A photoelectrochemical biosensor and its preparation and detection methods

Abstract

This invention belongs to the field of sensors and discloses a photoelectrochemical biosensor and its preparation and detection methods. The biosensor includes an SPE electrode, the surface of which a working electrode (rGO) is provided with Au-NPs; a dsDNA probe is attached to the surface of the Au-NPs, and the side of the probe away from the Au-NPs is modified with a photoelectrochemical signal molecule; one strand of the probe is modified with a thiol group, and the probe includes a Cas12a cleavage site. Preparation method: A dsDNA / Au-NPs / rGO / SPE electrode is prepared; the photoelectrochemical signal molecule is modified onto the dsDNA to obtain the above-mentioned biosensor. Detection method: The above-mentioned biosensor is brought into contact with the sample to be tested and a CRISPR system to detect the photoelectrochemical signal of the photoelectrochemical signal molecule, thereby detecting the target nucleic acid. The sensor of this invention exhibits excellent specificity and sensitivity when used to detect the sample to be tested.

Description

Technical Field

[0001] This invention belongs to the field of sensors, specifically relating to a photoelectrochemical biosensor and its preparation and detection methods. Background Technology

[0002] Currently, routine detection methods for pathogenic microorganisms mainly include culture methods, immunological detection methods, and molecular biological detection methods. Among these, traditional culture methods can accurately determine the quantity and type of pathogenic microorganisms in a sample and are considered the "gold standard," often used as a control method. However, this method is time-consuming and labor-intensive, requiring strict control over the culture environment and operators, making it unsuitable for rapid diagnosis of pathogenic microorganisms. Furthermore, culture methods have poor specificity and cannot sensitively distinguish subtle differences between pathogenic microorganisms. Immunological detection methods utilize the recognition and binding of antigens and antibodies to detect pathogenic microorganisms. It is a comprehensive technique that can perform both qualitative and quantitative analysis, such as enzyme-linked immunosorbent assay (ELISA) and chemiluminescent immunoassay (CLIA). However, immunological detection methods suffer from the "window period" false negative problem; that is, in the early stages of infection, due to the low quantity of pathogenic microorganisms, the abundance of antibodies produced by the body against the pathogenic microorganisms is low, leading to negative antibody results and missed detection. In addition, immunological detection methods also suffer from poor specificity. Polymerase chain reaction (PCR) and its derivative technologies have extremely high sensitivity and are widely used. However, PCR amplification can also amplify errors in detection, thereby reducing the accuracy and specificity of the method.

[0003] Therefore, it is of great significance to find a method for detecting pathogenic microorganisms that is highly specific and sensitive. Summary of the Invention

[0004] The present invention aims to at least solve one of the technical problems existing in the prior art. To this end, the present invention proposes a photoelectrochemical biosensor, which has the characteristics of high specificity and high sensitivity for the detection of pathogenic microorganisms.

[0005] The present invention also proposes a method for preparing the above-mentioned photoelectrochemical biosensor.

[0006] This invention also proposes a method for detecting target nucleic acids using the aforementioned photoelectrochemical biosensor.

[0007] According to one aspect of the present invention, a photoelectrochemical biosensor is provided, comprising a screen-printed electrode, the screen-printed electrode including a working electrode, the working electrode being upright graphene, and a gold nanoparticle-modified layer disposed on the surface of the working electrode; a dsDNA (double-stranded DNA) probe is attached to the surface of the gold nanoparticle-modified layer, the side of the dsDNA probe away from the gold nanoparticle-modified layer being modified with a photoelectrochemical signal molecule; the dsDNA probe includes ssDNA1, ssDNA2, and ssDNA3, ssDNA2 and ssDNA3 forming the complementary strand of ssDNA1; the 3' or 5' end of the ssDNA1 is modified with a thiol group, and the dsDNA probe includes a Cas12a cleavage site.

[0008] In some embodiments of the present invention, the screen-printed electrode further includes a counter electrode and a reference electrode.

[0009] In some preferred embodiments of the present invention, carbon paste is used as the counter electrode and Ag / AgCl is used as the reference electrode.

[0010] Specifically, upright graphene materials have a unique morphology that allows for flexible modulation of nanoscale spatial channels, enabling functional materials to be uniformly dispersed on their surface; moreover, they possess excellent electrical conductivity and a huge specific surface area, making them excellent carriers for various functional materials.

[0011] Specifically, the gold in the gold nano-modified layer and the thiol group in the thiol-modified ssDNA1 form an Au-S bond, thereby stably binding the thiol-modified ssDNA1 to the surface of the gold nano-modified layer.

[0012] In some embodiments of the present invention, the nucleic acid sequence of the ssDNA1 is shown as SEQ ID NO:1 (CTTTACTCAACTTATTATTACGAACATCAGG).

[0013] In some embodiments of the present invention, the photoelectrochemical signal molecules include quantum dots.

[0014] In some embodiments of the present invention, the photoelectrochemical signal molecule includes any one of CdTe / ZnS quantum dots, CdSe / ZnS quantum dots, CdTe / CdS / ZnS quantum dots, InP / ZnS quantum dots, ZnCdS / ZnS quantum dots, CdTe / CdSe / ZnS quantum dots, and CdSeTe / ZnS quantum dots.

[0015] In some preferred embodiments of the present invention, the photoelectrochemical signal molecule is selected from CdTe / ZnS quantum dots.

[0016] In some embodiments of the present invention, the dsDNA probe is linked to the photoelectrochemical signal molecule via an amide bond.

[0017] In some embodiments of the present invention, the ssDNA3 in the dsDNA probe and the photoelectrochemical signal molecule are respectively modified with either an amino group or a carboxyl group, and the modified groups are different; when the two come into contact, the amino group and the carboxyl group react to form the amide bond.

