Snp marker of bitter gourd resistance to meloidogyne incognita and application thereof

Abstract

The application discloses a SNP marker for resistance to Meloidogyne incognita in Momordica charantia and application thereof. The application identifies the resistance of different Momordica charantia germplasms to Meloidogyne incognita, and locates a SNP marker linked to the resistance to Meloidogyne incognita by combining whole genome resequencing technology. The location of the SNP marker on a chromosome is Chr8-32381360, and the SNP marker is located in the coding region of a McRBK2 gene. Further, a special primer pair for convenient detection is developed for the SNP site, and the primer pair is verified to be capable of accurately detecting the genotypes of different Momordica charantia germplasms at the site, and can be used for molecular marker assisted selection in breeding of Momordica charantia resistant to Meloidogyne incognita.

Description

Technical Field

[0001] This invention relates to the field of molecular biology, and in particular to a SNP marker for resistance to root-knot nematode disease in bitter melon and bean. Background Technology

[0002] Root-knot nematodes are a type of plant-parasitic nematode distributed worldwide, accounting for 5% of total annual losses in important economic crops caused by root-knot nematode disease. Currently, over 100 nematode species have been reported globally, with host plant species reaching 3,000. The elephant bean root-knot nematode was discovered in 1983 on elephant bean trees in Danzhou, Hainan, China. Subsequent studies have found that this nematode can also parasitize various economic crops such as peppers, watermelons, cucumbers, and bitter melons. Unlike other nematodes, the elephant bean root-knot nematode is not sensitive to nematode-resistant genes; it has been reported to parasitize tomato plants containing the Mi nematode-resistant gene. The elephant bean root-knot nematode has become a dominant nematode population in the tropical regions of southern my country, and how to effectively, economically, and environmentally control elephant bean root-knot nematode disease is a pressing issue that needs to be addressed.

[0003] Bitter melon is a cultivated species of the genus *Momordica* in the Cucurbitaceae family. Originally from India, it is widely grown in tropical, subtropical, and temperate regions and is an important vegetable used for both food and medicine. It is an annual vine-like herbaceous plant, monoecious with separate male and female flowers, and has a chromosome number of 2n=22. Other names include bitter melon, bitter grape, and bitter gourd. The young fruit is primarily eaten; it has distinct bumps and wrinkles on its surface, crisp and tender flesh, and a slightly bitter taste that stimulates appetite. Bitter melon has high nutritional value; every 100 grams of young fruit contains 0.9 grams of protein, as well as abundant vitamins, various amino acids, and carotene. Modern medical research has proven that bitter melon is rich in momordicin and momordicin, possessing effects such as lowering blood sugar, anti-cancer, antibacterial, and anti-inflammatory properties. The description of bitter melon's effects is: "When green, it is bitter and cold, clearing heat, brightening the eyes and calming the mind; when ripe, it nourishes the blood and liver, moistens the spleen and tonifies the kidneys."

[0004] Molecular markers are genetic markers based on genomic DNA variations among individuals, and are widely used in gene mapping, gene cloning, genetic diversity research, and breeding studies. Molecular markers include RAPD markers, STS markers, SSR markers, AFLP markers, SCAR markers, and CAP markers, among others. These markers have played a significant role in breeding as marker-assisted selection techniques; however, their limited number cannot fully meet the needs of scientific development. SNP markers, as third-generation molecular markers, are abundant; it is estimated that an SNP occurs approximately every 1000 bp in the human genome. SNP markers are numerous, widely distributed, and can be detected with high throughput, playing an increasingly important role in crop breeding and functional genomics research. Summary of the Invention

[0005] In view of this, the present invention provides a SNP marker for resistance to root-knot nematode disease in bitter gourd and its application. Using this invention, DNA is extracted and amplified by PCR during the bitter gourd seedling stage, and the resistance of tested plants to root-knot nematode disease is detected by agarose gel electrophoresis. This invention can provide support for the application of molecular marker-assisted breeding technology in bitter gourd breeding.

[0006] This invention identifies a resistance SNP marker for bitter gourd root-knot nematode disease by identifying different bitter gourd germplasms and performing genome-wide association analysis. The SNP marker is located at Chr8-32381360 on the chromosome and is located at the 1014th base (G / T) in the coding region of the McRBK2 gene.

[0007] Sequences containing the aforementioned SNP sites are shown in SEQ ID NO:4 (Seq I) and SEQ ID NO:5 (Seq II) in the sequence listing. The SNP site is located at position 251 of the sequence shown in SEQ ID NO:4 or SEQ ID NO:5.

