A method for detecting the neurotoxicity of pesticide mixed pollutants, a kit and an application thereof

Abstract

The present application relates to the field of food detection, in particular to a method and kit for detecting pesticide mixed pollution in food and application thereof.The method for detecting the neurotoxicity of pesticide mixed pollutants in the present application is mixed pollution of chlorpyrifos and difenacoum; the method comprises: detecting GPX4 gene and FTH1 gene; preferably, isothermal amplification technology is used to detect GPX4 gene and FTH1 gene.The present application aims at the problem that the joint toxicity effect of mixed pollutants and target molecules are not clear, by establishing a toxicity effect evaluation cell model, using transcriptome sequencing combined with bioinformatics to obtain clear multi-target molecules.In order to overcome the defects of PCR technology, isothermal amplification technology is preferably used to detect target molecules.

Description

Technical Field

[0001] This invention relates to the field of food testing, and more specifically, to a method, kit, and application for detecting the neurotoxicity of mixed pesticide contaminants. Background Technology

[0002] Currently, food production and storage often require the use of various pesticides, fungicides, and antimicrobial veterinary drugs, which enter the human body through multiple routes, posing potential health hazards. At present, the analysis of the impact of pesticide pollution on human health in my country is mainly based on the toxicity standards or experimental results of individual components. However, the harm caused by combined exposure to pesticides differs from that caused by individual pesticides; the interaction of mixed pollutants may produce more severe combined toxic effects. In recent years, the U.S. Environmental Protection Agency (USEPA) and the European Food Safety Authority (EFSA) have both published cumulative risk assessment reports on organophosphates, carbamates, and triazole fungicides in food, drinking water, and other routes. EU Regulation (EC) 396 / 2005 stipulates that when setting maximum residue limits for pesticides, the synergistic effect of multiple pesticide residues should be considered, and a cumulative risk assessment method should be used to evaluate the safety of multiple pesticides.

[0003] Therefore, establishing a broad-spectrum screening and monitoring technology based on the combined effects of toxicity to achieve efficient identification of the combined toxicity target molecules of mixed pollutants is of great and urgent practical significance.

[0004] Polymerase chain reaction (PCR) is a widely used method for in vitro nucleic acid amplification. However, because this technology relies on thermal cycling, it places strict requirements on experimental conditions and operators, making it unsuitable for off-site implementation. Therefore, there is an urgent need to develop a high-throughput, accurate, stable, and sensitive screening method.

[0005] In view of this, the present invention is proposed. Summary of the Invention

[0006] The primary objective of this invention is to provide a method for detecting the neurotoxicity of pesticide mixtures.

[0007] The second objective of this invention is to provide a kit for the neurotoxicity of pesticide mixtures.

[0008] A third objective of this invention is to provide the application of the GPX4 and FTH1 genes in the detection of neurotoxicity of pesticide contaminants.

[0009] The fourth objective of this invention is to provide the application of ferroptosis star proteins NRF2, 4F2hc, SCL7A11, SCL11A2, GPX4, and FTH1 in the detection of neurotoxicity of pesticide contaminants.

[0010] To achieve the objective of this invention, the technical solution adopted is as follows:

[0011] This invention proposes a method for detecting the neurotoxicity of mixed pesticide contaminants, wherein the mixed pesticide contaminant is a mixture of chlorpyrifos and difenoconazole;

[0012] The method includes: detecting the GPX4 gene and the FTH1 gene;

[0013] Preferably, isothermal amplification technology is used to detect the GPX4 gene and the FTH1 gene.

[0014] Optionally, the primers used for isothermal amplification to detect the GPX4 and FTH1 genes are shown in SEQ ID NO:1 to SEQ ID NO:11.

[0015] Optionally, the reaction temperature for the isothermal amplification is 63–68°C, preferably 65°C;

[0016] And / or, the reaction time for the isothermal amplification is 25-35 min, preferably 30 min;

[0017] And / or, the mass percentage concentration of the nucleic acid gel used in the isothermal amplification reaction is 0.8% to 1.5%, preferably 1.2%.

[0018] Optionally, the sample to be tested is RNA.

[0019] Preferably, the concentration of RNA in the sample to be tested is 1–10 ng / μL, and more preferably 5 ng / μL.

[0020] This invention relates to a kit for detecting the neurotoxicity of mixed pesticide contaminants, the kit comprising: an isothermal amplification reagent, a positive control sample, and a negative control sample;

[0021] The isothermal amplification reagent contains primers as shown in SEQ ID NO:1 to SEQ ID NO:11.