[0018] In some preferred embodiments of the present invention, the ssDNA3 in the dsDNA probe and the photoelectrochemical signal molecule are respectively modified with amino and carboxyl groups, and when they come into contact, the amino and carboxyl groups react to form the amide bond.

[0019] In some embodiments of the present invention, the nucleic acid sequence of the ssDNA2 is shown in SEQ ID NO:2(ATAAGTTGAGTAAAG).

[0020] In some embodiments of the present invention, the nucleic acid sequence of the ssDNA3 is shown in SEQ ID NO:3(CCTGATGTTCGTAATA).

[0021] In some embodiments of the present invention, the ssDNA1 includes the cleavage site of the Cas12a.

[0022] According to a second aspect of the present invention, a method for preparing the aforementioned photoelectrochemical biosensor is provided, comprising the following steps:

[0023] S1: Provide a working electrode for an SPE (screen-printed electrode), wherein the working electrode is upright graphene (rGO); prepare a gold nanoparticle modification layer on the surface of the working electrode to obtain an Au-NPs / rGO / SPE electrode;

[0024] S2: Connect thiol-modified ssDNA1 to the Au-NPs / rGO / SPE electrode described in step S1 to obtain the ssDNA1 / Au-NPs / rGO / SPE electrode.

[0025] S3: Contact the electrode obtained in step S2 with ssDNA2 and ssDNA3 so that ssDNA2 and ssDNA3 are completely complementary to the thiol-modified ssDNA1 to obtain the dsDNA / Au-NPs / rGO / SPE electrode; the dsDNA probe includes the Cas12a cleavage site.

[0026] S4: Incubate the electrode obtained in step S3 with a solution of photoelectrochemical signal molecules to modify the dsDNA probe with photoelectrochemical signal molecules, thereby obtaining the photoelectrochemical biosensor.

[0027] In some embodiments of the present invention, step S1 involves preparing the gold nanoparticle-modified layer on the surface of the working electrode by electrochemical deposition or magnetron sputtering.

[0028] In some preferred embodiments of the present invention, step S1 involves preparing the gold nanoparticle-modified layer on the surface of the working electrode by electrochemical deposition.

[0029] In some preferred embodiments of the present invention, step S1 uses chloroauric acid solution as electrolyte, the screen-printed electrode uses upright graphene as working electrode, carbon paste as counter electrode, and Ag / AgCl as reference electrode, and electrochemical deposition is performed on the surface of the working electrode by chronoamperometry to form the gold nano-modification layer.

[0030] In some preferred embodiments of the present invention, the voltage of the electrochemical deposition is -0.1 to -0.5V.

[0031] In some preferred embodiments of the present invention, the electrochemical deposition time is 400–1200 s.

[0032] In some embodiments of the present invention, the method for preparing the ssDNA1 / Au-NPs / rGO / SPE electrode in step S2 includes the following steps: mixing the thiol-modified ssDNA1 with a reducing agent to prevent the formation of disulfide bonds; covering the Au-NPs / rGO / SPE electrode with the thiol-modified ssDNA1 solution and incubating at room temperature for 0.5 to 4 hours.

[0033] In some embodiments of the present invention, the reducing agent includes at least one of dithiothreitol (DTT), tris(2-formylethyl)phosphonic acid hydrochloride (TCEP), and β-mercaptoethanol.

[0034] In some preferred embodiments of the present invention, the reducing agent is selected as TCEP.

[0035] Specifically, the thiol groups in the thiol-modified ssDNA1 are easily oxidized to form disulfide bonds (SS), so the reducing agent needs to be added to prevent the oxidation of the thiol groups.

[0036] In some preferred embodiments of the present invention, the Au-NPs / rGO / SPE electrode is covered with the thiol-modified ssDNA1 solution and incubated at room temperature for 1 hour.

[0037] In some embodiments of the present invention, the concentration of the thiol-modified ssDNA1 is 0.1–0.5 μM.

[0038] In some preferred embodiments of the present invention, the concentration of the thiol-modified ssDNA1 is 0.25 μM.

[0039] In some embodiments of the present invention, the thiol-modified ssDNA1 solution is prepared by dissolving the thiol-modified ssDNA1 in a Tris buffer solution.

[0040] In some embodiments of the present invention, after the ssDNA1 incubation is completed, the ssDNA1 / Au-NPs / rGO / SPE electrode is washed with Tris buffer and then treated with 6-mercaptohexanol (MCH) aqueous solution for 0.25 to 1.5 h.

[0041] In some embodiments of the present invention, after the ssDNA1 incubation is completed, the ssDNA1 / Au-NPs / rGO / SPE electrode is washed with Tris buffer and then treated with 6-mercaptohexanol (MCH) aqueous solution for 0.5 h.

[0042] In some embodiments of the present invention, the concentration of the MCH aqueous solution is 0.5 to 5 mM.

[0043] In some preferred embodiments of the present invention, the concentration of the MCH aqueous solution is 2 mM.

[0044] In some embodiments of the present invention, in step S3, the ssDNA2 and the ssDNA3 are added to the same PBS buffer at a concentration of 0.1–0.5 μM.

[0045] In some preferred embodiments of the present invention, in step S3, the ssDNA2 and the ssDNA3 are added to the same PBS buffer (0.1M, pH 7.4), and the concentration of each is 0.25μM.

[0046] In some embodiments of the present invention, the 3' or 5' end of the ssDNA3 is modified with an amino or carboxyl group.

[0047] In some preferred embodiments of the present invention, the 5' end of the ssDNA3 is modified with an amino group.