[0008] Furthermore, the present invention also provides a primer pair for amplifying the above-mentioned SNP marker, including primer pair I and primer pair II, wherein primer pair I includes primer Chr8-32381360F-G and primer Chr8-32381360R, and primer pair II includes primer Chr8-32381360F-CT and primer Chr8-32381360R;

[0009] The nucleotide sequence of primer Chr8-32381360F-G is: CTGTTTGATGCAGATACTTCGCG;

[0010] The nucleotide sequence of primer Chr8-32381360R is: AGAGGCTTTGCCTGAAATGA;

[0011] The nucleotide sequence of primer Chr8-32381360F-CT is: CTGTTTGATGCAGATACTCCGCT.

[0012] Furthermore, the present invention provides the application of the SNP marker or the primer pair in identifying resistance to root-knot nematode disease in bitter gourd and bean.

[0013] The method for determining the resistance of bitter gourd to root-knot nematode disease includes: amplifying bitter gourd genomic DNA using the primer pairs described above. If the product amplified by primer pair I has a band but the product amplified by primer pair II has no band, it indicates that the DNA sample to be tested is of the G / G genotype, and the material to be tested is susceptible (low resistance). If the product amplified by primer pair I has no band but the product amplified by primer pair II has a band, it indicates that the DNA sample to be tested is of the T / T genotype, and the material to be tested is highly resistant. If the product amplified by primer pair I has a band and the product amplified by primer pair II also has a band, it indicates that the DNA sample to be tested is of the G / T genotype, and the material to be tested is susceptible (moderate resistance).

[0014] Compared with the prior art, the beneficial effects of the present invention are:

[0015] This invention provides a SNP marker for resistance to root-knot nematode disease in bitter gourd and *Heliotropium indicum*. This SNP marker is located at base 1014 in the coding region of the bitter gourd RBK2 gene, specifically at Chr8-32381360. Using the SNP marker provided by this invention, the resistance of different bitter gourd germplasms to *Heliotropium indicum* root-knot nematode disease can be analyzed rapidly and accurately, accelerating the application of marker-assisted selection technology in disease-resistant breeding of bitter gourd. Attached Figure Description

[0016] Figure 1 Electrophoresis image of PCR amplification products. Genomic DNA from different bitter gourd germplasms was amplified using primer pairs consisting of Chr8-32381360F-G and Chr8-32381360R, and primer pairs consisting of Chr8-32381360F-CT and Chr8-32381360R. Detailed Implementation

[0017] To better understand the technical content of this invention, the invention will be further described below with reference to specific embodiments.

[0018] Identification of resistance to root-knot nematode in bitter melon:

[0019] Soak bitter gourd seeds in warm water overnight, then wrap them in a damp cloth and place them in a 37℃ incubator for 2-3 days to germinate. After germination, sow them in seedling trays. The root-knot nematode of *Hylocereus undatus* is propagated in the rhizosphere of susceptible water spinach. When the egg masses are nearly mature, they are removed from the water spinach roots and cultured into second-instar larvae. A suspension of 600 larvae / ml is prepared for the second-instar larvae. When the bitter gourd seedlings have grown to two leaves and a central bud, they are transplanted into small plastic boxes (6cm x 6cm x 7.5cm) filled with sterilized nutrient soil. The prepared *Hylocereus undatus* root-knot nematode suspension is inoculated using the rhizosphere perforation method. One seedling per box, with five replicates per sample. The small plastic boxes are randomly placed on trays and incubated in a 28℃ greenhouse. Soil moisture is checked daily and kept moist. After 45 days of incubation, the bitter gourd roots are washed with tap water, and the percentage of root knots on the root surface is recorded. Grade 0: No root knots in the entire root system; Grade 1: 1%–5% of the root system has root knots; Grade 2: 6%–25% of the root system has root knots; Grade 3: 26%–50% of the root system has root knots; Grade 4: 51%–75% of the root system has root knots; Grade 5: More than 75% of the root system has root knots. The root knot index (GI) was calculated according to Nyczepir et al. (1999).

[0020] Root knot index (GI) = Number of root knots per bitter gourd plant / Fresh weight of root system per bitter gourd plant.

[0021] Experimental steps

[0022] (1) Genomic DNA was extracted from the bitter gourd germplasm to be tested using the CTAB method, and the DNA concentration was adjusted to 50 ng / μL.

