A method for dwarfing peonies based on gene silencing technology

Abstract

This invention provides a method for dwarfing peonies based on gene silencing technology, comprising the following steps: 1) cloning... PlKAO The study included: 1) Gene fragmentation; 2) Construction of a recombinant plasmid for tobacco brittle virus TRV; 3) Sequencing and identification of the recombinant plasmid; 4) Plasmid transformation into Agrobacterium; 5) Agrobacterium culture and resuspension; 6) Vacuum infection of peony tuberous roots with buds under negative pressure; 7) Repotting infected peony seedlings for further culture; 8) Identification of positive infected plants; and 9) Observation of the transformed peony phenotype. Compared with existing methods for dwarfing peonies, this method significantly reduces the harm to the plant itself and the potential threat to the soil environment. Gene-silenced peony plants were successfully obtained after potting, achieving the goal of precisely improving peony traits. The infection process does not require aseptic operation, effectively solving the problem of the lack of a mature genetic transformation system for peonies, which makes gene function verification impossible. This method can serve as an important means for verifying peony gene function, with promising application prospects.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to a method for dwarfing peony based on gene silencing technology. Background Technology

[0002] Peony, a perennial herbaceous flowering plant belonging to the genus Paeonia in the family Paeoniaceae, has a long history of cultivation in my country and is one of the country's traditional famous flowers. It is suitable for garden ornamental purposes and is also an important cut flower in the flower market. However, many Chinese peony varieties suffer from thin, weak stems, drooping, and even lodging problems, which seriously affect their ornamental and market value. On the other hand, with the development of the flower industry, miniaturized potted plants have become a trend, and plant height is a significant factor limiting the development of potted peonies. Therefore, cultivating low-growing ornamental peony varieties has a promising market prospect.

[0003] Gibberellins (GA), as important plant hormones in plant growth and development, promote stem elongation by inducing rapid cell growth and participate in regulating cell wall remodeling, playing a crucial role in regulating plant height. The gibberellin synthesis pathway is now well understood (Hedden, P., Proebsting, WM (1999) Genetic analysis of gibberellin biosynthesis. Plant Physiol. 119:365-370), and the function of the key enzyme gene in gibberellin synthesis has been a hot topic in plant research. Genes encoding gibberellin synthase have been isolated from crops such as wheat, rice, and peas, and numerous mutants related to gibberellin synthase genes have been obtained, all resulting in dwarfing or semi-dwarfing phenotypic mutations. Treatment of peonies with gibberellin inhibitors causes a significant dwarfing phenotype. Therefore, silencing the peony gibberellin synthase gene to regulate plant architecture has a certain theoretical basis.

[0004] Virus-induced gene silencing (VIGS) technology utilizes the interaction between viral immune responses and RNA interference within plants to induce post-transcriptional gene silencing. Gene silencing induced by tobacco brittle virus (TRV) is currently the most widely used gene silencing system due to its high efficiency, long duration, and ease of operation. In the verification of gene function in ornamental plants, VIGS technology has also been widely used for the rapid identification of gene functions, mainly involving genetic improvement of senescence, metabolism, leaf color, flower morphology development, flower color, disease resistance, and stress resistance. However, research reports on its application in regulating plant form in ornamental plants are limited, with only its application in chrysanthemums.DmGA20ox The (GA20 oxidase) gene yielded dwarf chrysanthemum varieties (Xie, QL, et al. Dual silencing of DmCPD and DmGA20ox genes generates a novel miniature and delayed-flowering Dendranthema morifolium variety[J]. MOL BREEDING, 2015, 35); Silencing early auxin response genes in crape myrtle stem segments. LFiAUX22 Silent lines showed significantly shortened internode length (Liang Xiaohan. Correlation between plant height and silencing). SAURs , AUX / IAAs Cloning and Functional Analysis of Genes [D]. Beijing Forestry University, 2020.

