An engineered canthaxanthin-producing bacterium, a construction method and application thereof

Abstract

The application belongs to the technical field of biology, and discloses a cantharidin-producing genetically engineered bacterium as well as a construction method and application thereof. The genetically engineered bacterium is obtained by introducing the Mucor circinelloides beta-carotene synthesis genes carB and carRP, the Yarrowia lipolytica gene GGS1 and tHMGR into Yarrowia lipolytica MYA-2613 to obtain a beta-carotene-producing engineered bacterium, then expressing two copies of the beta-carotene ketolase gene BSW on the basis to convert beta-carotene into cantharidin, and further increasing the copy number of carB, carRP, GGS1 and tHMGR to improve the cantharidin level. The cantharidin-producing engineered bacterium such as MC-CTX4 has a cantharidin yield of 3.5 g / L, is an excellent high-yield cantharidin bacterium, realizes the purpose of rapidly guiding carbon source and nitrogen source to the target metabolic product cantharidin, and has a wide industrial application prospect.

Description

Technical Field

[0001] This invention relates to an engineered bacterium that produces cantharidin, its construction method, and its application, belonging to the field of biotechnology. Background Technology

[0002] Canthaxanthin, also known as canthaxanthin, has the molecular formula C. 40 H 52 O2, with a molecular weight of 564.84, belongs to the carotenoid family. Its ability to quench free radicals is nearly twice that of β-carotene and nearly 50 times that of vitamin E. Cantharidin was first extracted by Haxo from an edible mushroom in 1950. It was later chemically synthesized by the Swiss company Roche and used as a feed additive. In 1984, it was listed as a food additive by the US FDA and WHO, and corresponding quality standards were established. Besides its excellent coloring ability, cantharidin also possesses various physiological functions such as anti-cancer, antioxidant, immune-boosting, and skin and bone health protection. It is currently widely used in animal feed, food, cosmetics, and pharmaceuticals.

[0003] Cantharidin can be obtained through natural extraction, chemical synthesis, and bio-fermentation. Natural extraction primarily uses crustaceans and algae to obtain cantharidin; however, the low cantharidin content in these raw materials and high extraction costs prevent large-scale industrial production. While chemical synthesis is currently the main method for cantharidin production, it faces challenges such as significant environmental pollution and high costs for waste treatment. Bio-fermentation utilizes bacteria, fungi, and algae capable of synthesizing cantharidin to produce it. It offers advantages such as less environmental pollution, high biosafety, short production cycle, and continuous production, making it an important method for achieving green and sustainable cantharidin production.

[0004] In living organisms, canthaxanthin is a continuation of β-carotene synthesis, formed through ketylation of β-carotene at the C4 and C4′ sites by β-carotene ketylase. Currently reported organisms capable of producing canthaxanthin include fungi. Aspergillus carbonarius , Cantharellus cinnabarinus , Xanthophyllomyces dendrorhous ,bacteria Bradyrhizobium sp.、 Brevibacterium sp.、 Dietzia sp.、 Gordonia jacobaea , Micrococcus roseus , Paracoccus schoinia Archaea Haloferax alexandrines TMT, algae Asterarcys quadricellulare , Botryococcus braunii , Chlorella emersonii , Chlorella zofingiensis , Haematococcus pluvialis(Rebelo BA, Farrona S, Ventura MR, et al. Canthaxanthin, a Red-Hot Carotenoid: Applications, Synthesis, and Biosynthetic Evolution[J]. Plants, 2020, 9(8):1039.). However, the canthaxanthin yield of these natural organisms is usually low, and they accumulate a large amount of other carotenoids, making it difficult to obtain high-purity canthaxanthin through fermentation.

[0005] With the advancement of biological technologies, especially the development of synthetic biology, reconstructing the biosynthetic pathway of canthaxanthin using microorganisms as carriers has provided a new strategy for canthaxanthin production. For example, Naz T et al. expressed the β-carotene ketolase gene of Haematococcus pluvialis in the β-carotene-producing bacterium Mucor truncatula. bkd Converting β-carotene to cantharidin, the mutant strain yielded approximately 576 µg / g of cantharidin, higher than most natural organisms. However, the fermentation broth still contained a large amount of unketinated β-carotene and the single-site ketinated intermediate ursone (Naz T, Yang J, Nosheen S, et al. Genetic Modification of Mucor circinelloides For Canthaxanthin Production by Heterologous Expression of β-carotene Ketolase Gene. Front Nutr. 2021,8:756218. ). Scaife MA et al. inserted the source into a plasmid containing the β-carotene synthesis gene. Anabaena variabilis The β-carotene ketolase gene was extracted and then introduced into E. coli. The resulting engineered bacteria produced approximately 153 mg / L of cantharidin (Scaife MA, Prince CA, Norman A, et al. Progress toward an...). Escherichia coli Canthaxanthin bioprocess[J]. Process Biochemistry, 2012, 47(12):2500-2509.). Chen Mingkai et al., based on the modification of Saccharomyces cerevisiae to produce β-carotene, further expressed the gene encoding β-carotene ketolase. OBKTM29A canthaxanthin-producing Saccharomyces cerevisiae engineered strain was obtained by using a gene encoding a multi-directional drug resistance transcription factor. The canthaxanthin yield reached 1.44 g / L through two-stage temperature-controlled fermentation (Chen M, Li M, Ye L, Yu H. Construction of Canthaxanthin-Producing Yeast by Combining Spatiotemporal Regulation and Pleiotropic Drug Resistance Engineering. ACSSynth Biol. 2021.).

