Immunomodulatory peptide n c-cath and uses thereof

CN116462748BActive Publication Date: 2026-08-07KUNMING MEDICAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
KUNMING MEDICAL UNIVERSITY
Filing Date
2023-05-04
Publication Date
2026-08-07

AI Technical Summary

Technical Problem

到目前为止,云南小狭口蛙皮肤中的免疫调节肽及其抗感染的作用还未见报道

Benefits of technology

[0010] The beneficial effects of this invention are as follows: It provides a novel immunomodulatory peptide, Nc-CATH, which has the effect of resisting infection by methicillin-resistant Staphylococcus aureus and carbapenem-resistant Escherichia coli. This Yunnan small narrow-mouthed frog immunomodulatory peptide has significant anti-infective effects and can significantly protect mice from infection by drug-resistant bacteria. It can be used in the preparation of therapeutic drugs against infection by methicillin-resistant Staphylococcus aureus and carbapenem-resistant Escherichia coli.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116462748B_ABST
    Figure CN116462748B_ABST
Patent Text Reader

Abstract

This invention discloses an immunomodulatory peptide Nc-CATH and its applications, belonging to the biomedical field. Nc-CATH is a cyclic polypeptide encoded by the defense peptide gene of the Yunnan narrow-mouthed frog, an amphibian endemic to China. It consists of a pair of intramolecular disulfide bonds formed by the thirteenth and sixteenth cysteine ​​residues, with a molecular weight of 2703.07 Daltons and an isoelectric point of 4.47. Its amino acid sequence is shown in SEQ ID NO:2. The gene encoding the precursor of the Yunnan narrow-mouthed frog immunomodulatory peptide Nc-CATH consists of 663 nucleotide sequences, as shown in SEQ ID NO:1; nucleotides 397–468 represent the encoding gene for the mature Yunnan narrow-mouthed frog immunomodulatory peptide Nc-CATH. The invention also discloses the application of the Yunnan narrow-mouthed frog immunomodulatory peptide Nc-CATH in the preparation of therapeutic drugs for infectious diseases caused by methicillin-resistant Staphylococcus aureus and carbapenem-resistant Escherichia coli. The beneficial effects are: it has a strong regulatory effect on the host's main immune cells and can significantly resist infection by methicillin-resistant Staphylococcus aureus and carbapenem-resistant Escherichia coli.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to an immunomodulatory peptide Nc-CATH and its applications. Background Technology

[0002] Due to the overuse or inappropriate use of antibiotics, acquired drug-resistant strains such as methicillin-resistant Staphylococcus aureus have emerged in recent decades. Staphylococcus aureus MRSA), carbapenem-resistant Escherichia coli Escherichia coli The number of antibiotic-resistant bacteria (CRECs) is increasing. Despite researchers' efforts over the past decade to find new anti-infective drugs, the pace of antibiotic development still lags far behind the rate of bacterial mutation, making antimicrobial resistance a pressing global public health problem. We urgently need new anti-infective methods and drugs to combat drug-resistant bacterial infections. Immunomodulatory therapy refers to disease treatment methods that induce, enhance, or suppress immune responses. Compared to traditional antibiotics, immunotherapy targets the body's innate immune system, has a broader range of effects, and is less prone to inducing drug resistance. Therefore, immunotherapy is considered a promising new therapy for combating drug-resistant bacterial infections.

[0003] Amphibians represent the evolutionary link from aquatic to terrestrial vertebrates, possessing an ancient and powerful innate immune system. Their bare, smooth skin secretes a large number of biologically diverse active molecules to defend against various microbial infections in the environment. Neutrophils and macrophages are two professional phagocytic cell types that play a crucial role in initiating effective immune defenses and resisting invading microorganisms. It has been reported that some bioactive peptides can clear invading bacteria by modulating the host's innate immune response, such as increasing the number of monocytes / macrophages or neutrophils at the site of infection. These bioactive peptides with immunomodulatory functions are also called immunomodulatory peptides. The Yunnan narrow-mouthed frog (… Glyphoglossus yunnanensis This species belongs to the animal kingdom, phylum vertebrates, class amphibian, order Anura, family Ranidae, and genus *Rana yunnanensis*. To date, the immunomodulatory peptides in the skin of *Rana yunnanensis* and their anti-infective effects have not been reported. Summary of the Invention

[0004] The first objective of this invention is to provide an immunomodulatory peptide Nc-CATH; the second objective is to provide applications of the immunomodulatory peptide Nc-CATH.