[0048] In some embodiments of the present invention, step S3 involves covering the electrode surface obtained in step S2 with a buffer solution containing ssDNA2 and ssDNA3 and incubating at room temperature for 0.5 to 4 hours.

[0049] In some preferred embodiments of the present invention, step S3 involves covering the electrode surface obtained in step S2 with a buffer solution containing ssDNA2 and ssDNA3 and incubating at room temperature for 1 hour.

[0050] In some embodiments of the present invention, the ssDNA1 includes a Cas12a cleavage site.

[0051] In some embodiments of the present invention, the dsDNA in step S4 is linked to the photoelectrochemical signal molecule.

[0052] In some embodiments of the present invention, the dsDNA in step S4 is linked to the photoelectrochemical signal molecule via an amide bond.

[0053] Specifically, the ssDNA3 in step S3 and the photoelectrochemical signal molecule in step S4 are respectively modified with either an amino group or a carboxyl group, and the modified groups are different; when the two come into contact, the amino group and the carboxyl group react to form the amide bond, thereby connecting the photoelectrochemical signal molecule to the dsDNA probe.

[0054] In some embodiments of the present invention, the incubation time in step S4 is 0.25 to 8 hours.

[0055] In some preferred embodiments of the present invention, the incubation time in step S4 is 2 hours.

[0056] In some preferred embodiments of the present invention, the 5' end of the ssDNA3 described in step S3 is modified with an amino group, and the photoelectrochemical signal molecule described in step S4 is modified with a carboxyl group. The activated photoelectrochemical signal molecule solution is covered with the dsDNA / Au-NPs / rGO / SPE electrode described in step S3 and incubated at room temperature for 2 hours, so that the amino group and the carboxyl group react to form an amide bond, thereby linking the photoelectrochemical signal molecule to the dsDNA probe.

[0057] In some embodiments of the present invention, the preparation method of the photoelectrochemical signal molecule solution in step S4 includes: activating the photoelectrochemical signal molecule in a MES buffer containing EDC and NHS for 0.25 to 5 hours.

[0058] In some preferred embodiments of the present invention, the preparation method of the photoelectrochemical signal molecule solution in step S4 includes: activating the photoelectrochemical signal molecule in a MES buffer (0.1M, pH 6.0) containing 20mM EDC and 10mM NHS for 1h.

[0059] According to a third aspect of the present invention, a method for detecting target nucleic acid using the photoelectrochemical biosensor is provided, comprising the following steps: constructing a CRISPR system, contacting the photoelectrochemical biosensor with the sample to be tested and the CRISPR system, detecting the photoelectrochemical signal of the photoelectrochemical signal molecule, and thereby detecting the target nucleic acid.

[0060] In some embodiments of the present invention, the CRISPR system includes a Cas protein and crRNA.

[0061] In some embodiments of the present invention, the Cas protein is selected from the Cas12a protein.

[0062] In some embodiments of the present invention, the guide sequence of the crRNA is complementary to the sequence of the target nucleic acid in the sample to be tested.

[0063] In some embodiments of the present invention, the Cas12a cleavage site in the dsDNA probe is recognized and cleaved by the CRISPR / Cas12a system.

[0064] In some embodiments of the present invention, the photoelectrochemical signal is detected by combining light source irradiation and current-time curve method.

[0065] Specifically, a CRISPR system is constructed, and the sample to be tested is mixed with the CRISPR system and dropped onto the surface of the photoelectrochemical biosensor for incubation. The photoelectrochemical signal is detected by the current-time curve method under light irradiation. Photoelectrochemical signal molecules exhibit the photoelectric effect; under light irradiation, they transition from the ground state to an excited state, causing electron transitions that are transmitted to the external circuit via the dsDNA probe, forming a photocurrent. When the target nucleic acid is absent in the sample, the crRNA guide sequence cannot bind to the nucleic acid in the sample, and the trans-cleavage activity of the Cas12a protein is not activated. The dsDNA probe cannot be cleaved, and the photocurrent remains unchanged. When the target nucleic acid is present in the sample, the crRNA guide sequence binds complementary to the target nucleic acid sequence, activating the trans-cleavage activity of Cas12a. The Cas12a protein recognizes the cleavage site of the dsDNA probe and cleaves it. At this point, the photoelectrochemical signal molecule becomes ionized, thus weakening the detected photocurrent signal.

[0066] According to a preferred embodiment of the present invention, at least the following beneficial effects are achieved:

[0067] In the photoelectrochemical biosensor of this invention, a gold nanoparticle-modified layer is provided on the surface of the working electrode. Thiol-modified ssDNA1 is linked via gold-sulfur (Au-S) bonds. ssDNA1 further pairs complementary with ssDNA2 and ssDNA3 to form a dsDNA probe, which is then attached to the working electrode. The ssDNA3 terminus is linked to a photoelectrochemical signal molecule via an amide bond. The dsDNA probe includes a highly efficient cleavage site for Cas12a, which can be recognized and cleaved by the CRISPR / Cas12a system. The presence of the corresponding pathogenic microorganism in the sample is then detected by the photoelectrochemical signal molecule on the dsDNA probe. This biosensor possesses a highly efficient cleavage site for the Cas12a protein, allowing it to bind to the CRISPR / Cas12a system for detecting pathogenic microorganisms with high specificity. The photoelectrochemical signal molecule on the dsDNA probe exhibits excellent photoelectric effects. Combined with the large specific surface area and excellent conductivity of upright graphene, this results in high sensitivity and a detection limit as low as 7.79 × 10⁻⁶. -2 Furthermore, screen-printed electrodes are inexpensive, easy to modify, and portable, possessing great potential for POCT detection when combined with portable electrochemical workstations and light sources. Simultaneously, the detection method utilizing this biosensor exhibits excellent compatibility, especially when combined with microfluidic technology, enabling automated, highly sensitive, and high-throughput sample detection. Moreover, this method does not require nucleic acid amplification, requires small sample volumes, has short detection times, and is easy to operate. Attached Figure Description