[0006] Currently, there are few reports on the synthesis of canthaxanthin using non-naturally produced bacteria, and there are also problems such as low yield, which cannot meet the needs of fermentation production; safety risks such as endotoxin contamination of Escherichia coli as a host bacterium; and complex fermentation control. Summary of the Invention

[0007] To overcome the shortcomings of existing technologies, this invention employs genetic engineering methods to introduce three copies of the β-carotene synthesis gene from *Rhizopus lipolyticus* into *Yersinia lipophila* MYA-2613. carB and carRP And enhance the geraniol geraniol pyrophosphate (GGPP) synthase gene in Yersinia lipolyticis. GGS1 and the truncated form of the HMG-CoA reductase gene tHMGR By expressing the gene, MC-3BRP-GH, a β-carotene-producing engineered bacterium, was obtained. Then, based on this, two copies of the polynucleotide encoding β-carotene ketolase (i.e., the β-carotene ketolase gene), especially derived from [the gene], were expressed. Bradyrhizobium sp. ORS278 and codon-optimized gene BSW It converts β-carotene into canthaxanthin and increases... carB , carRP , GGS1 and tHMGR Copy number further promotes metabolic flux towards β-carotene synthesis, providing sufficient substrate for canthaxanthin synthesis, thereby increasing canthaxanthin production. The resulting engineered strain MC-CTX4 ultimately achieved a canthaxanthin yield of 3.5 g / L. This invention, by screening specific genes and constructing different vectors, sequentially introduces these genes into yeast cells, significantly increasing canthaxanthin production and facilitating large-scale industrial production.

[0008] This invention provides a polynucleotide encoding β-carotene ketolase for constructing a cantharidin-producing genetically engineered bacterium; preferably, the β-carotene ketolase is derived from... Bradyrhizobiumsp. ORS278; More preferably, the polynucleotide encoding β-carotene ketolase is derived from Bradyrhizobium The β-carotene ketolase gene of sp. ORS278 was obtained after codon optimization and named […]. BSW Its polynucleotide sequence is shown in SEQ ID NO:91.

[0009] The present invention also provides the use of the polynucleotide encoding β-carotene ketolase as described above in the construction of cantharidin-producing genetically engineered bacteria.

[0010] The present invention also provides a canthaxanthin-producing genetically engineered bacterium, wherein the genetically engineered bacterium is a yeast that can ferment to produce canthaxanthin, and the genetically engineered bacterium contains the polynucleotide encoding β-carotene ketolase as described above.

[0011] In this invention, the yeast is selected from one or more of the following: *Yersinia lipolytica*, *Phaefflera rubiginosa*, *Saccharomyces cerevisiae*, *Hansenula polymorpha*, *Candida albicans*, *Candida dulcis*, *Pichia pastoris*, *Schizosaccharomyces cerevisiae*, *Candida glabrata*, *Kluyveromyces brittleii*, *Kluyveromyces lactis*, *Candida guildrum*, *Candida parapsilosis*, *Candida tropicalis*, and *Candida utilis*. In some preferred embodiments, the yeast is *Yersinia lipolytica*. In some more preferred embodiments, the yeast is *Yersinia lipolytica* MYA-2613.

[0012] Preferably, the genetically engineered bacteria also contain GGS1, tHMGR , carB , carRP At least one of them.

[0013] Preferably, the GGS1 The polynucleotide sequence is shown in SEQ ID NO: 94.

[0014] Preferably, the tHMGR for HMGR The truncated form of (Genebank accession number YALI0_E04807g) has the polynucleotide sequence shown in SEQ ID NO:95.

[0015] Preferably, the carB The Genebank login number is AJ238028.

[0016] Preferably, the carRP The Genebank login number is AJ250827.

[0017] Preferably, the polynucleotide encoding β-carotene ketolase , GGS1, tHMGR , carB , carRPAt least one of them is a multiple copy.

[0018] In some preferred embodiments, the genetically engineered bacteria are yeast strains that form multiple copies of the GGPP synthase gene on their chromosomes. GGS1 Multiple copies of the truncated form of the HMG-CoA reductase gene tHMGR Multiple copies of the β-carotene synthesis gene derived from Mucor truncatula. carB Multiple copies of the β-carotene synthesis gene derived from Mucor truncatula. carRP Multiple copies of the β-carotene ketolase gene BSW It was constructed.

[0019] Preferably, the cantharidin-producing genetically engineered bacterium is one that forms multiple copies (two, three, or more) of the GGPP synthase gene on the chromosome of *Yarrowia lipolyticis* MYA-2613. GGS1 One or more copies of a truncated form of the HMG-CoA reductase gene tHMGR Multiple copies (two, three or more) of the β-carotene synthesis gene from *Mucor truncatula* carB Multiple copies (two, three or more) of the β-carotene synthesis gene derived from *Mucor* truncatulae carRP One or more copies of the β-carotene ketolase gene BSW The construction is completed. The multiple copies can be two or more, including three, four, five, six copies, etc.

[0020] In some preferred embodiments, the β-carotene ketolase gene BSW Multiple copies refer to two copies that are introduced into Yersinia lipolyticis MYA-2613 cells through two different recombinant vectors and then integrated into the Yersinia lipolyticis MYA-2613 chromosome through homologous recombination of homologous arms.

[0021] In some preferred embodiments, the GGPP synthase gene GGS1 Multiple copies refer to three copies, one of which is contained in Yersinia lipolytica MYA-2613 itself, and the other two copies are obtained by introducing Yersinia lipolytica MYA-2613 cells through two different recombinant vectors, and then integrating them into the Yersinia lipolytica MYA-2613 chromosome through homologous recombination of homologous arms.