[0005] The first objective of this invention is achieved as follows: the nucleotide sequence of the immunomodulatory peptide Nc-CATH is shown in the sequence listing SEQ ID NO: 1.

[0006] The immunomodulatory peptide Nc-CATH described in this invention has anti-methicillin-resistant Staphylococcus aureus and carbapenem-resistant Escherichia coli infection activity.

[0007] The immunomodulatory peptide Nc-CATH described in this invention is a cyclic polypeptide encoded by the defense peptide gene of the Yunnan narrow-mouthed frog, an amphibian species endemic to China. It consists of a pair of intramolecular disulfide bonds formed by the thirteenth and sixteenth cysteine ​​residues. The polypeptide has a molecular weight of 2703.07 Daltons and an isoelectric point of 4.47. The primary structure of the polypeptide (amino acid sequence SEQ ID NO:2) is: Ala Glu Glu Glu Ala Glu Lys Thr His Lys Thr Glu Cys Leu Glu CysIle Phe ThrLeu Leu Pro Pro Ala.

[0008] The gene encoding the precursor to the immunomodulatory peptide consists of 663 nucleotides (SEQ ID NO:1), and its sequence from the 'end' to the 3' end is as follows: Nucleotides 397–468 encode the mature immunomodulatory peptide Nc-CATH.

[0009] The second objective of this invention is achieved by the application of the immunomodulatory peptide Nc-CATH in the preparation of a therapeutic agent for infectious diseases caused by methicillin-resistant Staphylococcus aureus and carbapenem-resistant Escherichia coli.

[0010] The beneficial effects of this invention are as follows: It provides a novel immunomodulatory peptide, Nc-CATH, which has the effect of resisting infection by methicillin-resistant Staphylococcus aureus and carbapenem-resistant Escherichia coli. This Yunnan small narrow-mouthed frog immunomodulatory peptide has significant anti-infective effects and can significantly protect mice from infection by drug-resistant bacteria. It can be used in the preparation of therapeutic drugs against infection by methicillin-resistant Staphylococcus aureus and carbapenem-resistant Escherichia coli. Attached Figure Description

[0011] Figure 1 This is a schematic diagram illustrating the extremely strong immunotactic activity of the immunomodulatory peptide Nc-CATH of the present invention. Mice were injected intraperitoneally with Nc-CATH (10 mg / kg). Peritoneal lavage fluid was collected at 5, 12 and 24 h after injection. Flow cytometry was used to analyze the chemotactic effect of Nc-CATH on monocytes / macrophages and neutrophils in mice. Among them, (A) gated images of monocytes / macrophages and neutrophils by flow cytometry; (B) statistical graphs of monocytes / macrophages and neutrophils. *p<0.05, **p<0.01, ***p<0.001; Figure 2 This is a schematic diagram illustrating the extremely strong anti-methicillin-resistant Staphylococcus aureus and carbapenem-resistant Escherichia coli infection effects of the immunomodulatory peptide Nc-CATH of the present invention. Intraperitoneal injection of Nc-CATH before or 5 hours after bacterial infection improves the survival rate of mice infected with lethal doses of bacteria. Among them, (A) mice were infected with a lethal dose of MRSA; and (B) mice were infected with a lethal dose of CREC. Detailed Implementation

[0012] The present invention will be further described below with reference to embodiments and accompanying drawings, but this does not limit the present invention in any way. Any modifications or substitutions made based on the teachings of the present invention shall fall within the protection scope of the present invention.

[0013] The nucleotide sequence of the immunomodulatory peptide Nc-CATH described in this invention is shown in SEQ ID NO: 1 of the sequence listing.

[0014] The amino acid sequence encoded by the immunomodulatory peptide Nc-CATH is shown in SEQ ID NO: 2.

[0015] The application of the immunomodulatory peptide Nc-CATH described in this invention is its use in the preparation of drugs for treating infectious diseases caused by methicillin-resistant Staphylococcus aureus and / or carbapenem-resistant Escherichia coli.