[0005] Peony, as a perennial herbaceous plant, has high ornamental and economic value. However, due to the immaturity of its genetic transformation system, the verification of peony gene function relies on model plants. Developing molecular-assisted breeding for peonies is of great significance for rapidly identifying peony gene function. Currently, the published VIGS-mediated gene silencing method is insufficient for application in the regulation of peony plant architecture. The method described in this invention provides a highly efficient peony endogenous gene silencing system mediated by tobacco brittle virus (TRV), and this technology can be applied to the regulation of peony plant architecture. Summary of the Invention

[0006] In view of the above-mentioned shortcomings, the purpose of this invention is to provide an effective gene silencing method in peony to achieve dwarfing, mainly solving the technical problem of difficulty in verifying gene function in peony.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] 1) The peony gibberellin synthase gene was cloned. PlKAO

[0009] Peony obtained by cloning PlKAO The full-length gene fragment is shown in SEQ ID No:1;

[0010] 2) Constructing the recombinant plasmid for tobacco brittle virus (TRV)

[0011] Based on the principle of homologous recombination, in peony PlKAO Using a non-conserved gene fragment such as SEQ ID No:2, homologous recombination primers were designed to insert the exogenous gene fragment between the EcoR1 and Xho1 sites of the TRV2 plasmid, resulting in the recombinant plasmid PlKAO / TRV2.

[0012] 3) Sequencing and identification of recombinant plasmids

[0013] Primers were designed near the multiple cloning site of the TRV2 vector: the forward primer TRV2-F (sequence shown in SEQ ID NO:7) and the reverse primer TRV2-R (sequence shown in SEQ ID NO:8).

[0014] 4) Plasmid transformation of Agrobacterium

[0015] The above-mentioned plant recombinant expression vector PlKAO / TRV2 was heat-shocked and transformed into Agrobacterium competent cells EHA105 to obtain transgenic strains;

[0016] 5) Agrobacterium culture and resuspension

[0017] Positive clones were selected and cultured in LB liquid resistant medium by shaking, then resuspended in resuspending solution and left to stand in the dark.

[0018] 6) Peony tuberous roots infected under negative pressure vacuum.

[0019] The buds of the peony tubers that have broken dormancy were immersed in the Agrobacterium solution in step 5) for negative pressure vacuum infection.

[0020] 7) The infected peony seedlings were repotted and cultivated.

[0021] The infected peony tubers were transferred to a culture medium and placed in a greenhouse for pot cultivation.

[0022] 8) Identification of positive plants after infection,

[0023] Primers were designed flanking the coat protein in the TRV2 vector: forward primer CP-F (sequence shown in SEQ ID NO:9) and reverse primer CP-R (sequence shown in SEQ ID NO:10). Peony leaves infected with the empty TRV1 / TRV2 vector were used as a control group to detect the presence of [a specific protein] in the transgenic peony leaves. Coat protein The expression of .

[0024] 9) Observation of the transformation of peony phenotype

[0025] After 30 days of potted cultivation, the plant height phenotype of peony plants was observed and statistically analyzed.

[0026] This invention provides a complete and efficient process for dwarfing peonies based on gene silencing technology. This method can be used to obtain dwarfed peony plants, providing a new approach for the cultivation and development of potted peonies.

[0027] Compared with the prior art, the present invention has the following advantages:

[0028] 1. This invention performs gene silencing in peony, enabling precise genetic improvement of peony traits. The method is simple, easy to implement, and quick. Compared with existing methods for dwarfing peonies, it greatly reduces the potential threats to the plant itself and the soil environment. Therefore, molecular-assisted breeding is an environmentally friendly, efficient, and promising method for regulating the plant shape of ornamental plants.

[0029] 2. This invention is the first to use peony tubers as material for gene silencing, successfully obtaining gene-silenced peony plants after potting. This invention does not require tissue culture or a sterile operating environment, is low-cost, and directly obtains gene-silenced peony plants. It effectively solves the problem of the lack of a mature genetic transformation system for peonies, making it difficult to verify gene function on peony plants. It can serve as an important means of verifying peony gene function, with very promising application prospects. Attached Figure Description

[0030] Sequence ID NO:1 is peony. PlKAO Full-length gene sequence.

[0031] Sequence ID NO:2 is peony. PlKAO A non-conserved domain sequence of a gene.

[0032] The sequence listing SEQ ID NO:3 is the forward primer PlKAO-F.

[0033] The sequence listing SEQ ID NO:4 is the reverse primer PlKAO-R.

[0034] The sequence listing SEQ ID NO:5 is the forward primer PlKAO-EcoR1-F.

[0035] The sequence listing SEQ ID NO:6 is the reverse primer PlKAO-Xho1-R.

[0036] The sequence listing SEQ ID NO:7 is the forward primer TRV2-F.

[0037] The sequence listing SEQ ID NO:8 is the reverse primer TRV2-R.

[0038] The sequence listing SEQ ID NO:9 is the forward primer CP-F.

[0039] The sequence listing SEQ ID NO:10 is the reverse primer CP-R.