[0022] In some preferred embodiments, the truncated form of the HMG-CoA reductase gene tHMGR Multiple copies refer to two copies, which are introduced into Yersinia lipolyticis MYA-2613 cells through two different recombinant vectors, and then integrated into the Yersinia lipolyticis MYA-2613 chromosome through homologous recombination of homologous arms.

[0023] In some preferred embodiments, the β-carotene synthesis gene of the *Mucor truncatula* is... carB Multiple copies refer to four copies, which are introduced into Yersinia lipophila MYA-2613 cells through four different recombinant vectors, and then integrated into the Yersinia lipophila MYA-2613 chromosome through homologous recombination of homologous arms.

[0024] In some preferred embodiments, the β-carotene synthesis gene of the *Mucor truncatula* is... carRP Multiple copies refer to four copies, which are introduced into Yersinia lipophila MYA-2613 cells through four different recombinant vectors, and then integrated into the Yersinia lipophila MYA-2613 chromosome through homologous recombination of homologous arms.

[0025] In some preferred embodiments, the cantharidin-producing genetically engineered bacterium is a yeast that has formed three copies of the GGPP synthase gene on the chromosome of Yersinia lipophila MYA-2613. GGS1 Two copies of the truncated form of the HMG-CoA reductase gene tHMGR Four copies of the β-carotene synthesis gene derived from Mucor cladomycin carB Four copies of the β-carotene synthesis gene from *Mucor* truncatum. carRP And two copies of the β-carotene ketolase gene BSW It was constructed.

[0026] In some preferred embodiments, the polynucleotide encoding β-carotene ketolase , GGS1, tHMGR , carB , carRP The polynucleotide encoding β-carotene ketolase is connected to both ends by a promoter and a terminator. Specifically, a promoter is attached to the start codon end of the polynucleotide encoding β-carotene ketolase, and a terminator is attached to the stop codon end. GGS1 The start codon is connected to the promoter at one end, and the stop codon is connected to the stop codon at the other end; tHMGR The start codon is connected to the promoter at one end, and the stop codon is connected to the stop codon at the other end; carB The start codon is connected to the promoter at one end, and the stop codon is connected to the stop codon at the other end; carRP The start codon is connected to the starter, and the stop codon is connected to the stop codon.

[0027] In some preferred embodiments, for the polynucleotide encoding β-carotene ketolase , GGS1, tHMGR , carB , carRPThe promoter is selected from any one of TEFp, EXPp, and GPDp; the terminator is selected from any one of PEXt, XPRt, and LIPt; and the promoter and terminator are derived from yeast.

[0028] In some preferred embodiments, the genetically engineered bacteria are selected from one or more of MC-CTX1-BSW, MC-CTX2, MC-CTX3, and MC-CTX4.

[0029] This invention also provides the application of the genetically engineered bacteria described above in the fermentation production of cantharidin. By culturing the genetically engineered bacteria, cantharidin can be produced through fermentation. In this invention, the cantharidin-producing engineered bacteria, when cultured for 6 days at 28°C and 220 rpm in a shake flask containing fermentation medium (60 g / L glucose, 15 g / L peptone, 20 g / L yeast extract, 1 g / L potassium dihydrogen phosphate, 1 g / L ferrous sulfate, and the remainder being water), can achieve a yield of 726.9 mg / L; or...

[0030] The genetically engineered cantharidin-producing strain, when cultured in a fermenter containing fermentation medium (40 g / L glucose, 15 g / L peptone, 20 g / L yeast extract, 4 g / L potassium dihydrogen phosphate, 1 g / L ferrous sulfate, and the remainder being water) at 28°C, with an aeration rate of 1:1 (vol:vol) and shaking at 400-600 rpm for 160 h, can achieve a yield of 3.5 g / L; glucose is added during the fermentation process.

[0031] The present invention also provides a method for constructing the genetically engineered bacteria as described above, the method comprising:

[0032] (1) Construction of recombinant plasmids

[0033] (1.1) Construction of recombinant plasmid pMD-H1BRP

[0034] Genes carB , carRP The recombinant plasmid pMD-H1BRP was obtained by constructing the selection marker leu on the pMD19-T simple vector.

[0035] (1.2) Construction of recombinant plasmid pMD-H2BRPG

[0036] Genes carB , carRP , GGS1 The recombinant plasmid pMD-H2BRPG was constructed on the pMD19-Tsimple vector with the recyclable screening marker hisG-URA3-hisG.

[0037] (1.3) Construction of recombinant plasmid pMD-H3HM

[0038] Genes tHMGR The recombinant plasmid pMD-H3HM was constructed on the pMD19-T simple vector with the recyclable screening marker hisG-URA3-hisG.

[0039] (1.4) Construction of recombinant plasmid pMD-H4BRP

[0040] Genes carB , carRP The recombinant plasmid pMD-H4BRP was constructed on the pMD19-T simple vector with the recyclable screening marker hisG-URA3-hisG.

[0041] (1.5) Construction of recombinant plasmid pMD-H5BSW

[0042] Genes BSW The recombinant plasmid pMD-H5BSW was constructed on the pMD19-T simple vector with the recyclable screening marker hisG-URA3-hisG.

[0043] (2) Construction of engineered bacteria

[0044] The recombinant plasmid constructed in step (1) was transferred into yeast to obtain the genetically engineered bacteria.

[0045] Specifically, the method includes:

[0046] After linearizing the pMD-H1BRP constructed in (1.1), it was transformed into Yersinia lipophila for screening to obtain the mutant strain MC-BRP.

