were 25%, 75%, and 83.3%, respectively, with mortality beginning on days 6, 6, and 9. (0.01 TCID) 50 / Infective doses in mice do not cause IFNAR - / - C57BL / 6 mice either died or experienced significant changes in body weight.

[0065] Results of mice infected with the HBMC5(C3) strain are as follows Figure 4 As shown in B, when using 1 and 0.1 TCID 50 At mouse-level doses, mice experienced the greatest weight loss on day 7, with reductions of 28.33% and 18.65%, respectively. (1 TCID) 50At a mouse-dose infection, all mice died, with deaths occurring between days 6 and 8; at 0.1 TCID... 50 In mouse dose infection, the survival rate of mice was 20%, with death occurring within 7–9 days. Compared to the control group, all mice treated with 0.01 TCID... 50 Mice infected with the same dose of the mouse rotavirus survived and did not show any weight loss.

[0066] Results of mice infected with the WCH(C4) strain: Figure 4 As shown in C, when using 10 or 1 TCID 50 At mouse-level doses, all mice died, and the mice experienced severe weight loss of 20.23% and 26.07% on days 4 and 6, respectively. At 0.1 and 0.01 TCID... 50 At mouse-dose infection, surviving mice had similar body weights to the PBS control group. (0.1 and 0.01 TCID) 50 The survival rates for the mouse group and the mouse group were 80% and 100%, respectively.

[0067] Results of mice infected with the rNB24(C6 / J2 / J2) strain are as follows Figure 4 As shown in D, when infected with doses of 1000, 100, 10, or 1 TCID50 / mouse, the mice experienced body weight losses of 25.95% on day 6, 19.60% on day 6, 17.03% on day 7, and 11.53% on day 7, respectively. The 1000 and 100 TCID50 / mouse doses resulted in the following weight losses: 50 The survival rates in the mouse dose groups were 33.33% and 80%, respectively, with mortality beginning on days 6 and 9, respectively. Compared with the control group, the 10, 1, 0.1, and 0.01 TCID doses... 50 No deaths occurred in the 0.1 and 0.01 TCID50 / mouse dose groups, and no weight loss occurred in the 0.1 and 0.01 TCID50 / mouse dose groups.

[0068] Based on the results of infection models with different doses of different SFTSV genotypes mentioned above, this study calculated the LD50 of different SFTSV genotypes using the Reed-Muench method. 50 LD 50 The order from highest to lowest is rNB24(C6 / J2 / J2, 421.78TCID). 50 )>HBGS13(C2, 3.159TCID50)>WCH(C4, 0.2366TCID 50 )>HBMC5(C3, 0.042TCID 50 ), of which rNB24's LD 50The concentration of rNB24 was 133.5-10042.4 times higher than that of other genotypes. This indicates that rNB24 requires a higher dose than other genotypes to cause IFNAR. - / - C57BL / 6 mice died. rNB24 inhibited IFNAR. - / - The C57BL / 6 strain showed lower virulence than the C2, C3, and C4 genotypes, suggesting its potential as a weakened vaccine.

[0069] Example 6: SFTSV strain C57BL / 6 mouse infection model and antibody response process

[0070] To further investigate antibody responses in mice after SFTSV infection, this study established SFTSV infection models with different genotypes using 6-8 week old female C57BL / 6 mice. Nine groups of C57BL / 6 mice (n=6 per group) were first infected with the HBMC5(C3) strain, with each mouse receiving an intraperitoneal injection of 10... 7 TICD 50 SFTSV strain. At time points of 1, 3, 5, 7, 9, 14, 17, 21, and 28 days post-infection, blood was collected from the eyeballs of one group of C57BL / 6 mice for sacrifice. Mouse serum was incubated at room temperature for 1 hour, then centrifuged at 5000 rpm for 5 minutes at 4°C. The supernatant was aliquoted and stored at -80°C. After all mouse serum samples were collected, viral load, IgM and IgG antibodies, and neutralizing antibodies were uniformly measured. The experimental method is as follows:

[0071] 1) Preparation of SFTSV antigen tablets

[0072] Vero cells in 96-well plates were infected with different genotypes of SFTSV strains HBGS13 (C2), HBMC5 (C3), WCH (C4) and the chimeric attenuated strain rNB24 (C6 / J2 / J2) prepared in this invention at MOI=1. Cells were cultured at 1×10⁻⁶ M². 4 Cells were infected in a 37°C, 5% CO2 incubator for 72 h, and the supernatant was discarded. Cells were then fixed with 4% paraformaldehyde (prepared in PBS) at room temperature for 10-20 min, followed by washing three times with PBS. Cells were permeabilized with 0.2% Triton X-100 (prepared in PBS) at room temperature for 12-15 min, followed by washing five times with PBS. Cells were blocked with 5% BSA (prepared in PBS) at 37°C for 1 hour, and the supernatant was discarded. Excess moisture in the 96-well plates was dried at room temperature (20-30°C) and stored at -80°C for further experiments. The culture medium used in this experiment was DMEM containing 2% FBS, 100 U / mL penicillin, and 100 μg / mL streptomycin.