[0040] Picture 1 Peony plants in the control group and the silent group after 30 days of potted cultivation.

[0041] Picture 2 Semi-quantitative detection of viral vectors Coat protein The accumulation of information.

[0042] Picture 3 Quantitative detection of peony plants after infection PlKAO Gene expression levels.

[0043] Picture 4 The plant height of peony plants in the control group and the silent group was statistically analyzed 30 days after potting. Detailed Implementation

[0044] The present invention will be further described in detail below with reference to specific embodiments and accompanying drawings. The accompanying drawings are for illustrative purposes only and are not intended to limit the scope of protection of the invention; the scope of protection of the invention is defined by the claims. Unless otherwise specified, reagents and methods in the following embodiments are prepared and operated according to conventional methods.

[0045] All test materials were grown in the glass greenhouse of Beijing Forestry University (Haidian District, Beijing). The peony plants were all vigorous and uniform in growth, with no diseased or pest-infested plants.

[0046] Peony gene silencing method (Agrobacterium infection method):

[0047] In March, peony plants with buds and tubers were dug up, soaked in Agrobacterium tumefaciens solution carrying recombinant TRV virus, and subjected to negative pressure vacuum extraction for 30 minutes. They were then potted and cultured for 30 days. Positive plants were identified and the phenotypic characteristics of the peony plants were observed and statistically analyzed.

[0048] 1) Obtained by cloning PlKAO gene fragments

[0049] Using peony cDNA as a template, and with forward primer PlKAO-F (sequence shown in SEQ ID NO:3) and reverse primer PlKAO-R (sequence shown in SEQ ID NO:4) as primers, the key enzyme gene for peony gibberellin synthesis was amplified. ent- kaurenoic acid oxidase ( PlKAO A conserved gene fragment of 200bp~350bp is obtained, the nucleotide sequence information of which is shown in SEQ ID NO:1. PlKAO The fragment was ligated into the pMD18-T vector to obtain the recombinant plasmid PlKAO / pMD18-T.

[0050] 2) Constructing the recombinant plasmid for tobacco brittle virus (TRV)

[0051] Cloning containing homologous arms PlKAOThe fragment, templated as the recombinant plasmid PlKAO / pMD18-T, and with primer sequences of forward primer PlKAO-EcoR1-F (sequence shown in SEQ ID NO:5) and reverse primer PlKAO-Xho1-R (sequence shown in SEQ ID NO:6), was inserted into tobacco brittle virus TRV2 (containing the multiple cloning site MCS and capsid protein gene) via homologous recombination. Coat protein The recombinant plasmid PlKAO / TRV2 was obtained between the EcoR1 and Xho1 sites.

[0052] 3) Sequencing and identification of recombinant plasmids

[0053] The empty viral vector TRV1 (helper viral vector), empty viral vector TRV2, and recombinant plasmid PlKAO / TRV2 were transformed into competent E. coli DH5α cells, respectively. After being cultured in 700 uL of antibiotic-free LB liquid medium at 37°C with shaking for 1 h, the cells were spread onto solid medium containing antibiotic-LB (50 mg / L ampicillin) and incubated overnight upside down at 37°C.

[0054] Single colonies were picked and cultured overnight with shaking in liquid medium containing anti-ampicillin (50 mg / L) (37°C, 200 rpm) for PCR and sequencing identification. Using recombinant plasmid PlKAO / TRV2 as a template, and TRV2-F (sequence shown in SEQ ID NO:7) and TRV2-R (sequence shown in SEQ ID NO:8) as primers, PCR amplification was performed. Bacterial solutions with correct PCR bands were sent to the company for sequencing and compared with the sequence in SEQ ID NO:1. Positive clones with matching sequences were identified and cultured overnight with shaking.

[0055] 4) Plasmid transformation of Agrobacterium

[0056] The empty viral vector TRV1 (helper viral vector), empty viral vector TRV2, and recombinant plasmid PlKAO / TRV2 were transformed into Agrobacterium competent cells EHA105, respectively. After incubation at 28°C with shaking for 1 h in 700 μL of antibiotic-free LB liquid medium, the cells were plated onto solid medium containing antibiotic-LB (50 mg / L kanamycin + 25 mg / L rifampin) and incubated upside down at 28°C for 2 days. Single colonies were picked and placed in 1 mL of antibiotic-LB liquid medium (50 mg / L kanamycin + 25 mg / L rifampin) and incubated overnight at 28°C with shaking at 200 rpm. PCR amplification was performed using the Agrobacterium culture containing recombinant plasmid PlKAO / TRV2 as a template and TRV2-F (sequence shown in SEQ ID NO:7) and TRV2-R (sequence shown in SEQ ID NO:8) as primers. Transfer the bacterial culture with the correct band size to 500 mL of liquid medium containing LB inhibitor and incubate overnight for 12 h (28℃, 200 rpm).