[0068] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:

[0069] Figure 1 This is a schematic diagram illustrating the principle of the photoelectrochemical biosensor prepared in Example 1 of the present invention combined with a CRISPR system to detect the novel coronavirus;

[0070] Figure 2 The image shows the photoelectric response results of the photoelectrochemical biosensor for detecting gradient nucleic acid concentrations of the novel coronavirus in Example 2 of this invention (a-1: 0, 1.0aM, 10.0aM, 100.0aM, 1.0fM, 10.0fM, 100.0fM, 1.0pM, 10.0pM, 100.0pM, 1.0nM, 10.0nM).

[0071] Figure 3 This is a regression analysis of the photocurrent changes of the photoelectrochemical biosensor in Example 2 of the present invention and the concentration of SARS-CoV-2 nucleic acid.

[0072] Figure 4 This is a graph showing the specificity results of the photoelectrochemical biosensor for detecting SARS-CoV-2 nucleic acid samples in Example 3 of the present invention;

[0073] Figure 5 and Figure 6 This is a graph showing the stability test results of the photoelectrochemical biosensor in Example 4 of the present invention;

[0074] Figure 7 This is a graph showing the reproducibility test results of the photoelectrochemical biosensor in Example 5 of the present invention;

[0075] Figure 8 This is a graph showing the photoelectric response results of the photoelectrochemical biosensor used in Example 6 of the present invention for detecting SARS-CoV-2 samples. Detailed Implementation

[0076] The embodiments of the present invention are described in detail below. The embodiments described with reference to the accompanying drawings are exemplary and are only used to explain the present invention, and should not be construed as limiting the present invention.

[0077] In the description of this invention, unless otherwise explicitly defined, terms such as modification, connection, and cutting should be interpreted broadly, and those skilled in the art can reasonably determine the specific meaning of the above terms in this invention in conjunction with the specific content of the technical solution.

[0078] In the description of this invention, the references to "one embodiment" and "some embodiments" indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment is included in at least one embodiment of the invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments.

[0079] Unless otherwise specified, the experimental methods used in the examples are conventional methods; unless otherwise specified, the materials and reagents used are commercially available.

[0080] Example 1: Assembly of a CRISPR / Cas12a-driven photoelectrochemical biosensor

[0081] This embodiment fabricates a photoelectrochemical sensor based on a commercially available SPE electrode. The working electrode of the SPE is upright graphene (2 mm in diameter), the reference electrode is Ag / AgCl, and the counter electrode is carbon paste. The fabrication process includes the deposition of Au-NPs, the preparation and carboxylation modification of CdTe / ZnS QDs, and the assembly of DNA and CdTe / ZnS QDs in the SPE (see [link to documentation]). Figure 1 The preparation and carboxylation modification of CdTe / ZnS QDs were performed by a commercial company. The deposition of Au-NPs and the assembly of DNA with CdTe / ZnS QDs in SPE are as follows:

[0082] (1) Using 5 mM HAuCl4 solution (pH 5.0) as the electrolyte, the screen-printed electrode used upright graphene (rGO) as the working electrode, carbon paste as the counter electrode, and Ag / AgCl as the reference electrode. The cleaned screen-printed electrode was placed in the above electrolyte, and electrochemical deposition was performed using the chronoamperometry method. The electrochemical deposition voltage was -0.3V, and the time was 600s. The obtained electrode was an Au-NPs / rGO / SPE electrode.

[0083] (2) Under dark room temperature conditions, thiol-modified ssDNA1 (thiol modification at the 5' end of ssDNA1, the nucleic acid sequence of ssDNA1 is shown as SEQ ID NO:1: CTTTACTCAACTTATTATTACGAACATCAGG) was treated with 10 μM tris(2-carboxyethyl)phosphonic acid hydrochloride (TCEP) for 10 min to prevent the formation of SS bonds.

[0084] (3) Then, the thiol-modified ssDNA1 was diluted to 0.25 μM using a buffer containing 10 mM EDTA and 10 mM Tris. 200 μL of 0.25 μM thiol-modified ssDNA1 was used to cover the surface of the Au-NPs / rGO / SPE electrode and incubated in the dark at room temperature for 1 h. The electrode surface was then cleaned by standing in 10 mM Tris buffer for 5 min to obtain the ssDNA1 / Au-NPs / rGO / SPE electrode.

[0085] (4) Cover the electrode with 10mM Tris buffer containing 2mM 6-mercaptohexanol (MCH) and incubate at room temperature for 30 min to passivate the surface and replace the loose ssDNA1, forming a highly aligned surface. After MCH treatment, clean the electrode surface by standing in PBS buffer (0.1M, pH 7.4) for 5 min to obtain the ssDNA1 / MCH / Au-NPs / rGO / SPE electrode.

[0086] (5) Add ssDNA2 (nucleic acid sequence as shown in SEQ ID NO:2: ATAAGTTGAGTAAAG) and ssDNA3 modified with 5' amino group (nucleic acid sequence of ssDNA3 as shown in SEQ ID NO:3: CCTGATGTTCGTAATA) to the same PBS buffer (0.1M, pH 7.4) and dilute to 0.25μM. Then cover the electrode surface obtained in step (4) with 200μL of buffer containing ssDNA2 and ssDNA3 and incubate at room temperature for 1h. Clean the electrode surface by standing in PBS buffer (0.1M, pH 7.4) for 5min to obtain the dsDNA / MCH / Au-NPs / rGO / SPE electrode.