[0073] 2) Quantitative real-time RT-PCR assay of mouse serum

[0074] 1> RNA extraction from mouse serum

[0075] Collect 50 μL of mouse serum and extract viral nucleic acid from the serum according to the instructions of the Viral DNA / RNA Extraction Kit (RC311-C1, Novizan, Nanjing, China). Add 150 μL of DEPC H2O to 50 μL of mouse serum, then add 500 μL of lysis buffer and vortex to mix. Transfer the mixture to an adsorption column and centrifuge at 12000×g for 1 min. Add 600 μL of wash buffer to the adsorption column and centrifuge at 12000×g for 30 s. Repeat the above steps twice. Then add 50 μL of elution buffer, incubate at room temperature for 1 min, and centrifuge at 12000×g for 1 min. Centrifuge the empty column at 12000×g for 2 min. Sample RNA is used immediately and nucleic acid detection is completed on the same day.

[0076] 2> Preparation of standard RNA

[0077] PCR amplification of the SFTSV NP fragment was performed using Taq Master Mix (Novizan, Nanjing, China) according to Tables 1 and 2. The template was the pCAGGS-NP plasmid, and PCR was performed using primers containing the T7 in vitro transcriptase gene. The primers were SF-F-1001-TZ and SF-R-1200-TZ, and their nucleotide sequences are shown in SEQ ID NO:46 and SEQ ID NO:47, respectively. The PCR products were detected by 0.8% agarose gel electrophoresis. The concentration was determined by excising the target band at the marker size and recovering the product. The nucleotide sequences of SEQ ID NO:46 and SEQ ID NO:47 are as follows:

[0078] SEQ ID NO:46

[0079] TAATACGACTCACTATAGGGAGAAGCTTCTGCTGGGGACCCC

[0080] SEQ ID NO:47

[0081] CCTGAAGGTCGAGAATTATC

[0082] Using the T7 High Yield Transcription Kit (TR101-01, Novizan, Nanjing, China)

[0083] The kit was used for in vitro transcription. The PCR products were prepared according to Table 3 on ice, mixed, briefly centrifuged, and incubated at 37°C for 2 h. 1 μL of DNase I was added to the reaction mixture, and the mixture was incubated at 37°C for 15 min to digest the transcribed DNA template. RNA products were purified using a viral DNA / RNA extraction kit (RC311-C1, Novizan, Nanjing, China). The RNA was then dissolved in 100 μL of DEPC H2O, the concentration was determined, the viral copy number was calculated, and the products were aliquoted and stored at -80°C for experimental use.

[0084] Table 4 PCR reaction components

[0085]

[0086]

[0087] Table 5 PCR reaction conditions

[0088]

[0089] Table 6 In vitro transcription reaction system

[0090] 10×Reaction Buffer 2 ATP Solution 2 GTP Solution 2 UTP Solution 2 CTP Solution 2 DNA template X(0.1-1μg) T7 RNA Polymerase Mix 2 RNase-free ddH2O Up to 20

[0091] 3> Real-time RT-PCR

[0092] Real-time RT-PCR uses II. One Step qRT-PCR Probe Kit (Q222, Novizan, Nanjing, China). Primers used were SF-F-TZ-D and SF-R-TZ-D, and the fluorescent probe was SF-Probe. The nucleotide sequences of SF-F-TZ-D, SF-R-TZ-D, and SF-Probe are SEQ ID NO:48, SEQ ID NO:49, and SEQ ID NO:50, respectively. The above RNA standards were serially diluted tenfold, and the qRT-PCR reaction system was prepared according to Table 4, followed by the reaction according to Table 5. Viral copy number was determined using a StepOnePlus™ RealTime PCR instrument, and the results were plotted using GraphPadPrism 8.0 (GraphPad Software Inc).