[0047] After linearizing the pMD-H2BRPG constructed in (1.2), it was transferred into the MC-BRP and screened to obtain the mutant strain MC-2BRP-G;

[0048] URA3-deficient MC-2BRP-G was screened to obtain MC-2BRP-G-FOA. After linearization by enzyme digestion of pMD-H3HM constructed in (1.3), it was transferred into the MC-2BRP-G-FOA for screening to obtain mutant strain MC-2BRP-GH.

[0049] URA3-deficient MC-2BRP-GH was screened to obtain MC-2BRP-GH-FOA. After linearization by digestion of pMD-H4BRP constructed in (1.4), it was transferred into the MC-2BRP-GH-FOA for screening to obtain mutant strain MC-3BRP-GH.

[0050] URA3-deficient MC-3BRP-GH was screened to obtain MC-3BRP-GH-FOA. After linearization by enzyme digestion of pMD-H5BSW constructed in (1.5), it was transferred into the MC-3BRP-GH-FOA for screening to obtain the mutant strain MC-CTX1-BSW.

[0051] The method of the present invention further includes adding to the genetically engineered bacteria MC-CTX1-BSW BSW , carB , carRP , GGS1 , tHMGR The copying step involves sequentially constructing one, two, or three of the following recombinant plasmids for the construction of genetically engineered bacteria.

[0052] (1.6) Construction of recombinant plasmid pMD-H6BSW

[0053] Genes BSW The recombinant plasmid pMD-H6BSW was obtained by constructing the recyclable screening marker hisG-URA3-hisG on the pMD19-T simple vector.

[0054] (1.7) Construction of recombinant plasmid pMD-H7BRP

[0055] Genes carB , carRP The recombinant plasmid pMD-H7BRP was constructed on the pMD19-T simple vector with the recyclable screening marker hisG-URA3-hisG.

[0056] (1.8) Construction of recombinant plasmid pMD-H8GH

[0057] Genes GGS1 , tHMGR The recombinant plasmid pMD-H8GH was obtained by constructing the recyclable screening marker hisG-URA3-hisG on the pMD19-T simple vector.

[0058] When the method further includes step (1.6) of constructing the recombinant plasmid pMD-H6BSW:

[0059] URA3-deficient MC-CTX1-BSW was screened to obtain MC-CTX1-BSW-FOA. After linearization by enzyme digestion of pMD-H6BSW constructed in (1.6), it was transferred into the MC-CTX1-BSW-FOA for screening to obtain mutant strain MC-CTX2.

[0060] When the method further includes step (1.7) of constructing the recombinant plasmid pMD-H7BRP:

[0061] URA3-deficient MC-CTX2 was screened to obtain MC-CTX2-FOA. After linearization by pMD-H7BRP enzyme digestion constructed in (1.7), it was transferred into the MC-CTX2-FOA for screening to obtain mutant strain MC-CTX3.

[0062] When the method further includes step (1.8) of constructing the recombinant plasmid pMD-H8GH:

[0063] URA3-deficient MC-CTX3 was screened to obtain MC-CTX3-FOA. After linearization by enzyme digestion of pMD-H8GH constructed in (1.8), it was transferred into the MC-CTX3-FOA for screening to obtain mutant strain MC-CTX4.

[0064] The present invention also provides the application of the construction method described above in the construction of genetically engineered bacteria that produce high levels of canthaxanthin.

[0065] The present invention also provides a fermentation method for producing canthaxanthin, wherein the genetically engineered bacteria described above are inoculated into a fermentation medium and fermented to obtain the canthaxanthin.

[0066] In this invention, when using shake-flask fermentation, there are no particular limitations on the composition of the fermentation medium. In some preferred embodiments, the fermentation medium consists of: glucose 30-90 g / L, peptone 8-30 g / L, yeast extract 8-45 g / L, potassium dihydrogen phosphate 0.5-8 g / L, ferrous sulfate 0.5-8 g / L, and the remainder being water. More preferably, the fermentation medium consists of: glucose 45-70 g / L, peptone 10-22 g / L, yeast extract 12-35 g / L, potassium dihydrogen phosphate 0.8-3 g / L, ferrous sulfate 0.8-3 g / L, and the remainder being water. Even more preferably, the fermentation medium consists of: glucose 60 g / L, peptone 15 g / L, yeast extract 20 g / L, potassium dihydrogen phosphate 1 g / L, ferrous sulfate 1 g / L, and the remainder being water.

[0067] There are no particular restrictions on the fermentation temperature. In some preferred embodiments, the fermentation temperature is 20-37℃, which can be 20-25℃, 25-28℃, 28-30℃, 25-30℃, 30-33℃, or 33-37℃, specifically 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37℃. In some preferred embodiments, the fermentation temperature is 28-30℃. In other preferred embodiments, the fermentation temperature is 28℃.

[0068] There is no particular limitation on the fermentation time. In some preferred embodiments, the fermentation time is 96-168 hours, which can be 96-108 hours, 108-120 hours, 120-136 hours, 136-148 hours, 148-158 hours, or 158-168 hours. In some preferred embodiments, the fermentation time is 136-148 hours. In other preferred embodiments, the fermentation time is 144 hours.

[0069] There are no particular restrictions on the fermentation speed. In some preferred embodiments, the fermentation speed is 180-280 rpm, which can be 180-200 rpm, 200-220 rpm, 220-240 rpm, 240-260 rpm, or 260-280 rpm. In some preferred embodiments, the fermentation speed is 200-260 rpm. In other preferred embodiments, the fermentation speed is 220 rpm.