[0057] 5) Agrobacterium culture and resuspension

[0058] Agrobacterium cultures containing empty TRV1, empty TRV2, and recombinant plasmid PlKAO / TRV2 were centrifuged at 5000 rpm and 20°C for 5 min, and the supernatant was discarded. The cultures were then resuspended in infection resuspension (1 mM 2-morpholine ethanesulfonic acid MES + 1 mM magnesium chloride MgCl2 + 0.2 mM acetylsuccinone AS). The OD value of the resuspension was adjusted to OD0.05. 600 =0.8. TRV1 and TRV2-PlKAO, TRV2 resuspension were mixed 1:1 and left to stand in the dark for 3 h for infection.

[0059] 6) Peony with buds and tuberous roots infected by negative pressure vacuum inoculation

[0060] In March of that year, peony tubers that had not yet emerged from the soil were dug up, and the plump buds on them had already elongated. After rinsing the peony tubers with buds with water, a 5 mL syringe was used to pierce the healthy peony buds, avoiding the growth point inside the bud. The entire plant was then immersed in a mixed suspension for negative pressure vacuum infection. The pressure was approximately 80 kPa, maintained for 15 minutes, and then slowly released for 15 minutes.

[0061] 7) The infected peony seedlings were repotted and cultivated.

[0062] Planted in a nutrient substrate (peat moss: vermiculite: perlite = 3:1:1), and cultivated in a glass greenhouse, watered and fertilized once a week, and the phenotype was observed after 30 days.

[0063] 8) Identification of positive plants after infection

[0064] Peony leaves uninfected with Agrobacterium and those infected with the empty TRV1 / TRV2 vector served as the control group, while silent peony lines infected with PlKAO / TRV2 served as the silence group. Coat protein Expression detection. RNA was extracted from leaves of each peony plant. Using single-plant cDNA as a template and CP-F (sequence shown in SEQ ID NO:9) and CP-R (sequence shown in SEQ ID NO:10) as primers, quantitative real-time fluorescence detection was performed. PlKAO The silencing effect of genes.

[0065] 9) Observation of the transformation of peony phenotype

[0066] The plant height of peony lines infected with TRV1 / TRV2 empty vector 30 days after potting was counted. The plant height of the PlKAO / TRV2 silent group was significantly reduced by 34.65% compared with the control group.

[0067] Although the present invention has been described in detail above with general descriptions, specific embodiments, and experiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention are within the scope of protection claimed by the present invention.

[0068] Sequence list information:

[0069] DTD Version: V1_3

[0070] Filename: A method for dwarfing peonies based on gene silencing technology.xml

[0071] Software Name: WIPO Sequence

[0072] Software version: 2.2.0

[0073] Generation Date: 2022-11-15

[0074] Basic Information:

[0075] Current application / applicant's profile name: Yu Xiaonan

[0076] Applicant's Name: Yu Xiaonan

[0077] Applicant's name or organization name / Language: zh

[0078] Applicant's Name / Latin Name: Xiaonan Yu

[0079] Invention Title: A Method for Dwarfing Peonies Based on Gene Silencing Technology (zh)

[0080] Total number of sequences: 10

[0081] sequence:

[0082] Serial Number (ID): 1

[0083] Length: 1470

[0084] Molecular type: DNA

[0085] Feature location / qualifier:

[0086] - source, 1..1470

[0087] >mol_type, other DNA

[0088] >Organism, artificial sequence

[0089] residues:

[0090] atggaggagctggtgggtatcaattgggttttgtgtatagccgtctgtgctggtttttgg60

[0091] gcagtcaagcgggtgctgagccgggcaaattcgtatttctatgaaacccaattgggtgat120

[0092] gaccgcttctctcttcctccaggtgatttgggttggcctttcattggaaatatgtggtct180

[0093] ttcctcagagctttcaagtccagtaatcctgattcttttatctccacctttgtcgacaga240

[0094] tttggaaaagcaggaatatacaaggccttcatgtttggaagtccaagtataattgttaca300

[0095] acaccagaagcttgcaaaagagtcttgacagatgatgaagcatttaagcctggctggccc360

[0096] agttccacactgaaactgattggaaggaaatcatttattggcatttcgtatgaagaacac420

[0097] aagcgtcttcggcgattaactgcagctccggtcaatggtcctgaagcattgtccttatat480

[0098] atgagatatattgaagacagtgttaaatttgctttaaataaatgggctgacatgggaaaa540

[0099] attgagttcttaacagaactccgaaagctaacttttagaataattatgtatattttcctt600

[0100] agctccgagagcgagaatgtaatggaggcgttggagagggaatacacaatgctaaattat660

[0101] ggagtcagagccatggcaatcaatattcctggttttgcttaccataaggcactcaaggct720

[0102] agaaaaaatctcgttgctatttttcaaacaatagtaactgcacgaaggaagcaaacaata780

[0103] gctaagaaagacatgttggatgctctgttggaagttgaagatgagcatggtagaagattg840

[0104] aatgatgaagaaatcattgatgttctggttatgtacttgaatgctggtcatgaatcttct900

[0105] ggccacatcacaatgtgggctgctatttttcttcaagaacacccagaattcttccaaaga960

[0106] gcaaaggaagagcaagaaagaattgtaaagaatagacccccaacacaaaaagggttgacg1020

[0107] cttaaagaaattcgacaaatggagtatctttccaaggcaatcgatgaaacacttcgtttg1080

[0108] gtaacattttcattagtggt tttccgtgaggcaaaagatgatgtcaagattagtggttat1140

[0109] accattcccaagggatggaaagttctggtttggtttaggagtgttcacttggatcctgaa1200

[0110] atatatcctgacccaaaggaattcaatccttccagatgggatgaccacacacccaaagca1260

[0111] ggaactttccttccctttggaggaggaagcaggatgtgcccgggaaatgaccttgccaag1320

[0112] ctagagatttctattttcctacactattttctcctcaattacaagcttgaaaggaataat1380

[0113] cctcagtgcccgctaagatatttaccacattcaaggccgacagataattgtttgggaaga1440

[0114] atcagaaaagtatcagctccatctgtataa1470

[0115] Sequence number (ID): 2

[0116] Length: 250

[0117] Molecular type: DNA

[0118] Feature Location / Qualifier:

[0119] - source, 1..250

[0120] >mol_type, other DNA[[ID=4{0]]

[0121] >organism, artificial sequence

[0122] Residues:

[0123] caatagctaagaaagacatgttggatgctctgttggaagttgaagatgagcatggtagaa60

[0124] gattgaatgatgaagaaatcattgatgttctggttatgtacttgaatgctggtcatgaat120

[0125] cttctggccacatcacaatgtgggctgctatttttcttcaagaacacccgaattcttcc180

[0126] aaagagcaaaggaagagcaagaaagaattgtaaagaatagacccccaacacaaaaagggt240

[0127] tgacgcttaa250

[0128] Serial Number (ID): 3

[0129] Length: 20

[0130] Molecular type: DNA

[0131] Feature location / qualifier:

[0132] - source, 1..20

[0133] >mol_type, other DNA

[0134] >Organism, artificial sequence

[0135] residues:

[0136] atggaggagctggtgggtat20

[0137] Serial Number (ID): 4

[0138] Length: 26

[0139] Molecular type: DNA

[0140] Feature location / qualifier:

[0141] - source, 1..26

[0142] >mol_type, other DNA

[0143] >Organism, artificial sequence

[0144] residues:

[0145] gaaaagtatcagctccatctgtataa26

[0146] Serial Number (ID): 5

[0147] Length: 48

[0148] Molecular type: DNA

[0149] Feature location / qualifier:

[0150] - source, 1..48

[0151] >mol_type, other DNA

[0152] >Organism, artificial sequence

[0153] residues:

[0154] gtgagtaaggttaccgaattccaatagctaagaaagacatgttggatg48

[0155] Serial Number (ID): 6

[0156] Length: 43

[0157] Molecular type: DNA

[0158] Feature location / qualifier:

[0159] - source, 1..43

[0160] >mol_type, other DNA

[0161] >Organism, artificial sequence

[0162] residues:

[0163] gggacatgcccgggcctcgagttaagcgtcaaccctttttgtg43

[0164] Serial Number (ID): 7

[0165] Length: 22

[0166] Molecular type: DNA

[0167] Feature location / qualifier:

[0168] - source, 1..22

[0169] >mol_type, other DNA

[0170] >Organism, artificial sequence

[0171] residues:

[0172] ctgggagatgatacgctgtttg22

[0173] Serial Number (ID): 8

[0174] Length: 23

[0175] Molecular type: DNA

[0176] Feature location / qualifier:

[0177] - source, 1..23

[0178] >mol_type, other DNA

[0179] >Organism, artificial sequence

[0180] residues:

[0181] acctaaaacttcagacacggatc23

[0182] Serial Number (ID): 9

[0183] Length: 24

[0184] Molecular type: DNA

[0185] Feature location / qualifier:

[0186] - source, 1..24

[0187] >mol_type, other DNA

[0188] >Organism, artificial sequence

[0189] residues:

[0190] actgaatcacttgcgctaatcaac24

[0191] Serial Number (ID): 10

[0192] Length: 24

[0193] Molecular type: DNA

[0194] Feature location / qualifier:

[0195] - source, 1..24

[0196] >mol_type, other DNA

[0197] >Organism, artificial sequence

[0198] residues:

[0199] aacagagttcacgtccttaaatcc24

[0200] END

Claims

1. A method for dwarfing peonies based on gene silencing technology, characterized in that, Includes the following steps: 1) The peony gibberellin synthase gene was cloned. PlKAO ; 2) Using the tobacco brittle virus TRV plasmid as a vector, peony root... PlKAO The non-conserved domain fragment of the gene was inserted between the EcoR1 and Xho1 restriction sites of the TRV2 plasmid to obtain the recombinant plasmid PlKAO / TRV2. 3) Design primers near the multiple cloning site of the TRV2 vector to identify the sequence of the recombinant plasmid; 4) The recombinant expression vector PlKAO / TRV2 was heat-shocked and transformed into Agrobacterium competent cells EHA105 to obtain a transgenic strain; 5) Select the identified positive clones, culture them in LB liquid antibiotic medium by shaking, then resuspend them in a resuspension solution and measure the absorbance (OD). 600 =0.8, TRV1 and TRV2, PlKAO / TRV2 were mixed at a volume ratio of 1:1 and left to stand in the dark for 3 hours; 6) In March of that year, peony tubers that had not yet emerged from the ground were dug up from the base. The plump buds on them had already elongated. The buds of the peony tubers that had broken dormancy were immersed in the Agrobacterium solution in step 5) and subjected to negative pressure vacuum infection. 7) Transfer the infected peony tubers to a culture medium and place them in a greenhouse for potted cultivation; 8) Primers were designed on both sides of the coat protein in the TRV2 vector. Peony leaves infected with the empty TRV1 / TRV2 vector were used as a control group to detect the reporter gene in the transgenic peony leaves. coat protein The expression and PlKAO Relative expression levels are used to identify positive plants; 9) After 30 days of pot culture, the plant height phenotype of peony plants was observed and statistically analyzed; the non-conservative domain fragment mentioned in step 2) is as shown in SEQ ID No:2; the resuspension mentioned in step 5) is 1mM MES + 1mM MgCl2 + 0.2mM AS.

2. The method for dwarfing peony based on gene silencing technology according to claim 1, characterized in that, The peony gibberellin synthase gene described in step 1) PlKAO The nucleotide sequence is shown in SEQ ID No:

1.

3. The method for dwarfing peony based on gene silencing technology according to claim 1, characterized in that, The primers mentioned in step 3) are the forward primer TRV2-F as shown in SEQ ID NO:7 and the reverse primer TRV2-R as shown in SEQ ID NO:

8.

4. The method for dwarfing peony based on gene silencing technology according to claim 1, characterized in that, The peony tuber mentioned in step 6) refers to a peony tuber with plump buds that have elongated but have not yet emerged from the soil.

5. The method for dwarfing peony based on gene silencing technology according to claim 1, characterized in that, The primers mentioned in step 8) are the forward primer CP-F as shown in SEQ ID NO:9 and the reverse primer CP-R as shown in SEQ ID NO:

10.

6. The method for dwarfing peony based on gene silencing technology according to claim 1, characterized in that: During the infection process, a vacuum was drawn at a pressure of 80 kPa, and the infection time was 30 min. After maintaining the pressure for 15 min, the air was slowly released for 15 min.

7. The method for dwarfing peony based on gene silencing technology according to claim 1, characterized in that: The identification of positively transformed plants used reporter genes. coat protein Semi-quantitative identification, detection of relative expression levels of target genes, and statistical analysis of plant height.

Images