[0023] (2) Primer pair I (Chr8-32381360F-G / Chr8-32381360R) and primer pair II (Chr8-32381360F-CT / Chr8-32381360R) were synthesized at Shanghai Sangon Biotech Co., Ltd. The primers were diluted to 10 μmol / L. Using genomic DNA as a template, polymerase chain reaction (PCR) was performed using primer pair I and primer pair II respectively to amplify and obtain PCR products.

[0024] The nucleotide sequence of primer Chr8-32381360F-G is: CTGTTTGATGCAGATACTTCGCG;

[0025] The nucleotide sequence of primer Chr8-32381360R is: AGAGGCTTTGCCTGAAATGA;

[0026] The nucleotide sequence of primer Chr8-32381360F-CT is: CTGTTTGATGCAGATACTCCGCT.

[0027] (3) The 20 μL PCR reaction system contains: 2× PCR Master Mix (Shanghai Yisheng Biotechnology Co., Ltd.) 10μL, forward primer Chr8-32381360F-G / Chr8-32381360F-CT 0.5μL, reverse primer Chr8-32381360R 0.5μL, genomic DNA 1ul, ddH2O 8μL.

[0028] (4) PCR amplification reaction program: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 63℃ annealing for 30 s, 72℃ extension for 40 s, 35 cycles; 72℃ extension for 10 min, 16℃ for 5 min.

[0029] (5) The amplified PCR products were analyzed by agarose gel electrophoresis. For the same DNA sample, the product amplified by primer pair I was loaded first, followed by the product amplified by primer pair II. If the product amplified by primer pair I showed a band but the product amplified by primer pair II showed no band, it indicates that the DNA sample being tested has the G / G genotype and the material being tested is susceptible. If the product amplified by primer pair I showed no band but the product amplified by primer pair II showed a band, it indicates that the DNA sample being tested has the T / T genotype and the material being tested is resistant. If both the product amplified by primer pair I and the product amplified by primer pair II showed a band, it indicates that the DNA sample being tested has the G / T genotype and the material being tested is susceptible.

[0030] Table 1. Test results of different bitter gourd materials

[0031] Y85 4 G / G Beijing Zhongliangxin Agricultural Technology Development Company Parjat 1 T / T Unknown Huayu 5 G / G Fujian, China THMC134 1 T / T India Chuman 1 T / T Unknown THMC76 1 T / T India UNR32 1 T / T Unknown Y54 5 G / G Hainan, China THMC286 1 T / T India T2 4 G / G Fujian, China 09-18 4 G / G Japan THMC35 5 G / G India T06 5 G / G Thailand THMC14 5 G / G India THMC68 1 T / T India Y118 5 G / G Fujian, China THMC285 1 T / T India Jiangxicibai 5 G / G Jiangxi, China Y17 5 G / G Guangdong, China Y95 5 G / G Hunan, China Y27 5 G / G Fujian, China Columbia 1 T / T Colombia D17 5 G / G Guangdong, China

[0032] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A primer pair for amplifying SNP markers of resistance to root-knot nematode disease in bitter melon and bean weevil, characterized in that: The SNP marker for resistance to root-knot nematode disease in bitter gourd and bean is located at position 251 of the sequence shown in SEQ ID NO:4 or SEQ ID NO:

5. The primer pair includes primer pair I and primer pair II. Primer pair I includes primer Chr8-32381360F-G and primer Chr8-32381360R. Primer pair II includes primer Chr8-32381360F-CT and primer Chr8-32381360R. The nucleotide sequence of primer Chr8-32381360F-G is: CTGTTTGATGCAGATACTTCGCG; The nucleotide sequence of primer Chr8-32381360R is: AGAGGCTTTGCCTGAAATGA; The nucleotide sequence of primer Chr8-32381360F-CT is: CTGTTTGATGCAGATACTCCGCT.

2. The application of the primer pair according to claim 1 in identifying resistance to root-knot nematode disease in bitter gourd and bean.

3. The application according to claim 2, characterized in that, The method for determining the resistance of bitter gourd to root-knot nematode disease includes: amplifying bitter gourd genomic DNA using the primer pair described in claim 1; if the product amplified using primer pair I has a band but the product amplified using primer pair II has no band, then the material to be tested is a low-resistance material; if the product amplified using primer pair I has no band but the product amplified using primer pair II has a band, then the material to be tested is a high-resistance material.

Images