[0022] Optionally, in the isothermal amplification reagent, the molar ratio of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6 is 1:1:8:8:2:2; and the molar ratio of SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11 is 1:1:8:8:4.

[0023] Preferably, the concentration of the primers is 100 μM, and the volume ratio of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 to sterile enzyme-free water is 1:1:8:8:2:2:18; the volume ratio of SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11 to sterile enzyme-free water is 1:1:8:8:4:18.

[0024] Optionally, the positive control sample is cellular genomic RNA of SH-SY5Y cells after exposure to chlorpyrifos and difenoconazole alone or in combination, at a concentration of 5 ng / μL;

[0025] The negative control sample was genomic RNA from SH-SY5Y cells that had not been exposed to pesticides, at a concentration of 5 ng / μL.

[0026] Optionally, the concentration of the sample to be tested in the isothermal amplification reagent is 10–100 ng / 10 μL; preferably 50 ng / 10 μL.

[0027] Preferably, the isothermal amplification reagent consists of: 2.5 μL 10-fold buffer, 1.5 μL magnesium sulfate, 3.5 μL dNTP, 1 μL primer mixture, 1 μL Bst DNA polymerase, and 16.5 μL sterile enzyme-free water.

[0028] This invention relates to the application of the GPX4 and FTH1 genes in the detection of neurotoxicity of pesticide mixtures.

[0029] This invention relates to the application of ferroptosis star proteins NRF2, 4F2hc, SCL7A11, SCL11A2, GPX4, and FTH1 in the detection of neurotoxicity of pesticide mixtures.

[0030] The present invention has at least the following beneficial effects:

[0031] This invention addresses the problem of unclear combined toxic effects of mixed pollutants and the lack of defined target molecules. It establishes a cellular model for evaluating toxic effects and utilizes transcriptomics sequencing combined with bioinformatics to obtain clearly defined multi-target molecules. To overcome the limitations of PCR technology, isothermal amplification technology is employed to detect the target molecules.

[0032] The advantages of isothermal amplification-based detection technology for mixed pesticide contamination in food are high specificity, high sensitivity, and low cost. Clinical use does not require special instruments; it does not require long-term temperature cycling, expensive instruments such as PCR, or laboratory specialists. It is simple to operate and can achieve visualized detection of neurotoxicity. Attached Figure Description

[0033] Figure 1 This is a graph showing the results of the GPX4 isothermal amplification reaction in Example 2;

[0034] Figure 2 This is a graph showing the results of the FTH1 isothermal amplification reaction in Example 2;

[0035] Figure 3 The image shows the results of qPCR verification of GPX4 expression in Example 2. In the image, A is the control group, B is chlorpyrifos (200 μM), C is difenoconazole (100 μM), and D is chlorpyrifos + difenoconazole (200 μM + 100 μM).

[0036] Figure 4 The image shows the results of qPCR verification of FTH1 expression in Example 2. In the image, A is the control group, B is chlorpyrifos (200 μM), C is difenoconazole (100 μM), and D is chlorpyrifos + difenoconazole (200 μM + 100 μM).

[0037] Figure 5 Cell viability of SH-SY5Y cells treated with chlorpyrifos;

[0038] Figure 6 Cell viability of SH-SY5Y cells treated with difenoconazole;

[0039] Figure 7 Venn diagram for differentially expressed genes;

[0040] Figure 8 This is a volcano diagram of differentially expressed genes, where genes to the left of the dashed line are downregulated genes and genes to the right of the dashed line are upregulated genes.

[0041] Figure 9 Heatmap of differentially expressed genes;

[0042] Figure 10 Scatter plot of KEGG enrichment for differentially expressed genes;

[0043] Figure 11The purpose of qPCR was to verify the upregulation of gene expression in SY-5Y cells by transcriptomics sequencing. Among them, A was the control group, B was chlorpyrifos (200 μM), C was difenoconazole (100 μM), D was chlorpyrifos + difenoconazole (200 μM + 100 μM), E was chlorpyrifos (100 μM), F was difenoconazole (50 μM), and G was chlorpyrifos + difenoconazole (100 μM + 50 μM).

[0044] Figure 12 Western blot was used to detect the expression of ferroptosis-related proteins;

[0045] Figure 13 The results are from the isothermal amplification of the template amount screening experiment. Detailed Implementation

[0046] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0047] It should be noted that the terminology used herein is for the purpose of describing particular implementations only and is not intended to limit the exemplary implementations according to this application. As used herein, the singular form includes the plural form unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this description, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.