[0016] The invention will be further illustrated below with specific implementation examples: Example 1 Gene cloning of the immunomodulatory peptide Nc-CATH (1) Total RNA extraction from the skin of the Yunnan narrow-mouthed frog: Rinse the dorsal skin of the Yunnan narrow-mouthed frog with deionized water. Take gland-rich skin tissue from both sides of the dorsal side of a live Yunnan narrow-mouthed frog and grind it thoroughly in liquid nitrogen. Add 1 ml of Trizol solution and homogenize in a 20 ml glass homogenizer for 30 minutes. Add an equal volume of phenol / chloroform solution, mix vigorously, incubate at room temperature for 10 minutes, centrifuge at 12000 rpm for 10 minutes at 4°C, and discard the precipitate. Add an equal volume of isopropanol to the supernatant, incubate at room temperature for 10 minutes, centrifuge at 12000 rpm for 10 minutes at 4°C, wash the precipitate once with 75% ethanol, air dry, and the precipitate at the bottom of the tube is the total RNA from the skin.

[0017] (2) Construction of a cDNA library from the skin of the Yunnan narrow-mouthed frog: Using CLONTECH's Creator TM SMART TM The cDNA Library Construction Kit is a plasmid-cDNA library construction kit. Follow the instructions carefully. Use SMARTScribe. TM First-strand cDNA was synthesized using reverse transcriptase, SMARTer V oligonucleotides, and 3' In-Fusion SMARTer CDS primers. Second-strand cDNA was synthesized using long-distance PCR with Advantage 2 Polymerase Mix, 5' PCR primer IIA, and 3' In-Fusion SMARTer PCR primers. The synthesized second-strand cDNA was used as a template for the following PCR to screen for cDNA encoding the polypeptide (Nc-CATH).

[0018] (3) Screening of Nc-CATH gene clones for immunomodulatory peptide: Based on the reported highly conserved cathelin domain sequence of amphibian cathelicidins, a 3' reverse primer Nv-CATH-R1 (5'-WSCRCAGRYCTTCACCTCC-3' (W=A / T; S=G / C; R=A / G; Y=C / T)) was designed and combined with the 5' PCR primer (5'-AAGCAGTGGTATCAACGCAGAGT-3') provided in the kit to amplify the 5' fragment of the cDNA encoding cathelicidin. PCR conditions were: 95°C pre-denaturation for 2 min, 92°C denaturation for 10 s, 50°C annealing for 30 s, 72°C extension for 40 s, repeated 30 times, followed by a final extension at 72°C for 10 min. The PCR product was purified by gel electrophoresis and cloned into the pMD19-T vector (Takara, Japan) for DNA sequencing.

[0019] Based on the 5' end sequence obtained from sequencing, primer 5'-CCATGAGGAGCTGGTGGCTGT-3' was designed and used in conjunction with the 3' PCR primer 5'-ATTCTAGAGGCCGAGGCGGCCG-3' from the library preparation kit for PCR amplification under the same conditions as above. After amplification, the target fragment was recovered using a DNA gel extraction kit, and the band size was verified by gel electrophoresis. The gel-extracted product was ligated overnight with the pMD18-T vector and transformed into *E. coli* DH5α competent cells prepared using the calcium chloride method. The next day, single clones were picked for colony PCR, and positive clones were screened for inoculation and plasmid extraction. Subsequently, the plasmid fragment size was verified by agarose gel electrophoresis, and plasmids corresponding to the correct band size were sequenced.

[0020] (4) Sequence determination of the immunomodulatory peptide Nc-CATH gene: Plasmid DNA was extracted and its nucleotide sequence was determined using the dideoxy sequencing method. The instrument used was an Applied Biosystems 373A fully automated nucleotide sequencer, and the sequencing primers were BcaBEST. TM Sequencing Primer RV-M and BcaBEST TM Sequencing Primer M13-47, BcaBEST TM Sequencing Primer RV-M sequence: 5`GAGCGGATAACAATTTCAC ACAGG 3', BcaBEST TM Sequencing Primer M13-47: 5'CGCCAGGGTTTTCCCAGTCACGAC 3'.

[0021] Gene sequencing results show that the gene encoding the immunomodulatory peptide precursor of the Yunnan narrow-mouthed frog consists of 663 nucleotides (SEQ ID NO: 1) (GenBank Accession Number: OQ870534), and the sequence from the 5' end to the 3' end is as follows: Nucleotides 397–468 encode the immunomodulatory peptide Nc-CATH from the mature Yunnan narrow-mouthed frog.