[0093] The nucleotides of SEQ ID NO:48, SEQ ID NO:49 and SEQ ID NO:50 are shown below:

[0094] SEQ ID NO:48

[0095] GGGTCCCTGAAGGAGTTGTAAA

[0096] SEQ ID NO:49

[0097] TGCCTTCACCAAGACTATCAATGT

[0098] SEQ ID NO:50

[0099] HEX-TTCTGTCTTGCTGGCTCCGCGC-BHQ-2

[0100] Table 7 qRT-PCR reaction system

[0101] 2×One Step Q Probe Mix 10 One Step Q Probe Enzyme 1 50×ROX Reference Dye 1 0.4 Gene Specific Primer Forward(10μM) 0.4 Gene Specific Primer Reverse(10μM) 0.4 TaqMan Probe (10μM) 0.2 DNA template 5 <![CDATA[RNase-free ddH2O]]> Up to 20

[0102] Table 8 qRT-PCR reaction conditions

[0103]

[0104] 3) Determination of IgM and IgG antibodies

[0105] Mouse serum samples for antibody detection were inactivated at 56°C for 30 min. The mouse serum was then serially diluted twofold (from 1:16 to 1:32768) with PBS containing 1% BSA and 0.05% Tween. The prepared antigen slides were removed and allowed to return to room temperature. Serum samples of different dilutions (50 μL / well) were added to the antigen slides and incubated at 37°C for 2 h. After washing three times with PBS, the secondary antibody was incubated at 37°C for 1–1.5 h. The secondary antibody was either HRP-labeled goat anti-mouse IgG (H+L) antibody or HRP-labeled goat anti-mouse IgM (H+L) antibody (Sanying, Wuhan, China), diluted 1:4000 with PBS containing 1% BSA and 0.05% Tween. After washing three times with PBS, 100 μL of TMB solution (Beyotime, Shanghai, China) was added to each well and incubated at room temperature for 20 min. The reaction was terminated by adding 100 μL of stop solution (Beyotime, Shanghai, China). Absorbance was measured at 450 nm using a microplate reader (Synergy HT BioTek, Vermont, USA). The highest serum dilution with an optical density value greater than twice the average of the negative control was considered the dilution endpoint. Antibody titers in mouse serum reacting to different SFTSV strains were expressed as the reciprocal of the highest detectable dilution. Antibody level curves were plotted using GraphPad Prism 8.0 (GraphPad Software Inc.).

[0106] 4) Determination of neutralizing antibodies

[0107] Heat-inactivated (56°C, 30 min) serum samples were serially diluted twice using DMEM medium containing 2% FBS, 100 U / mL penicillin, and 100 μg / mL streptomycin. 50 μL of the diluted serum was then mixed with 50 μL of medium containing 100 TCID50. 50 Equal volumes of SFTSV strains (HBGS13, HBMC5, WCH, or rNB24) were mixed. The virus-serum mixture was incubated at 37°C for 1 hour. A mixture containing SFTSV without diluted serum was used as a control. 100 μL of the mixture was added to Vero cells in a pre-prepared 96-well plate (1×10⁻⁶ cells). 4 Cells / well were infected at 37°C, 5% CO2 for 72 h, and the supernatant was discarded. SFTSV NP protein expression was detected using IFA. The number of infected cells and the total number of cells were then photographed and calculated using the Operetta CLSTM high-throughput instrument and system (PerkinElmer, Waltham, MA, USA). The infection rate for each test was expressed as the number of SFTSV NP-positive cells / total number of cells, while the infection rate of wells containing the virus but without antiserum served as a control. Inhibition rate % = (1 - infection rate of each test / infection rate of the control) × 100. The inhibitory effect of different strains after serial dilutions was analyzed using the "[Inhibitor] vs. Normalized response - Variable slope" model in GraphPad Prism 8.0 (GraphPad Software Inc.).

[0108] HBMC5(C3) strain (10 7 TCID 50 The results of viral load, IgM and IgG antibodies, and neutralizing antibody assays at different time points after C57BL / 6 mice were infected are as follows: Figure 5 As shown, the viral load in C57BL / 6 mice reached its peak on day 3 post-infection and was completely cleared by day 10. Furthermore, IgM antibody levels peaked between days 5 and 7 post-infection and disappeared after day 10. IgG antibody levels continued to rise between days 1 and 7 post-infection, reaching a plateau (titer 1638.4-5324.8) between days 7 and 28. IgG antibodies with a titer of 1228.8 were still detectable 60 days post-infection. Further analysis of neutralizing antibody levels revealed an increasing trend in neutralizing antibody titers between days 1 and 14 post-infection, reaching a plateau (titer 179.2-268.8) between days 14 and 28. The neutralizing antibody titer measured on day 60 post-infection was 102.4.