[0048] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0049] This invention proposes a method for detecting the neurotoxicity of mixed pesticide contaminants, wherein the mixed pesticide contamination is a mixture of chlorpyrifos and difenoconazole; the target molecules to be detected are neurotoxic target molecules. This invention establishes cell models of individual and mixed exposure to chlorpyrifos and difenoconazole by selecting appropriate environmental exposure concentrations. Through transcriptomic sequencing, and further combined with bioinformatics analyses such as KEGG analysis, the target molecules were screened and identified as the GPX4 and FTH1 genes. Compared to the negative control group, using the GPX4 and FTH1 genes as target molecules for detection, the group with positive toxicity screening will show bright bands, and the higher the toxicity level, the brighter the band, thus obtaining the screening results for the combined neurotoxicity of the mixed pesticide contaminants. By detecting the GPX4 and FTH1 genes, the toxic effects of mixed chlorpyrifos and difenoconazole on the nervous system can be detected.

[0050] This invention further establishes a detection method for the GPX4 and FTH1 genes using isothermal amplification technology, for detecting the neurotoxicity of pesticide mixtures. Primers for isothermal amplification of the GPX4 and FTH1 genes are shown in SEQ ID NO:1 to SEQ ID NO:11. The key to LAMP lies in primer design; highly specific primers are crucial for the success of the LAMP experiment. When designing primers, identifying the six specific regions F3, F2, F1, B1, B2, and B3 on the target gene is necessary and paramount. Based on these six specific regions, four primers are designed: one pair of external primers and one pair of internal primers. The external primers define the amplification range and provide a template for the internal primers. The external primers consist of an upstream external primer (F3) composed of the F3 region on the target gene and a downstream external primer (B3) composed of the B3 region on the target gene; the internal primers consist of a forward internal primer (FIP) composed of F1c and F2 and a reverse internal primer (BIP) composed of B1c and B2.

[0051] The LAMP primer design is shown in Table 1:

[0052] Table 1: LAMP primer design

[0053] SEQ ID NO:1 F3-GPX4 upstream external primers ggcacatggttaacctgga SEQ ID NO:2 B3-GPX4 Downstream external primers tctcttcgttactccctggc SEQ ID NO:3 FIP-GPX4 Forward inner primer aggtcgacgagctgagtgtagtcttcgtgtgcatcgtcacc SEQ ID NO:4 BIP-GPX4 Reverse inner primer cacgcccgatacgctgagtgtcctgcttcccgaactgg SEQ ID NO:5 LF-GPX4 circular primers tcggtcttgcctcactgg SEQ ID NO:6 LB-GPX4 circular primers cctggccttcccgtgtaa SEQ ID NO:7 F3-FTH1 upstream external primers tccatctccatgggcgag SEQ ID NO:8 B3-FTH1 Downstream external primers tactcccgggcacgct SEQ ID NO:9 FIP-FTH1 Forward inner primer cacggacaacgctgtcgatctaagtgtgtcctccacgtcat SEQ ID NO:10 BIP-FTH1 Reverse inner primer gacttcctggtgcagcagctgggcaactccacacagccaat SEQ ID NO:11 LF-FTH1 circular primers ggtacatgacagcaccgtt

[0054] According to the method for detecting the neurotoxicity of pesticide mixed pollutants according to embodiments of the present invention, the reaction temperature for isothermal amplification is 63-68°C, preferably 65°C;

[0055] Furthermore, the reaction time for isothermal amplification is 25–35 min, preferably 30 min;

[0056] Furthermore, the mass percentage concentration of the nucleic acid gel used in the isothermal amplification reaction is 0.8%–1.5%, preferably 1.2%. If the nucleic acid gel content is too low, the low molecular weight bands generated by the LAMP reaction will be difficult to distinguish; if the nucleic acid gel content is too high, the high molecular weight bands will be difficult to distinguish.

[0057] According to the method for detecting the neurotoxicity of mixed pesticide pollutants according to embodiments of the present invention, the test sample is RNA. The present invention has found through research that when the test sample is RNA, the bands are clearer and the detection sensitivity is higher.

[0058] Preferably, the concentration of RNA in the sample to be tested is 1–10 ng / μL, and more preferably 5 ng / μL.

[0059] According to an embodiment of the present invention, the test sample is prepared by the following method:

[0060] (1) Specifically, a commercially available RNA extraction kit can be used for extraction.

[0061] (2) Determine the concentration;

[0062] (3) Adjust to the same concentration for later use, preferably the concentration of RNA is 50 ng / μL.