[0022] Example 2 Chemical synthesis method of immunomodulatory peptide Nc-CATH (1) Synthesized using an automated peptide synthesizer (433A, Applied Biosystems, USA) Buga The complete amino acid sequence of CATH was determined by high-performance liquid chromatography (HPLC) (Waters, USA). 18The synthesized sample was purified by reverse-phase column chromatography desalting. (2) The molecular weight of the synthesized sample was determined by matrix-assisted laser desorption / ionization time-of-flight mass spectrometry (MALDI-TOF). (3) The purity of the synthesized sample was identified by high-performance liquid chromatography (HPLC). The molecular weight of the chemically synthesized peptide was determined to be 2703.07 Da by MALDI-TOF, the isoelectric point of the synthesized peptide was determined to be 4.47 by isoelectric focusing electrophoresis, and the purity of the synthesized sample was determined to be >95% by HPLC. The amino acid sequence structure of the synthesized Nc-CATH was confirmed to be consistent with that of natural Nc-CATH by an automated amino acid sequencer.

[0023] Example 3 Pharmacological activity of the immunomodulatory peptide Nc-CATH (1) Chemotactic activity of the immunomodulatory peptide Nc-CATH on major immune effector cells (monocytes / macrophages and neutrophils) in mice Male C57BL / 6 mice were intraperitoneally injected with Nc-CATH (10 mg / kg) alone, with an equal volume of PBS used as a negative control. The peritoneal cavity of the mice was irrigated with PBS at 5, 12, and 24 h post-injection, and the irrigated fluid was collected. Cells were obtained by centrifugation at 1500 rpm for 10 min. Cells were stained with PE / F4 / 80 (monocytes / macrophages) and FITC / Ly-6G / Ly-6C (Gr-1, neutrophils), and flow cytometry was used to analyze the chemotactic effect of Nc-CATH on monocytes / macrophages and neutrophils in mice.

[0024] The results are as follows Figure 1 As shown, a concentration of 10 mg / kg of Nc-CATH significantly increased the number of monocytes / macrophages and neutrophils in the peritoneal cavity of mice. This indicates that Nc-CATH has a chemotactic effect on innate immune cells (monocytes / macrophages and neutrophils) in mice.

[0025] (2) Application of Nc-CATH, an immunomodulatory peptide from the Yunnan narrow-mouthed frog, in the preparation of antibacterial infection treatment drugs. Male C57B / L mice (6-8 weeks old, 25-30g, n=6) were intraperitoneally injected with G + Drug-resistant bacteria MRSA and G - Drug-resistant bacteria CREC (1.5x10 8 Mice were intraperitoneally injected with Nc-CATH (10 mg / kg), LL-37 (positive control; 10 mg / kg), or PBS (control) 5 hours before or after bacterial injection (CFU / mouse). Survival rates were recorded for 7 consecutive days.

[0026] The results are as follows Figure 2As shown: Mice in the MRSA and CREC infection model groups all died on the third and second days, respectively. However, after intraperitoneal injection of the immunomodulatory peptide Nc-CATH 5 hours before bacterial infection, G... + Drug-resistant bacteria MRSA and G - The survival rates of mice infected with drug-resistant CREC reached 66.66% and 83.33%, respectively; after intraperitoneal injection of the immunomodulatory peptide Nc-CATH 5 hours after bacterial infection, G... + Drug-resistant bacteria MRSA and G - The survival rates of mice infected with drug-resistant CREC reached 50% and 66.66%, respectively. This indicates that the immunomodulatory peptide Nc-CATH has strong anti-MRSA and anti-CREC infection effects, and its anti-infective effect is stronger than that of LL-37 (see details). Figure 2 ).

[0027] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. An immunomodulatory peptide Nc-CATH, characterized in that... The immunomodulatory peptide Nc-CATH is a cyclic polypeptide consisting of a pair of intramolecular disulfide bonds formed by the thirteenth and sixteenth cysteine ​​residues. The amino acid sequence of the immunomodulatory peptide Nc-CATH is shown in SEQ ID NO:

2.

2. The application of the immunomodulatory peptide Nc-CATH according to claim 1, characterized in that... The application of the immunomodulatory peptide Nc-CATH in the preparation of drugs for treating infectious diseases caused by methicillin-resistant Staphylococcus aureus and / or carbapenem-resistant Escherichia coli.

Citation Information

Patent Citations

  • Tree frog defensive peptide Zs-CATH as well as gene and application of tree frog defensive peptide Zs-CATH

    CN114671936A

  • Polypeptides for inducing a protective immune response against staphylococcus aureus

    WO2010062815A1