[0087] (6) The carboxylated CdTe / ZnS QDs suspension was added to MES buffer (0.1M, pH 6.0) containing 20mM EDC and 10mM NHS at a volume ratio of 1:9. The suspension was incubated at room temperature for 1 h to activate the carboxyl groups. 200 μL of CdTe / ZnS QDs suspension was used to cover the electrode and incubated at room temperature for 2 h. The electrode was then cleaned by standing in PBS buffer (0.1M, pH 7.4) for 5 min to obtain the CdTe / ZnS QDs-dsDNA / MCH / Au-NPs / rGO / SPE electrode, thus completing the assembly of the photoelectrochemical biosensor.

[0088] Example 2: Sensitivity Testing of CRISPR / Cas12a-Driven Photoelectrochemical Biosensor

[0089] The potential of the photoelectrochemical biosensor assembled in Example 1 for detecting the novel coronavirus was explored under the constructed experimental conditions. The detection principle and procedure are as follows: Figure 1 As shown. The specific detection method in this embodiment is as follows: The Cas12a-crRNA RNP complex was prepared by adding 1 μL of crRNA (20 μM, nucleic acid sequence as shown in SEQ ID NO:4: UAAUUUCUACUAAGUGUAGAUACCGUUAAUUAUAAUUACCA) and 1 μL of Cas12a protein (20 μM) to a reaction buffer consisting of 20 μL of 10×Buffer and 168 μL of water and incubating at room temperature for 10 min; then, 190 μL of the RNP complex was mixed with 10 μL of dsDNA template and incubated at room temperature for 10 min to form the Cas12a-crRNA-dsDNA ternary complex; 200 μL of the Cas12a-crRNA-dsDNA ternary complex solution was dropped onto the electrode surface covered by the CdTe / ZnS QDs-dsDNA reporter probe and incubated at 37°C for 1 h, followed by PBS buffer (0.1M, pH 10). 7.4) Rinse the surface of the electrode for photoelectrochemical (PEC) detection. PEC detection is performed on a PEC1000 photoelectrochemical testing system, using white light generated by an Xe lamp as the light source, which is turned on and off every 10 seconds. The photocurrent is recorded on a CHI 760E electrochemical workstation with an applied potential of 0.3V and the electrolyte is PBS buffer (0.1M, pH 7.4) containing 0.1M KCl.

[0090] A dsDNA template for the BA.5 variant of SARS-CoV-2 (nucleic acid sequence as shown in SEQ ID NO:5: TTTACTAATGTCTATGCAGATTCATTTGTAATTAGAGGTAATGAAGTCAGACAAATCGCTCCAGGGCAAACTGGAAATATTGCTGATTATAATTATAAATTACCAGATGATTTTACAGGCTGCGTTATAGCTTGGAATTCTAACAAGCTTGATTCTAAGGTTGGTGGTAATTATAATTACCGGTATAGATTGTTTAGGAAGTCTAATCTCAAACCTTTTGAGAGAGATATTTCAACTGAAATCTATCAGGCCGGTAACAAACCTTGTAATGGTGTTGCAGGGTTTAATTGTTACTTTCCTTTACGATCATATGGTTTCCGACCCACTTATGGTGTTGGTCACCAA, where the bolded bases are mutation sites) was designed, loaded onto pUC57, and amplified by PCR to obtain the dsDNA template. The concentration was then determined for subsequent analysis. Based on the detection method of this embodiment, the sensitivity of the biosensor was tested, and the results are as follows: Figure 2 As shown. Figure 2 The results showed that the photocurrent gradually decreased as the concentration of SARS-CoV-2 nucleic acid increased from 1 aM to 10 nM. The change in photocurrent showed a significant linear relationship with the logarithm of the SARS-CoV-2 nucleic acid concentration. Figure 3 For example, the equation ΔI = 5.64LgC(M) + 108.64 (where C(M) represents the DNA concentration; ΔI = I1 - I2, where I1 is the photocurrent when the template dsDNA is absent, I2 is the photocurrent when the dsDNA is present, and R...) 2 =0.9914, where each error bar in the figure represents the standard deviation of three measurements. Based on the 3δ / k method, the detection limit is calculated to be 7.79 × 10⁻⁶. -2 aM. σ is called the standard deviation, calculated from the background signal (6 times), and k is the slope of the calibration curve. Compared with previous COVID-19 nucleic acid detection strategies, this photoelectrochemical biosensor exhibits a lower detection limit and a wider linear range.

[0091] Example 3: Specificity testing of CRISPR / Cas-driven photoelectrochemical biosensors

[0092] Excellent specificity is an essential requirement for practical biosensors. Based on the biosensor assembled in Example 1 and the detection method in Example 2, the selectivity of the photoelectrochemical biosensor was investigated, with wild-type SARS-CoV-2 (Origin), Middle East Respiratory Syndrome Coronavirus (MERS), Influenza A virus H1N1, Influenza A virus H3N2, Influenza B virus, and Human Respiratory Cell Virus (HRSV) as potential interfering agents. The nucleic acid sequences of the above viruses are as follows:

[0093] Wild-type new coronavirus (Origin, NC_045512.2, S gene, 22736-23080), SEQ ID NO:6: TTTACTAA TGTCTATGCAGATTCATTTGTAATTAGAGGTGATGAAGTCAGACAAATCGCTCCAGGGCAAACT GGAAAGATTGCTGATTATAATTATAAATTACCAGATGATTTTACAGGCTGCGTTATAGCTTGGAATTCTAACAATCTTGATTCTAAGGTTGGTGGTAATTATAATTACCTGTATAGATTGTTTAGGAAGTCTAATCT CAAACCTTTTGAGAGAGATATTTCAACTGAAATCTATCAGGCCGGTAGCACAACCTTGTAATGGTGTTGAAGGTTTTAATTGTTACTTTCCTTTACAATCATATGGTTTCCAACCCACTAATGGTGTTGGTTACCAA;

[0094] MERS(NC_019843.3,24275-24938),SEQ ID NO:7:TGTTAATATGGAAGCCGCGTATACTTCATCTTTGCTTGGCAGCATAGCAGGTGTTGGCTGGACTGCTGGCTTATCCTCCTTTGCTGCTATTCCATTTGCACAGAGTATCTTTTATAGGTTAAACGGTGTTGGCATTACTCAACAGGTTCTTTCAGAGAACCAAAAGCTTATTGCCAATAAGTTTAATCAGGCTCTGGGAGCTATGCAAACAGGCTTCACTACAACTAATGAAGCTTTTCAGAAGGTTCAGGATGCTGTGAACAACAATGCACAGGCTCTATCCAAATTAGCTAGCGAGCTATCTAATACTTTTGGTGCTATTTCCGCCTCTATTGGAGACATCATACAACGTCTTGATGTTCTCGAACAGGACGCCCAAATAGACAGACTTATTAATGGCCGTTTGACAACACTAAATGCTTTTGTTGCACAGCAGCTTGTTCGTTCCGAATCAGCTGCTCTTTCCGCTCAATTGGCTAAAGATAAAGTCAATGAGTGTGTCAAGGCACAATCCAAGCGTTCTGGATTTTGCGGTCAAGGCACACATATAGTGTCCTTTGTTGTAAATGCCCCTAATGGCCTTTACTTCATGCATGTTGGTTATTACCCTAGCAACCACATTGAGGTTGTTTCTGCTTATGGTCTTTGCGATGCAGCTAACCCT;

[0095] Influenza A virus, H1N1 (NC_026431.1),SEQ ID NO:8:ATGAGTCTTCTAACCGAGGTCG AAACGTACGTTCTTTCTATCATCCCGTCAGGCCCCCTCAAAGCCGAGATCGCGCAGAGACTGGAAAGTGTCTTTGCAGGAAAGAACACAGATCTTGAGGCTCTCATGGAATGGCTAAAGACAAGACCAATCTTGTCACCTCTGACTAAGGGAATTTTAGGATTTGTGTTCACGCTCACCGTGCCCAGTGAGCGAGGACTGCAGCGTAGACGCTTTGTCCAAAATGCCCTAAATGGGAATGGGGACCCGAACAACATGGATAGAGCAGTTAAACTATACAAGAAGCTCAAAAGAGAAATAACGTTCCATGGGGCCAAGGAGGTGTCACTAAGCTATTCAACTGGTGCACTTGCCAGTTGCATGGGCCTCATATACAACAGGATGGGAACAGTGACCACAGAAGCTGCTTTTGGTCTAGTGTGTGCCACTTGTGAACAGATTGCTGATTCACAGCATCGGTCTCACAGACAGATGGCTACTACCACCAATCCACTAATCAGGCATGAAAACAGAATGGTGCTGGCTAGCACTACGGCAAAGGCTATGGAACAGATGGCTGGATCGAGTGAACAGGCAGCGGAGGCCATGGAGGTTGCTAATCAGACTAGGCAGATGGTACATGCAATGAGAACTATTGGGACTCATCCTAGCTCCAGTGCTGGTCTGAAAGATGACCTTCTTGAAAATTTGCAGGCCTACCAGAAGCGAATGGGAGTGCAGATGCAGCGATTCAAGTGATCCTCTCGTCATTGCAGCAAATATCATTGGGATCTTGCACCTGATATTGTGGATTACTGATCGTCTTTTTTTCAAATGTATTTATCGTCGCTTTAAATACGGTTTGAAAAGAGGGCCTTCTACGGAAGGAGTGCCTGAGTCCATGAGGGAAGAATATCAACAGGAACAGCAGAGTGCTGTGGATGTTGACGATGGTCATTTTGTCAACATAGAGCTAGAGTAA;.