[0070] In this invention, when using a fermenter for cultivation, there are no particular limitations on the composition of the fermentation medium. In some preferred embodiments, the fermentation medium consists of: glucose 30-70 g / L, peptone 8-30 g / L, yeast extract 8-45 g / L, potassium dihydrogen phosphate 1-8 g / L, ferrous sulfate 1-8 g / L, and the remainder being water. More preferably, the fermentation medium consists of: glucose 35-60 g / L, peptone 10-22 g / L, yeast extract 12-35 g / L, potassium dihydrogen phosphate 2-6 g / L, ferrous sulfate 2-6 g / L, and the remainder being water. Even more preferably, the fermentation medium consists of: glucose 40 g / L, peptone 15 g / L, yeast extract 20 g / L, potassium dihydrogen phosphate 4 g / L, ferrous sulfate 1 g / L, and the remainder being water.

[0071] There are no particular restrictions on the fermentation temperature. In some preferred embodiments, the fermentation temperature is 20-37℃, which can be 20-25℃, 25-28℃, 28-30℃, 25-30℃, 30-33℃, or 33-37℃. In some preferred embodiments, the fermentation temperature is 28-30℃. In other preferred embodiments, the fermentation temperature is 28℃.

[0072] There is no particular limitation on the fermentation time. In some preferred embodiments, the fermentation time is 96h~192h, which can be 96~120h, 120~144h, 144~168h, or 168~192h. In some preferred embodiments, the fermentation time is 144~168h. In other preferred embodiments, the fermentation time is 160h.

[0073] There are no particular restrictions on the fermentation speed. In some preferred embodiments, the fermentation speed is 450-600 rpm; it can be 450-480 rpm, 480-510 rpm, 510-540 rpm, 540-580 rpm, or 580-600 rpm. In some preferred embodiments, the fermentation speed is 400-600 rpm. Those skilled in the art can adjust the speed according to actual needs.

[0074] During fermentation, a carbon source is added. In some preferred embodiments, carbon source addition begins after 16 hours of fermentation. In some preferred embodiments, for a 5L fermenter containing 3L of fermentation medium, the flow rate of glucose (500 g / L, the remainder being water) added during fermentation is 3-20 ml / h. In some preferred embodiments, for a 5L fermenter containing 3L of fermentation medium, the flow rate of glucose (500 g / L, the remainder being water) added during fermentation is 8-12 ml / h. In some preferred embodiments, for a 5L fermenter containing 3L of fermentation medium, the flow rate of glucose added during fermentation is 10 ml / h.

[0075] Before inoculation into the fermentation medium, the method of the present invention further includes a process of preparing seed liquid, which includes inoculating the genetically engineered bacteria into a plate medium, and then cutting out a piece to inoculate into a seed medium to obtain seed liquid.

[0076] There are no particular limitations on the composition, incubation temperature, and incubation time of the plate culture medium. In some embodiments, the plate culture medium consists of: 8-40 g / L glucose, 8-45 g / L peptone, 5-20 g / L yeast extract, 10-30 g / L agar powder, and the remainder is water; the plate culture temperature is 20-37°C; and the plate culture time is 58-106 h.

[0077] There are no particular restrictions on the composition, culture temperature, and culture time of the seed culture medium. In some embodiments, the seed culture medium consists of: 8-40 g / L glucose, 8-45 g / L peptone, 5-20 g / L yeast extract, and the remainder is water; the seed culture temperature is 20-37°C; and the seed culture time is 20-32 h.

[0078] There are no particular restrictions on the inoculation amount of the seed culture into the fermentation medium. In some embodiments, the inoculation amount of the seed culture into the fermentation medium is 8-15%.

[0079] Compared to existing technologies, the beneficial effects of this invention include: obtaining a genetically engineered bacterium that produces cantharidin through genetic engineering technology, which overexpresses the GGPP synthase gene. GGS1 truncated form of HMG-CoA reductase gene tHMGR The β-carotene synthesis gene in *Mucor rotundifolia* that can convert GGPP into β-carotene carB and carRP And the β-carotene ketolase gene that can convert β-carotene into canthaxanthin. BSW The genetically engineered bacteria constructed using the method of this invention are excellent high-yield strains of canthaxanthin, achieving a canthaxanthin yield of 3.5 g / L. This invention regulates the canthaxanthin synthesis pathway by modulating the expression of key enzymes promoting canthaxanthin synthesis in microbial cells, thereby accelerating the metabolic flux towards the metabolites and achieving excessive accumulation of the canthaxanthin metabolite. This provides a new method and solution for modifying strains and increasing canthaxanthin production through metabolic engineering, with broad application prospects. Attached Figure Description

[0080] Figure 1 Assembly sequence of functional modules in plasmid pMD-H1BRP.

[0081] Figure 2 Assembly sequence of functional modules in plasmid pMD-H2BRPG.

[0082] Figure 3 Assembly sequence of functional modules in plasmid pMD-H3HM.

[0083] Figure 4Assembly sequence of functional modules in plasmid pMD-H4BRP.

[0084] Figure 5 Assembly sequence of functional modules in plasmid pMD-H5BSW.

[0085] Figure 6 Assembly sequence of functional modules in plasmid pMD-H6BSW.

[0086] Figure 7 Assembly sequence of functional modules in plasmid pMD-H7BRP.

[0087] Figure 8 Assembly sequence of functional modules in plasmid pMD-H8GH. Detailed Implementation

[0088] The present invention will be further described below with reference to specific embodiments. It should be understood that the following embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions or conditions provided by the manufacturer.