[0063] This invention also proposes a kit for detecting the neurotoxicity of mixed pesticide contaminants, comprising: an isothermal amplification reagent, a positive control sample, and a negative control sample; the isothermal amplification reagent contains primers as shown in SEQ ID NO:1 to SEQ ID NO:11. The specific sequences of the primers are shown in Table 1.

[0064] In the isothermal amplification reagent, the primer concentration is:

[0065] In the isothermal amplification reagent, the molar ratio of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6 is 1:1:8:8:2:2; the molar ratio of SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11 is 1:1:8:8:4.

[0066] Preferably, the primer concentration is 100 μM, and the volume ratio of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, and sterile enzyme-free water is 1:1:8:8:2:2:18; the volume ratio of SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, and sterile enzyme-free water is 1:1:8:8:4:18. The positive control sample is cellular genomic RNA from SH-SY5Y cells exposed to chlorpyrifos and difenoconazole alone or in combination, at a concentration of 5 ng / μL.

[0067] The negative control sample was genomic RNA from SH-SY5Y cells that had not been exposed to pesticides, at a concentration of 5 ng / μL.

[0068] The concentration of the sample to be tested in the isothermal amplification reagent is 10–100 ng / 10 μL; preferably 50 ng / 10 μL; preferably, the isothermal amplification reagent consists of: 2.5 μL 10-fold buffer, 1.5 μL magnesium sulfate, 3.5 μL dNTP, 1 μL primer mixture, 1 μL Bst DNA polymerase and 16.5 μL sterile enzyme-free water.

[0069] This invention also proposes the application of the GPX4 and FTH1 genes in detecting the neurotoxicity of mixed pesticide contaminants. In this invention, by selecting suitable environmental exposure concentrations, cell models of individual and mixed exposure to chlorpyrifos and difenoconazole were established. Through transcriptomic sequencing, and further combined with bioinformatics analyses such as KEGG analysis, the target molecules were screened and identified as the GPX4 and FTH1 genes.

[0070] This invention also proposes the application of ferroptosis star proteins NRF2, 4F2hc, SCL7A11, SCL11A2, GPX4, and FTH1 in detecting the neurotoxicity of pesticide mixtures. Differentially expressed genes identified in Experiment 1 were analyzed using KEGG to determine the most important metabolic processes and signal transduction pathways involved. One ferroptosis signaling pathway was selected from the metabolic pathways primarily enriched by the differentially expressed genes for protein validation. The application of these ferroptosis star proteins in the neurotoxicity of pesticide mixtures was thus demonstrated.

[0071] Material:

[0072] Cell titer kit; F12 / DMEM, fetal bovine serum (FBS), and trypsin were purchased from Gibco; TRIZOL lysis buffer, anhydrous ethanol, chloroform, isopropanol, Prime Script™ RT kit, SYBR Premix Ex Taq™ II kit, 10×TBST buffer (Solepro, China), Western primary antibody dilution buffer (Zhuangmeng Biotechnology, China), blocking-specific skim milk powder (Sigma, USA), RIPA lysis buffer (strong) (Beyotime, China), Ferrotosis Antibody Sampler Kit (CST, USA), horseradish enzyme-labeled goat anti-rabbit IgG (CST, USA), protein marker (Thermo, USA), 5× loading buffer (Solepro, China), chemiluminescent developing solution (Millipore, USA), PVDF membrane (Millipore, USA), 50× cocktail (Solepro, China), and phosphatase inhibitor (Solepro, China).

[0073] NRF2, 4F2hc, SCL7A11, SCL11A2, and FTH1 (Rabbit mAb) were purchased from Cell Signaling Technology, USA. GPX4 (Antibody) and Anti-rabbit IgG were purchased from Cell Signaling Technology, USA.

[0074] PCR primers and LAMP primers for the target gene were synthesized by Shanghai Sangon Biotech Co., Ltd. Chlorpyrifos and difenoconazole pesticide standards were purchased from DRE. Bst 3.0 DNA Polymerase (NEB, USA), Magnesium Sulfate (MgSO4) Solution (NEB, USA), Deoxynucleotide (dNTP) Solution Mix (NEB, USA); DNA polymerase (NEB, USA), magnesium ion buffer (NEB, USA), and deoxyribonucleic acid (NEB, USA). Agarose (Biowest, France), DNA Marker I (Tiangen, China), D2000 (Tiangen, China), and DNA electrophoresis loading buffer (bromophenol blue / xylenecyanide) (Tiangen, China).