[0096] Influenza A virus,H3N2(U51247.1),SEQ ID NO:9:ATGAATCCAAATCAAAAGATAATAA CAATTGGCTCTGTTTCTCTCACTATTGCCACAATATGCTGCCTTATGCAAATTGCCATCCTGGTAACTACTGTAACATTACATTTCAAGCAATATGAATGCAACTCCCCCCCAAACAACCAAGTAATGCTGTGTGAACCAACAATAATAGAAAGAAACATAACAGAGATAGTGTATCTGACCAACACCACCA TAGAGAAAGAAGTATGCCCCAAACTAGCAGAATACAGAAATTGGTCAAAGCCGCAATGTAAAATTACAGGATTTGCACCTTTTTCTAAGGACAATTCAATTCGGCTTTCCGCTGGTGGAGACATTTGGGTGACAAGAGAACCTTATGTGTCATGCGATCCTGGCAAGTGTATCAATTTGCCCTTGGACAGGG AACAACACTAAACAACAGGCATTCAAATGACACAGTACATGATAGGACCCCTTATCGAACCCTATTGATGAATGAGTTGGGTGTTCCATTTCATTTGGGAACCAAGCAAGTGTGCATAGCATGGTCCAGCTCAAGTTGTCACGATGGAAAAGCATGGCTGCATGTTTGTGTAACTGGGCATGATGAAAATGCAACTGCTAGCTTCATTTACGATGGGAGGCTTGTAGATAGTATTGGTTCATGGTCCAAAAATATCCTCAGGACCCAGGAGTCGGAATGCGTTTGTATCAATGGAACTTGTACAGTAGTAATGACTGATGGAAGTGCTTCAGGAAGAGCTGATACTAAAATACTATTCATTGAAGAGGGGAAAATCGCTCATATTAGCCCATTGTCAGGAAGTGCTCAGCATGTCGAGGAGTGCTCCTGTTATCCTCGATATCCTGGTGTCAGATGTGTCTGCAGAGACAACTGGAAAGGCTCCAATAGGCCCATCGTAGATATAAATGTGAAAGATTATAGCATTGTTTCCAGTTATGTGTGCTCAGGACTTGTTGGAGACACAGCCAGAAAAAACGACAGCTCCAGCAGTAGCTATTGCCGGAATCCTAACAATGAGAAAGGGAGTCATGGAGTGAAAGGCTGGGCCTTTGATGATGGAAATGATGTGTGGATGGGAAGAACGATCAGCGAGAAGTTACGCTCAGGTGATGAAACCTTCAAAGTCATTGGAGGCTGGTCCAAACCTAACTCCAAATTGCAGATAAATAGGCAAGTCATAGTTGACAGAGGTAATAGGTCCGGTTATTCTGGTATTTTCTCTGTTGAAGGCAAAAGCTGCATCAATCGGTGCTTTTATGTGGAGTTGATAAGGGGAAGGAAACAGGAAACTGAAGTCTGGTGGACCTCAAACAGTATTGTTGTGTTTTGTGGCACCTCAGGTACATATGGAACAGGCTCATGGCCTGATGGGGCGGACATCAATCTCATGCCTATATAAA;

[0097]

[0098] HRSV Human orthopneumo virus Subgroup A(NC_038235.1),SEQ ID NO:11:GGGGCAAATACAAAGATGGCTCTTAGCAAAGTCAAGTTGAAATGATACACTCAACAAAGATCAACTTCTGTCATCCAGCAAATACACCATCCAACGGAGCACAGGAGATAGTATTGATACTCCTAATTATGATGTGCAGAAACACATCAATAAGTTATGTGGCATGTTATTATTAATCACAGAAGATGCTAATCATAAATTCACTGGGTTAATAGGTATGTTATATGCGATGTCTAGGTTAGGAAGAGAAGACACCATAAAAATACTCAGAGATGCGGGATATCATGTAAAAGCAAATGGAGTAGATGTAACAACACATCGTCAAGACATTAATGGAAAAGAAATGAAATTTGAAGTGTTAACATTGGCAAGCTTAACAACTGAAATTCAAATCAACATTGAGATAGAATCTAGAAAATCCTACAAAAAAAATGCTAAAAGAAATGGGAGAGGTAGCTCCAGAATACAGGCATGACTCTCCTGATTGTGGGATGATA ATATTATGTATAGCAGCATTAGTAATAACTAAATTAGCAGCAGGGGACAGATCTGGTCTTACAGCCGTGATTAGGAGAGCTAATAATGTCCTAAAAAATGAAATGAAACGTTACAAAGGCTTACTACCCAAGGACATAGCCAACAGCTTCTATGAAGTGTTGAAAAACATCCCCACTTTATAGATGTTTTTGTTCATTTTGGTATAGCACAATCTTCTACCAGAGGTGGCAGTAGAGTTGA AGGGATTTTTGCAGGATTGTTTATGAATGCCTATGGTGCAGGGCAAGTGATGTTACGGTGGGGAGTCTTAGCAAAATCAGTTAAAAATATTATGTTAGGACATGCTAGTGTGCAAGCAGAAATGGAACAAGTTGTTGAGGTTTATGAATATGCCCAAAAATTGGGTGGTGAAGCAGGATTCTACCATATATTGAACAACCCAAAAGCATCATTATTATCTTTGACTCAATTTCCTCACTTCTCCAGTGTAGTATTAGGCAATGCTGCTGGCCTAGGCATAATGGGAGAGTACAGAGGTACACCGAGGAATCAAGATCTATATGATGCAGCAAAGGCATATGCTGAACAACTCAAAGAAAATGGTGTGATTAACTACAGTGTACTAGACTTGACAGCAGAAGAACTAGAGGCTATCAAACATCAGCTTAATCCAAAAGATAATGATGTAGAGCTTTGAGTTAATAAAAAA.

[0099] By mounting these viruses onto pUC57, the changes in photocurrent induced by the dsDNA template (ΔI = I1 - I2, where I1 is the photocurrent in the absence of dsDNA and I2 is the photocurrent in the presence of dsDNA) were compared with the photocurrent changes of the SARS-CoV-2 BA.5 variant to determine the selectivity of the photoelectrochemical biosensor. The dsDNA concentration of these viruses was the same, 10 nM. The results are as follows: Figure 4 As shown. Figure 4 The photocurrent changes induced by the SARS-CoV-2 BA.5 variant (Omicron) dsDNA template were significantly higher than those induced by other potential interfering agents. This indicates that the photoelectrochemical biosensor exhibits significant selectivity for the SARS-CoV-2 BA.5 variant.