[0089] Before further describing specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for describing specific embodiments and not for limiting the scope of protection of the present invention; in the specification and claims of the present invention, unless otherwise expressly stated in the text, the singular forms "a", "an" and "this" include the plural forms.

[0090] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in the present invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art. In addition to the specific methods, apparatus, and materials used in the embodiments, based on the knowledge of the prior art possessed by one of ordinary skill in the art and the description of this invention, any prior art methods, apparatus, and materials similar to or equivalent to those described, apparatus, and materials in the embodiments of this invention may be used to implement the present invention.

[0091] Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in this invention all employ conventional techniques in molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related fields.

[0092] (a) Experimental materials

[0093] (1) The primer sequence information used in this invention is shown in Table 1.

[0094] Table 1 Primer List

[0095]

[0096]

[0097]

[0098]

[0099]

[0100]

[0101] SEQ ID NO:91

[0102] BSW

[0103] atgcacgccgccaccgccaaggccaccgagttcggcgcctctcgacgagacgacgcccgacagcgacgagtgggcctgaccctggccgccgtgattatcgccgcctggctggtgctgcacgtgggcctgatgttcttctggcccctgaccctgcactctctgctgcccgccctgcccctggtggtgctgcagacctggctgtacgtgggcctgttcatcatcgcccacgactgtatgcacggctctctggtgcccttcaagccccaagtgaaccgacgaatcggacagctgtgtctgttcctgtacgccggcttctctttcgacgccctgaacgtagagcaccacaagcaccaccgacaccccggcacagccgaagacccggatttcgacgaggtgcccccccacggcttctggcactggttcgcctctttcttcctgcactacttcggctggaagcaagtggccataatcgccgccgtgtctctggtgtatcagctggtgttcgccgtgcccctgcagaacatcctgctgttctgggccctgcccggcctgctgtctgccctgcagctgttcaccttcggcacctacctgccccacaagcccgccactcagcccttcgccgaccgacacaacgcccgaacctctgagttccccgcctggctgtctctgctgacctgtttccacttcggcttccatcatgagcaccacttgcacccggatgccccctggtggcgactgcccgagatcaagcgacgagccctggagcgacgagactaa

[0104] SEQ ID NO:92

[0105] SMW

[0106] atgaccgtggatcacgatgcccgaatctctctgctgctggccgccgccataggcgcggcctggctggccattcacgtgggcgccatagtatggtggcgatggtctcccgcgacagccgtgctggccatccccgtggtgctggtgcaagcctggctgtctaccggcctgttcatcgtggcccacgactgtatgcacggctctttcgtgcccggccgacccgccgtgaaccgaaccgtgggcaccctgtgtctgggcgcctacgccggcctgtcttacggacagctacaccccaaacatcacgctcatcatgatgccccgggtaccgcagccgaccctgatttccacgccggcgctccccgatctgccctgccctggttcgcccgattcttcacctcttactacacccacggacagatcctgcgaatcaccgccgccgccgtgctgtacatgctgctgggcgtgtctctgctgaacatcgtggtgttctgggccctgcccgccctgatcgccctggctcagctgttcgtgttcggcaccttcctgccccaccgacacggcgacacccccttcgccgacgcccacaacgcccgatctaacggctggccccgactggcctctctggccacctgtttccacttcggcgcctaccaccacgagcaccatctgtctccctggaccccctggtggcaactcccccgagttgggcaacctgccgccggccaccgatctctgtctaaggaccgataa

[0107] SEQ ID NO:93

[0108] BVW

[0109] atgtctgccgtgacccccatgtctcgagtggttcccaaccaagcgctgataggcctcactctggcgggtctgatcgccgccgcctggctgaccctgcacatctacggcgtgtacttccaccgatggaccatctggtctgtgctcaccgtgcccctgatcgtggccggacagacctggctgtctgtgggcctgttcatagtcgcccacgacgccatgcatgggtctctggcacccgcccgaccccgactgaacaccgccatcggatctctggccctggccctgtacgccggcttccgttttacgcccctgaaaacggcgcatcatgcccatcatgccgcaccgggtaccgcagacgaccccgactttcacgcggacgccccccgagccttcctgccctggttctacggcttcttccgaacctactttggctggcgagagctggccgtgttgaccgtactggtggctgttgccgtgctgatcctgggtgcccgaatgccgaaccttctggtgttctgggccgcacccgccctgctgtctgccctgcagctgttcaccttcggcacctggctgccccaccgacacaccgacgacgccttccccgacaaccacaacgcccgaacctctcccttcggccccgtgctgtctctgctgacctgtttccacttcggccgacaccacgagcaccacctgaccccctggaagccctggtggtctctgttctcttaa

[0110] SEQ ID NO:94

[0111] GGS1

[0112] atggattataacagcgcggatttcaaggagatatggggcaaggccgccgacaccgcgctgctgggaccgtacaactacctcgccaacaaccggggccacaacatcagagaacacttgatcgcagcgttcggagcggttatcaaggtggacaagagcgatctcgagaccatttcgcacatcaccaagattttgcataactcgtcgctgcttgttgatgacgtggaagacaactcgatgctccgacgaggcctgccggcagcccattgtctgtttggagtcccccaaaccatcaactccgccaactacatgtactttgtggctctgcaggaggtgctcaagctcaagtcttatgatgccgtctccattttcaccgaggaaatgatcaacttgcatagaggtcagggtatggatctctactggagagaaacactcacttgcccctcggaagacgagtatctggagatggtggtgcacaagaccggtggactgtttcggctggctctgagacttatgctgtcggtggcatcgaaacaggaggaccatgaaaagatcaactttgatctcacacaccttaccgacacactgggagtcatttaccagattctggatgattacctcaacctgcagtccacggaattgaccgagaacaagggattctgcgaagatatcagcgaaggaaagttttcgtttccgctgattcacagcatacgcaccaacccggataaccacgagattctcaacattctcaaacagcgaacaagcgacgcttcactcaaaaagtacgccgtggactacatgagaacagaaaccaagagtttcgactactgcctcaagaggatacaggccatgtcactcaaggcaagttcgtacattgatgatctagcagcagctggccacgatgtctccaagctacgagccattttgcattattttgtgtccacctctgactgtgaggagagaaagtactttgaggatgcgcagtga

[0113] SEQ ID NO:95

[0114] tHMGR

[0115]

[0116] (2) Yeast lipophila MYA-2613 was purchased from ATCC.