[0075] Unless otherwise specified in the examples, the procedures should be performed under standard conditions or conditions recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0076] Example 1 Reagent Kit

[0077] The components of the kit are shown in Table 2:

[0078] Table 2

[0079]

[0080]

[0081] After the primers are designed, dissolve each tube of primers in DEPC water according to the instructions, and then prepare PrimerMIX (25×) according to the table below:

[0082] Table 3 Primer mixture preparation system (25×)

[0083] SEQ ID NO:4, SEQ ID NO:10 10 μL each SEQ ID NO:6 2.5μL SEQ ID NO:1, SEQ ID NO:7 1.25 μL each SEQ ID NO:11 5μL SEQ ID NO:2, SEQ ID NO:8 1.25 μL each DEPC water 22.5μL

[0084] Example 2

[0085] The density of SY-5Y cells in logarithmic phase was adjusted to 2.0 × 10⁻⁶. 6 Cells were seeded at a density of 1 mL / mL in 10 cm culture dishes and incubated for 24 hours until the cell density reached approximately 70% to 80%. The culture medium was then discarded, and culture medium containing different concentrations of pesticides was added, followed by another 24 hours of incubation. After incubation, the culture dishes were removed, the pesticide-contaminated medium was discarded, and the cells were washed three times with pre-cooled PBS. 3 mL of Trizol lysis buffer was added to each culture dish to lyse the cells and extract RNA. Total RNA from each sample was quantified using a NanoDrop ND-1000 instrument, and the purity and concentration of the total RNA samples were determined. The experimental results are shown in Table 4.

[0086] Table 4

[0087] Comparison 1141.3 2.05 2.06 Chlorpyrifos group 2498.7 2.06 2.07 difenoconazole group 1309.8 2.03 2.09 Mixed group 709.1 2.02 1.98

[0088] Configure the LAMP amplification reaction system according to Table 5:

[0089] Table 5 LAMP amplification reaction system

[0090]

[0091]

[0092] After preparing the reaction system, it was placed in a PCR instrument for isothermal amplification and reverse transcription at 65℃ for 30 min. After reverse transcription, a 1.2% nucleic acid gel was prepared, and 10 μL of each sample was loaded for gel electrophoresis. The results are as follows: Figure 1 and Figure 2 As shown.

[0093] Depend on Figure 1 and Figure 2 It can be seen that, compared with the negative control group, the group with positive toxicity screening will show bright bands, and the higher the toxicity, the brighter the bands, thus obtaining the screening results of pesticide mixed pollutants combined with neurotoxicity.

[0094] Following the protocol of Experiment Example 2, the isothermal amplification screening results were validated by qPCR. The validation results are as follows: Figure 3 and Figure 4 As shown.

[0095] Depend on Figure 3 and Figure 4 It can be seen that, compared with the control group, exposure to SH-SY5Y cells, whether alone or in combination, can increase the expression levels of GPX4 and FTH1 mRNA, and this is more pronounced in the combination group, which is consistent with the LAMP screening results.

[0096] Example 1: Screening of target genes

[0097] This invention provides a method for screening target molecules of mixed pesticide and veterinary drug contaminants, the method comprising:

[0098] (1) The effects of chlorpyrifos and difenoconazole, alone and in combination, on cell viability were determined using the cell titer method. The cell density in the logarithmic growth phase was adjusted to 1.6 × 10⁻⁶. 4 Cells were seeded at a density of 100 μL / well in 96-well plates and incubated for 24 h until the cell density reached approximately 70% to 80%. The culture medium was then discarded, and culture medium containing different concentrations of pesticides was added for further incubation. After 24 h of incubation, 50 μL of cell titer reagent was added to each well, and the absorbance at 450 nm was measured using a microplate reader within 15 min. Cell viability curves were plotted, and the IC50 of pesticide exposure was calculated. 50 The cell viability of SY-5Y cells is as follows: Figure 5 and 6 As shown. Figure 5 Cell viability graph of SY-5Y cells treated with chlorpyrifos. Figure 6 Cell viability diagram of SY-5Y cells treated with difenoconazole.