[0100] Example 4: Stability Testing of CRISPR / Cas12a-Driven Photoelectrochemical Biosensor

[0101] The stability of the described photoelectrochemical biosensor was explored. Based on the biosensor assembled in Example 1 and the detection method in Example 2, the photocurrent of the constructed biosensor was evaluated in the detection buffer through multiple light-on and light-off cycles (10 cycles, 200 s). Figure 5 During the cyclic testing, the photocurrent response did not change significantly, and the relative standard deviation (RSD) of the PEC response was only 0.58%, indicating that the PEC signal is stable and reliable. Furthermore, to further investigate the stability of the biosensor, a long-term storage stability study was conducted (results are shown in...). Figure 6 (As shown). Figure 6 The results showed that after storage in a humid environment at 4°C for 1-4 weeks, the photocurrents were 96.20%, 90.66%, 85.63%, and 73.99% of those of the newly prepared biosensor, respectively, indicating that the biosensor has extremely excellent stability.

[0102] Example 5: Reproducibility Testing of CRISPR / Cas12a-Driven Photoelectrochemical Biosensor

[0103] Based on the biosensor assembled in Example 1 and the detection method in Example 2, the photocurrents of six photoelectrochemical biosensors assembled in the same batch were compared to conduct a reproducibility study of the biosensors (results are shown in...). Figure 7 ). Figure 7 The results showed that there was no significant difference in the photocurrent of these six independent photoelectrochemical biosensors (RSD = 1.96%), indicating that the biosensor has significant reproducibility.

[0104] Example 6: CRISPR / Cas12a-driven photoelectrochemical biosensor for nucleic acid detection of clinical samples of COVID-19.

[0105] This embodiment uses the photoelectrochemical biosensor prepared in Example 1 to detect clinical samples of the SARS-CoV-2 BA.5 variant. The specific process is as follows: clinical samples are collected, RNA is extracted, and reverse transcribed into cDNA; after isothermal amplification, nucleic acid is detected using the detection method in Example 2, with a negative control set up. The results are as follows: Figure 8 As shown in the figure, the photocurrent in the clinical sample group was significantly reduced compared to the control group. This is because the nucleic acid of the BA.5 variant of the novel coronavirus in the clinical samples activated the CRISPR / Cas12a system, which in turn non-specifically cleaved the DNA on the electrode surface, leading to the shedding of CdTe / ZnS QDs and the reduction in photocurrent.

[0106] The embodiments of the present invention have been described in detail above. However, the present invention is not limited to the above embodiments. Within the scope of knowledge possessed by those skilled in the art, various changes can be made without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof can be combined with each other unless otherwise specified.

Claims

1. A photoelectrochemical biosensor, characterized in that, The device includes a screen-printed electrode, comprising a working electrode made of upright graphene, with a gold nanoparticle-modified layer on its surface. A dsDNA probe is attached to the surface of the gold nanoparticle-modified layer. The side of the dsDNA probe away from the gold nanoparticle-modified layer is modified with a photoelectrochemical signal molecule, which includes quantum dots. The dsDNA probe comprises ssDNA1, ssDNA2, and ssDNA3, with ssDNA2 and ssDNA3 forming the complementary strand of ssDNA1. The 3' or 5' end of ssDNA1 is modified with a thiol group. The dsDNA probe includes a Cas12a cleavage site. Both ssDNA3 and the photoelectrochemical signal molecule are modified with either an amino group or a carboxyl group, with different modified groups. The amino and carboxyl groups react to form an amide bond, thereby linking the photoelectrochemical signal molecule to the dsDNA probe.

2. The photoelectrochemical biosensor according to claim 1, characterized in that, The photoelectrochemical signal molecules include any one of CdTe / ZnS quantum dots, CdSe / ZnS quantum dots, CdTe / CdS / ZnS quantum dots, InP / ZnS quantum dots, ZnCdS / ZnS quantum dots, CdTe / CdSe / ZnS quantum dots, and CdSeTe / ZnS quantum dots.

3. The photoelectrochemical biosensor according to claim 1, characterized in that, The screen-printed electrode also includes a counter electrode and a reference electrode.

4. The photoelectrochemical biosensor according to claim 3, characterized in that, The screen-printed electrode uses carbon paste as the counter electrode and Ag / AgCl as the reference electrode.

5. The method for preparing the photoelectrochemical biosensor according to any one of claims 1 to 4, characterized in that, Includes the following steps: S1: Provide a working electrode for a screen-printed electrode, wherein the working electrode is an upright graphene; prepare a gold nanoparticle modification layer on the surface of the working electrode to obtain an Au-NPs / rGO / SPE electrode; S2: Connect thiol-modified ssDNA1 to the Au-NPs / rGO / SPE electrode described in step S1 to obtain the ssDNA1 / Au-NPs / rGO / SPE electrode. S3: Contact the electrode obtained in step S2 with ssDNA2 and ssDNA3 so that ssDNA2 and ssDNA3 are completely complementary to the thiol-modified ssDNA1 to obtain the dsDNA / Au-NPs / rGO / SPE electrode; the dsDNA probe includes the Cas12a cleavage site. S4: Incubate the electrode obtained in step S3 with a solution of photoelectrochemical signal molecules to modify the dsDNA probe with photoelectrochemical signal molecules, thereby obtaining the photoelectrochemical biosensor.

6. The method according to claim 5, characterized in that, Step S2 is a method for preparing the ssDNA1 / Au-NPs / rGO / SPE electrode, comprising the following steps: mixing the thiol-modified ssDNA1 with a reducing agent to prevent the formation of disulfide bonds; covering the Au-NPs / rGO / SPE electrode with the thiol-modified ssDNA1 solution and incubating at room temperature for 0.5 to 4 hours.

7. The method according to claim 6, characterized in that, The reducing agent includes at least one of dithiothreitol, tris(2-formylethyl)phosphonic acid hydrochloride, and β-mercaptoethanol.

Images