[0109] Example 7: Immunogenicity evaluation of different genotypes of SFTSV strains

[0110] After determining the period of highest neutralizing antibody production in mice based on the establishment of the above animal model, C57BL / 6 mice were infected with different genotypes of SFTSV strains, with each mouse receiving an infection dose of 10. 7 TICD 50 SFTSV, 6 mice per group. Blood was collected from the eyeballs on day 14 post-infection and the mice were sacrificed. Mouse serum was incubated at room temperature for 1 hour, then centrifuged at 5000 rpm and 4°C for 5 minutes. The supernatant was aliquoted and stored at -80°C. Further analysis will be conducted to determine the cross-recognition and cross-neutralization effects of IgG antibodies in the serum of mice with different genotypes.

[0111] 1) Cross-recognition of serum antibodies against different genotype SFTSV strains C57BL / 6 mice

[0112] Using the SFTSV-infected C57BL / 6 mouse model, this study used different genotypes of SFTSV strains (10 7 TCID 50 (Number of mice) were infected with C57BL / 6 antibodies. Serum samples were collected on day 14 post-infection to determine the cross-recognition ability of serum IgG antibodies against different genotypes. The M fragment genotypes of HBGS13, HBMC5, WCH, and rNB24 were C2, C3, C4, and J, respectively, which are briefly referred to as C2, C3, C4, and J antigens. Results are as follows... Figure 6As shown, the titers of C2 genotype serum IgG antibodies recognizing C2, C3, C4, and J antigens were 8192, 23210.7, 30037.3, and 21845.3, respectively. Compared with the effect of recognizing C2 antigen, the recognition abilities of C3, C4, and J antigens showed significant differences (p values ​​0.0139, 0.0003, and 0.0174, respectively), indicating that C2 genotype serum can not only efficiently recognize C2 antigen but also effectively recognize C3, C4, and J antigens, suggesting that the C2 genotype strain produces broad-spectrum antibodies capable of efficiently recognizing antigens of different SFTSV strains. The titers of C3 genotype serum IgG antibodies recognizing C2, C3, C4, and J antigens were 10922.7, 12970.7, 14336, and 15701.3, respectively. Compared with the effect of recognizing C3 antigen, there were no significant differences in the recognition abilities of other genotype antigens. This indicates that the C3 genotype strain can produce broad-spectrum antibodies, with similar abilities to recognize different genotype antigens. The titers of C4 genotype serum IgG antibodies recognizing C2, C3, C4, and J antigens were 8192, 10922.7, 11605.3, and 16384, respectively. Compared with the effect of recognizing the C4 antigen, there was no significant difference in the recognition ability of other genotype antigens. This indicates that the C4 genotype strain can produce broad-spectrum antibodies, with similar abilities to recognize different genotype antigens. The titers of J genotype serum IgG antibodies recognizing C2, C3, C4, and J antigens were 6144, 8192, 13653.3, and 11605.3, respectively. There was a significant difference in the recognition of the C2 antigen and the J antigen (p=0.018). This indicates that the J2 genotype strain can produce broad-spectrum antibodies, but its ability to recognize the C2 antigen is weaker than its ability to recognize the C3 and C4 antigens. This study found that the C2 strain significantly enhanced antibody levels and cross-recognition of other genotype antigens, suggesting its potential as a vaccine strain. By comparing antibodies from different genotypes, this study found that serum from each genotype could elicit highly effective and broad-spectrum antibodies, all exhibiting good immunogenicity.

[0113] 2) Cross-neutralization analysis of SFTSV strain C57BL / 6 mice with different genotypes