[0099] (2) Take SY-5Y cells in the logarithmic growth phase and use 1×10 6Cells were seeded at a density of 1 / mL in large dishes and exposed to chlorpyrifos, difenoconazole, or chlorpyrifos + difenoconazole according to experimental groups. The cells were incubated for 24 hours. After exposure, the culture plates were removed, the exfoliating solution was discarded, and the cells were washed three times with pre-cooled PBS. Each dish was placed on ice with 3 mL of TRIZOL lysis buffer, and after complete lysis, transferred to 1.5 mL RNase-free EP tubes and stored at -80°C. Bioinformatics analysis, including total RNA extraction and quality control, library construction and sequencing, data filtering and quality control, and alignment with the reference genome, was performed by Beijing Novogene Technology Co., Ltd. according to standard experimental procedures and data analysis methods. Differentially expressed genes were screened by comparing the data of the experimental and control groups. These differentially expressed genes were compared with the KEGG database to obtain functional annotations. The bioinformatics analysis results of SY-5Y cells are shown below. Figures 7-10 As shown.

[0100] Depend on Figures 7-10 It was found that, compared with the control group, mixed exposure to chlorpyrifos and difenoconazole induced 1530 significantly differentially expressed genes, of which 839 genes were upregulated and 691 genes were downregulated. KEGG analysis showed that after mixed exposure, the differentially expressed genes were mainly enriched in metabolic pathways such as endoplasmic reticulum protein processing, steroid biosynthesis, and ferroptosis signaling pathways.

[0101] Experiment 2 PCR Validation

[0102] SY-5Y cells in the logarithmic growth phase were used at a concentration of 1×10⁻⁶. 6 Cells were seeded at a density of 1 / mL in 6-well plates, with 2mL of cell suspension added to each well. Once the cell density was appropriate, the cells were exposed to the drug according to the experimental groups. The culture plates were gently shaken and placed in an incubator for 24 hours of exposure. After the exposure period, the culture plates were removed, the drug solution was discarded, and the cells were washed twice with pre-cooled PBS. RNA was extracted from the cells using Trizol reagent and processed according to Prime Script. TM The RT kit instructions describe reverse transcription of RNA samples into cDNA. The reverse transcription conditions are: 37°C for 30 min; 85°C for 10 sec; store at 4°C; and store at -20°C after cooling.

[0103] Differentially upregulated genes from Experiment Example 2 were selected for RT-qPCR analysis. Primers are shown in Table 6.

[0104] Table 6. Primer sequences for the target gene (SY-5Y)

[0105]

[0106] RT-qPCR was performed on an ABI Real-Time PCR instrument. The RT-qPCR reaction system was prepared according to the SYBR Premix ExTaq standard. TM Prepare the kit according to the instructions, using a 10 μL amplification volume. Amplification conditions: 95℃, 30 s; 95℃, 5 s, 40 cycles; 60℃, 31 s. Melting curve assay: 95℃, 15 s; 60℃, 1 min; 95℃, 15 s. All qRT-PCR data were analyzed using 2... -ΔΔCT The method was used for processing. The results of qRT-PCR verification of differentially expressed upregulated target genes in SY-5Y cells are as follows: Figure 11 As shown.

[0107] Depend on Figure 11 It can be seen that the expression levels of ASNS, DDIT3, OSCAR and other mRNAs in each group were upregulated by qRT-PCR.

[0108] Experimental Example 3

[0109] The differentially expressed genes identified in Experiment 1 were analyzed using KEGG to determine the most important metabolic processes and signal transduction pathways involved. One ferroptosis signaling pathway was selected from the metabolic pathways primarily enriched by the differentially expressed genes for protein validation.

[0110] The density of SY-5Y cells in logarithmic phase was adjusted to 2.0 × 10⁻⁶. 6 Cells / mL: 1 mL of cell solution was inoculated into each 10 cm culture dish and incubated for 24 h until the cell density was about 70% to 80%. The culture medium was then discarded and cultured again for another 24 h with culture medium containing different concentrations of pesticides.

[0111] After the culture is complete, remove the culture dish, discard the contaminated solution, wash the cells three times with pre-cooled PBS, add 500 μL of lysis buffer to each culture dish, place the cells on ice for 3-5 min to lyse, scrape the cells to one side with a cell scraper, and aspirate the lysis buffer from the culture dish into a 2 mL centrifuge tube.

[0112] Add 125 μL of protein loading buffer to each culture dish, repeatedly pipette the mixture, boil at 100°C for 10 min, centrifuge at 14000g for 15 s at 4°C, aliquot and freeze at -80°C.

[0113] Electrophoresis: Take 20 μL of protein samples from each group, select a pre-made gel with a concentration of 8-16%, and electrophore at room temperature with a constant voltage of 70V until the marker bands separate. Then adjust the voltage to 100V and stop electrophoresis when the bromophenol blue is close to the bottom of the separating gel.

[0114] Transfer: Before transfer, the PVDF membrane was soaked in methanol for 15 seconds; a semi-dry transfer method was used, with a constant current of 200mA for about 60 minutes, and the protein was transferred from the polyacrylamide gel to the 0.20μm PVDF membrane.