[0117] (3) pMD19-T simple vector, purchased from TAKARA.

[0118] (4) β-carotene synthesis gene in Mucor truncatula carB See GeneBank accession number AJ238028. Synthesized by Suzhou Hongxun Biotechnology Co., Ltd., it was inserted into the pUC57 vector to obtain pUC-CB.

[0119] (5) β-carotene synthesis gene in Mucor truncatula carRP See GeneBank accession number AJ250827. Synthesized by Suzhou Hongxun Biotechnology Co., Ltd., it was inserted into the pUC57 vector to obtain pUC-CRP.

[0120] (6) Bradyrhizobium β-Carotene Ketoylase Gene in sp. ORS278 crtW See GeneBank accession number AF218415, perform codon optimization on it, and name the optimized gene as follows: BSW The sequence is shown in SEQ ID NO:91. It was synthesized by Suzhou Hongxun Biotechnology Co., Ltd. and inserted into the pUC57 vector to obtain pUC-BSW.

[0121] (7) Sphingomonas melonis β-Carotene ketolase gene in DC18 crtW See GeneBank accession number DQ400932, perform codon optimization on it, and name the optimized gene as... SMW The sequence is shown in SEQ ID NO:92. It was synthesized by Suzhou Hongxun Biotechnology Co., Ltd. and inserted into the pUC57 vector to obtain pUC-SMW.

[0122] (8) Brevundimonas vesicularis β-Carotene ketolase gene in DC263 crtW See GeneBank accession number DQ309446, perform codon optimization on it, and name the optimized gene as... BVW The sequence is shown in SEQ ID NO:93. It was synthesized by Suzhou Hongxun Biotechnology Co., Ltd. and inserted into the pUC57 vector to obtain pUC-BVW.

[0123] (9) The leu screening marker is found in Genebank accession number M37309. It was synthesized by Suzhou Hongxun Biotechnology Co., Ltd. and inserted into the pUC57 vector to obtain pUC-LEU.

[0124] (10) The retrievable hisG-URA3-hisG screening marker can be constructed by referring to the literature (Voth WP, Richards JD, Shaw JM, et al. Yeast vectors for integration at the HO locus. Nucleic Acids Res. 2001, 29(12):E59). Among them, URA3 (genebank accession number AJ306421) was synthesized by Suzhou Hongxun Biotechnology Co., Ltd., and hisG sequence (genebank accession number AF324729) was added to both ends of it and inserted into the pUC57 vector to obtain pUC-HUH.

[0125] (11) Gene GGS1 (The polynucleotide sequence is shown in SEQ ID NO: 94) tHMGR (The polynucleotide sequence is shown in SEQ ID NO: 95), promoters TEFp, EXPp, GPDp, and terminators PEXt, XPRt, and LIPt are all derived from *Yarrowia lipolytica* MYA-2613 and obtained by PCR. In this invention, the genes mentioned, such as the gene encoding β-carotene ketolase, GGS1, tHMGR , carB , carRP This refers to the polynucleotides in the gene.

[0126] (II) Shaking-flask fermentation of engineered bacteria producing β-carotene and product detection

[0127] The β-carotene-producing engineered bacteria were streaked onto YPD plates (20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract, 20 g / L agar powder, and the remainder water) and cultured at 28°C for 3 days. A small amount was then inoculated into a 250 mL shake flask containing 25 mL of YPD seed culture medium (20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract, and the remainder water) and cultured at 28°C with shaking at 220 rpm for 24 hours. Then, the seed culture was transferred at a 10% (v / v) inoculation rate to a 250 mL shake flask containing 25 mL of fermentation medium (50 g / L glucose, 15 g / L peptone, 20 g / L yeast extract, and the remainder water) and cultured at 28°C with shaking at 220 rpm for 5 days. β-carotene production was detected using HPLC. The HPLC method refers to Yoon SH, Lee SH, Das A, et al. Combinatorial expression of bacterial whole mevalonate pathway for the production of beta-carotene in E. coli. J Biotechnol. 2009,140(3-4):218-226.

[0128] (III) Shaking-flask fermentation of engineered bacteria producing cantharidin and product detection

[0129] Following the process of β-carotene-producing engineered bacteria fermentation and product detection, the fermentation medium was changed to 60 g / L glucose, 15 g / L peptone, 20 g / L yeast extract, 1 g / L potassium dihydrogen phosphate, 1 g / L ferrous sulfate, with the remainder being water, and fermentation was carried out for 6 days.