[0114] To understand the cross-neutralization effect of serum from different genotypes, the serum collected in Example 1) of this paper was subjected to a cross-neutralization experiment, and the results are as follows: Figure 7 As shown. C2 type serum in 2 4 -2 12 At dilutions of [specific concentration], the inhibition rates of neutralizing HBGS13(C2), HBMC5(C3), and WCH(C4) strains were higher than 50%, at 2 [specific concentrations]. 4 -2 9At the specified dilution, the inhibition rate of neutralizing rNB24 (C6 / J2 / J2) strain was higher than 50%, suggesting that the C2 type serum has a broad-spectrum neutralizing effect. The C3 type serum showed a similar effect at 2... 4 -2 12 At dilutions of [specific concentration], the inhibition rates of neutralizing HBGS13 (C2), HBMC5 (C3), and WCH (C4) strains were higher than 50%. In 2 [specific concentrations]... 4 -2 8 At the specified dilution, the inhibition rate of neutralizing the rNB24 (C6 / J2 / J2) strain was higher than 50%, indicating that the C3 serum has a broad-spectrum neutralizing effect, but its neutralizing effect on the rNB24 (C6 / J2 / J2) strain is worse than that on other genotypes. The C4 serum at 2... 4 -2 12 At dilutions of [specific concentration], the inhibition rates of neutralizing HBGS13(C2), HBMC5(C3), and rNB24(C6 / J2 / J2) strains were higher than 50%, and at 2 [specific concentrations]... 4 -2 11 At the specified dilution, the inhibition rate of neutralizing the rNB24 (C6 / J2 / J2) strain was higher than 50%, suggesting that the C4 serum has a broad-spectrum neutralizing effect. The J serum, at 2... 4 -2 12 At dilutions of [specific concentration], the inhibition rate of neutralizing HBGS13(C2) and HBMC5(C3) strains was higher than 50%, and at 2 [specific concentrations]... 4 -2 11 At dilutions of [specific concentration], the inhibition rate of neutralizing the WCH(C4) strain was higher than 50%, and at 2 [specific concentrations]... 4 -2 9 At the specified dilution, the inhibition rate of neutralizing the rNB24 (C6 / J2 / J2) strain was higher than 50%. This suggests that J2-type serum has a broad-spectrum neutralizing effect, but its neutralization effect on the rNB24 (C6 / J2 / J2) strain is weaker than that on other genotypes. Furthermore, comparisons of the neutralizing effects of different genotype serums revealed that serums were more effective at neutralizing HBGS13 (C2), HBMC5 (C3), and WCH (C4) strains than rNB24 (C6 / J2 / J2) strains, with the best effect observed at HBGS13 (C2) strain. These neutralization results indicate that serums of different genotypes have a broad-spectrum neutralizing effect, and the immunogenicity of different genotype strains is similar.

[0115] Example 9: Evaluation of the protective effect of the chimeric attenuated strain rNB24 attenuated vaccine

[0116] In comparing the differences between different genotypes of SFTSV strains in vivo and in vitro, the inventors found that the rNB24 strain had similar growth characteristics to other genotypes at the cellular level, but in IFNAR... - / -The C57BL / 6 mouse model showed weaker virulence than other genotypes of SFTSV strains, suggesting that this strain has the potential to be used as an attenuated vaccine. Therefore, the attenuated vaccine of the rNB24 strain was evaluated.

[0117] Female IFNARs aged 6-8 weeks - / - C57BL / 6 mice were first treated with 10 TICD. 50 Mice were pre-immunized with rNB24 virus 10 days in advance, with mice pre-immunized with PBS serving as controls. Ten days after immunization, mice were administered 1 or 10 TCID50. 50 Mice were infected with HBGS13(C2) virus. Each group consisted of 6 mice, and the weight changes and survival rate of the mice were monitored for 12 consecutive days after reinfection.

[0118] Experimental results are as follows Figure 8 As shown, immunization with the rNB24 strain (10 TCID) 10 days in advance... 50 IFNAR ( / mouse dose) - / - C57BL / 6 mice were reinfected with 1 TCID. 50 / mouse dose of HBGS13(C2) strain. Control mice pre-immunized with PBS showed a 50% mortality rate on day 7, and experienced a severe 22.97% weight loss. Mice pre-immunized with rNB24 strain survived reinfection, with weight changes ranging from 101.4% to 112.1%. This study also found that reinfection with 10 TCID... 50 When administered the HBGS13(C2) strain at a mouse dose, mice in the control group began to die on day 6, with all mice dying by day 8, and a significant 24.57% weight loss on day 7. In contrast, mice immunized with the rNB24 strain survived, with a weight loss ranging from 97.29% to 108.3%. The rNB24 strain induced the production of broad-spectrum antibodies in C57BL / 6 mice. Figure 7 D) suggests that the rNB24 strain has the effect of an attenuated vaccine and can be used as a candidate strain for attenuated vaccine.

[0119] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A chimeric attenuated SFTSV strain, characterized in that, The nucleotide sequences of the S, M, and L fragments of the SFTSV chimeric attenuated strain are based on GenBank sequence numbers KR698324, KR698337, and KR698350, respectively. The 11th position of the NSs protein encoded by the S fragment is mutated from leucine to phenylalanine.

2. The SFTSV chimeric attenuated strain according to claim 1, characterized in that, The nucleotide sequence of the M fragment of the SFTSV chimeric attenuated strain underwent the following mutations: A10C, C30T, and T2598C.

3. The use of the SFTSV chimeric attenuated strain according to claim 1 or 2 in the preparation of SFTSV attenuated vaccines.

Images