[0115] Sealing: The PVDF membrane was sealed with a 5% sealing solution at room temperature for 1 hour.

[0116] Incubation with antibodies (NRF2, 4F2hc, SCL7A11, SCL11A2, FTH1 (Rabbit mAb); GPX4 (Antibody)): After blocking, wash the membrane three times rapidly with TBST, 5-10 min each time. Prepare an appropriate concentration of primary antibody incubation solution according to the antibody instructions, and incubate overnight at 4°C. Wash the membrane three times with TBST, 5-10 min each time, and then incubate at room temperature for 1 h with the appropriate concentration of the corresponding secondary antibody incubation solution (Anti-rabbit IgG). Wash the membrane three more times with TBST, 5-10 min each time.

[0117] Luminescent development: Add an appropriate amount of luminescent developing solution to the cleaned PVDF membrane and observe the results in a gel imaging system.

[0118] ImageJ software was used to adjust the loading amount of each sample based on the grayscale value of the internal control band. Electrophoresis experiments were then performed based on the adjusted loading amounts for each group, and the results were observed according to different protein sizes. The expression of key ferroptosis proteins in SY-5Y cells is shown below. Figure 12 As shown.

[0119] Depend on Figure 12 It was found that the expression levels of NRF2, 4F2hc / CD98, SCL7A11 / xCT, SCL11A2 / DMT1, GPX4, and FTH1 proteins related to the ferroptosis signaling pathway were increased.

[0120] Experiment Example 4 Template Quantity Screening Experiment

[0121] Following the method in Example 2, the template amount was changed to 5ng, 10ng, 20ng, 50ng, and 100ng, and the isothermal amplification results were obtained as follows: Figure 13 As shown.

[0122] Figure 13In the experiment, the seven vertical bands were 500bp linear DNA marker, 2000bp linear DNA marker, template amount 5ng, template amount 10ng, template amount 20ng, template amount 50ng, and template amount 100ng. The results showed that the bands with template amounts of 5ng, 10ng, and 20ng were less bright than the band with template amount of 50ng, and the band with template amount of 100ng had increased impurities and less specificity than the band with template amount of 50ng.

[0123] Based on the optimization results of the sample loading conditions, the optimal sample loading volume is 50 ng / 10 μL.

[0124] Although this application discloses preferred embodiments as described above, it is not intended to limit the claims. Any person skilled in the art can make several possible changes and modifications without departing from the concept of this application. Therefore, the scope of protection of this application should be determined by the scope defined in the claims of this application. sequence list <120> A method, kit, and application for detecting the neurotoxicity of mixed pesticide contaminants. <160> twenty three <170> SIPOSequenceListing 1.0 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence <400> 1 ggcacatggt taacctgga 19 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <400> 2 tctcttcgtt actccctggc 20 <210> 3 <211> 41 <212> DNA <213> Artificial Sequence <400> 3 aggtcgacga gctgagtgta gtcttcgtgt gcatcgtcac c 41 <210> 4 <211> 38 <212> DNA <213> Artificial Sequence <400> 4 cacgcccgat acgctgagtg tcctgcttcc cgaactgg 38 <210> 5 <211> 18 <212> DNA <213> Artificial Sequence <400> 5 tcggtcttgc ctcactgg 18 <210> 6 <211> 18 <212> DNA <213> Artificial Sequence <400> 6 cctggccttc ccgtgtaa 18 <210> 7 <211> 18 <212> DNA <213> Artificial Sequence <400> 7 tccatctcca tgggcgag 18 <210> 8 <211> 16 <212> DNA <213> Artificial Sequence <400> 8 tactcccggg cacgct 16 <210> 9 <211> 41 <212> DNA <213> Artificial Sequence <400> 9 cacggacaac gctgtcgatc taagtgtgtc ctccacgtca t 41 <210> 10 <211> 41 <212> DNA <213> Artificial Sequence <400> 10 gacttcctgg tgcagcagct gggcaactcc acacagccaa t 41 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <400> 11 ggtacatgac agcaccgtt 19 <210> 12 <211> twenty one <212> DNA <213> Artificial Sequence <400> 12 tctccaaagg aggttacctg c 21 <210> 13 <211> twenty two <212> DNA <213> Artificial Sequence <400> 13 agactcccct cagtaaagtg ac 22 <210> 14 <211> 19 <212> DNA <213> Artificial Sequence <400> 14 gaaccctggt tacctgggc 19 <210> 15 <211> twenty two <212> DNA <213> Artificial Sequence <400> 15 cgcagcaagt attcaaggtt gt 22 <210> 16 <211> twenty one <212> DNA <213> Artificial Sequence <400> 16 ggaaacagag tggtcattcc c 21 <210> 17 <211> twenty one <212> DNA <213> Artificial Sequence <400> 17 ctgcttgagc cgttcattct c 21 <210> 18 <211> twenty one <212> DNA <213> Artificial Sequence <400> 18 ggaagacagc cccgatttac t 21 <210> 19 <211> twenty two <212> DNA <213> Artificial Sequence <400> 19 agcacgaact gttgtaatgt ca 22 <210> 20 <211> twenty one <212> DNA <213> Artificial Sequence <400> 20 gatgtgggaa ttgttgccct t 21 <210> twenty one <211> twenty three <212> DNA <213> Artificial Sequence <400> twenty one attgtctctg ttccaacttc cag 23 <210> twenty two <211> twenty one <212> DNA <213> Artificial Sequence <400> twenty two tcactccgtc tgccgtttat t 21 <210> twenty three <211> 20 <212> DNA <213> Artificial Sequence <400> twenty three gcagcggtaa attccccctt 20

Claims

1. A method for detecting the neurotoxicity of pesticide mixtures, characterized in that, This detection method is used to detect mixed contamination of pesticides such as chlorpyrifos and difenoconazole. The detection method includes: detecting the GPX4 and FTH1 genes in SH-SY5Y cells exposed to chlorpyrifos and difenoconazole; Primers for isothermal amplification of the GPX4 and FTH1 genes are shown in SEQ ID NO:1 ~ SEQ ID NO:

11. Compared to the negative control group, the GPX4 and FTH1 genes were used as target molecules for detection. During the test, the group that tested positive for toxicity screening would show bright bands, and the higher the toxicity level, the brighter the band. The toxic effects of mixed contamination of chlorpyrifos and difenoconazole on the nervous system were detected by the brightness of the bands.

2. The method according to claim 1, characterized in that, The reaction temperature for isothermal amplification is 63~68℃; The reaction time for isothermal amplification is 25 to 35 minutes. The mass percentage concentration of the nucleic acid gel used in the isothermal amplification reaction is 0.8% to 1.5%.

3. The method according to claim 1, characterized in that, The test sample is RNA, and the concentration of RNA in the test sample is 1 ~ 10 ng / μL.

4. A kit for detecting the neurotoxicity of mixed pesticide contaminants, characterized in that, The kit includes: isothermal amplification reagent, positive control sample and negative control sample, for detecting mixed contamination of chlorpyrifos and difenoconazole in pesticide mixed contamination; The isothermal amplification reagent contains the following primers: F3-GPX4 upstream external primer SEQ ID NO:1, B3-GPX4 downstream external primer SEQ ID NO:2, FIP-GPX4 forward internal primer SEQ ID NO:3, BIP-GPX4 reverse internal primer SEQ ID NO:4, LF-GPX4 circular primer SEQ ID NO:5, and LB-GPX4 circular primer SEQ ID NO:

6. F3-FTH1 upstream external primer SEQ ID NO:7, B3-FTH1 downstream external primer SEQ ID NO:8, FIP-FTH1 forward internal primer SEQ ID NO:9, BIP-FTH1 reverse internal primer SEQ ID NO:10, LF-FTH1 circular primer SEQ ID NO:

11.

5. The reagent kit according to claim 4, characterized in that, In the isothermal amplification reagent, the molar ratio of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6 is 1:1:8:8:2:2; and the molar ratio of SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11 is 1:1:8:8:

4.

6. The reagent kit according to claim 4, characterized in that, The positive control samples were cellular genomic RNAs from SH-SY5Y cells exposed to chlorpyrifos and difenoconazole alone or in combination, at a concentration of 5 ng / μL. The negative control sample was genomic RNA from SH-SY5Y cells that had not been exposed to pesticides, at a concentration of 5 ng / μL.

7. The reagent kit according to claim 4, characterized in that, The concentration of the sample to be tested in the isothermal amplification reagent is 10 ~ 100 ng / 10 μL.

8. The reagent kit according to claim 7, characterized in that, The isothermal amplification reagent consists of: 2.5 μL 10-fold buffer, 1.5 μL magnesium sulfate, 3.5 μL dNTP, 1 μL primer mixture, 1 μL Bst DNA polymerase, and 16.5 μL sterile enzyme-free water.

Images