[0130] Example 1: Construction of β-carotene-producing engineered bacteria and fermentation in a vial

[0131] This embodiment expresses the β-carotene synthesis gene of *Rhizopus rubra* in *Yersinia lipolyticis* MYA-2613. carB and carPR GGPP is converted into β-carotene, and then the GGPP synthase gene is overexpressed. GGS1 truncated form of HMG-CoA reductase gene tHMGR Increase the supply of the precursor GGPP, and further increase the supply of the precursor GGPP. carB and carPR Copy number promotes the conversion of GGPP to β-carotene, thereby enhancing the synthesis of β-carotene.

[0132] 1.1 Construction of recombinant plasmid pMD-H1BRP

[0133] (1) Using Yersinia lipophila MYA-2613 chromosome as a template, the homologous arm sequences on the chromosome were amplified using primers H1U-F / R (SEQ ID NO:1~2) and H1D-F / R (SEQ ID NO:3~4), and the two were linked together by overlap PCR and inserted into the pMD19-T simple vector to obtain the pMD-H1 plasmid.

[0134] (2) Using Yersinia lipolyticis chromosome MYA-2613 as a template, the promoter TEFp and terminator PEXt were amplified using primers TEF1-F / R (SEQ ID NO:5~6) and PEX1-F / R (SEQ ID NO:9~10), respectively; using pUC-CB as a template, the promoter TEFp and terminator PEXt were amplified using primers CB1-F / R (SEQ ID NO:7~8). carB Genes; then, the TEFp-carB-PEXt module was constructed by overlap PCR.

[0135] (3) Using Yersinia lipolyticis chromosome MYA-2613 as a template, the promoter EXPp and terminator XPRt were amplified using primers EXP1-F / R (SEQ ID NO:11~12) and XPR1-F / R (SEQ ID NO:15~16), respectively; using pUC-CRP as a template, the promoter EXPp and terminator XPRt were amplified using primers CRP1-F / R (SEQ ID NO:13~14). carRP Genes; then the EXPp-carRP-XPRt module was constructed by overlap PCR.

[0136] (3) Using pUC-LEU as a template, the selection marker leu was amplified using primers LEU-F / R (SEQ ID NO:17~18).

[0137] (4) Using the One Step Fusion Cloning Mix kit (TOROIVD), the TEFp-carB-PEXt module, EXPp-carRP-XPRt module, and the selection marker leu were integrated into the homologous arms of the pMD-H1 plasmid to construct pMD-H1BRP. The assembly order of each functional module in pMD-H1BRP is shown in [reference needed]. Figure 1 .

[0138] 1.2 Construction of recombinant plasmid pMD-H2BRPG

[0139] (1) Using Yersinia lipophila MYA-2613 chromosome as a template, the homologous arm sequences on the chromosome were amplified using primers H2U-F / R (SEQ ID NO:19~20) and H2D-F / R (SEQ ID NO:21~22), and the two were linked together by overlap PCR and inserted into the pMD19-T simple vector to obtain the pMD-H2 plasmid.

[0140] (2) The recyclable screening marker hisG-URA3-hisG on pUC-HUH was inserted into pMD-H2 by enzyme digestion to obtain pMD-H2-HUH.

[0141] (3) Using Yersinia lipolyticis chromosome MYA-2613 as a template, the promoter EXPp and terminator XPRt were amplified using primers EXP2-F / R (SEQ ID NO:23~24) and XPR2-F / R (SEQ ID NO:27~28), respectively; using pUC-CB as a template, the promoter EXPp and terminator XPRt were amplified using primers CB2-F / R (SEQ ID NO:25~26). carB Genes; then the EXPp-carB-XPRt module was constructed by overlap PCR.

[0142] (4) Using Yersinia lipolyticis chromosome MYA-2613 as a template, the promoter TEFp and terminator PEXt were amplified using primers TEF2-F / R (SEQ ID NO:29~30) and PEX2-F / R (SEQ ID NO:33~34), respectively; using pUC-CRP as a template, the promoter TEFp and terminator PEXt were amplified using primers CRP2-F / R (SEQ ID NO:31~32). carRP Genes; then, the TEFp-carRP-PEXt module was constructed by overlap PCR.

[0143] (5) Using the Yersinia lipolyticis MYA-2613 chromosome as a template, the promoter GPDp and gene were amplified using primers GPD-F / R (SEQ ID NO:35~36), GGS-F / R (SEQ ID NO:37~38), and LIP-F / R (SEQ ID NO:39~40), respectively. GGS1 The terminator LIPt was then used to construct the GPDp-GGS1-LIPt module via overlap PCR.

[0144] (6) Using the One Step Fusion Cloning Mix kit (TOROIVD), the EXPp-carB-XPRt module, TEFp-carRP-PEXt module, and GPDp-GGS1-LIPt module were integrated into the pMD-H2-HUH plasmid to obtain pMD-H2BRPG. The assembly order of each functional module in pMD-H2BRPG is shown in [reference needed]. Figure 2 .

[0145] 1.3 Construction of recombinant plasmid pMD-H3HM

[0146] (1) Using the Yeast MYA-2613 chromosome as a template, the homologous arm sequences on the chromosome were amplified using primers H3U-F / R (SEQ ID NO:41~42) and H3D-F / R (SEQ ID NO:43~44), and the two were linked together by overlap PCR and inserted into the pMD19-T simple vector to obtain the pMD-H3 plasmid.

[0147] (2) The recyclable screening marker hisG-URA3-hisG on pUC-HUH was inserted into pMD-H3 by enzyme digestion to obtain pMD-H3-HUH.

[0148] (3) Using the Yeast lipophila MYA-2613 chromosome as a template, the promoter TEFp and gene were amplified using primers TEF3-F / R (SEQ ID NO:45~46), HMGR-F / R (SEQ ID NO:47~48), and PEX3-F / R (SEQ ID NO:49~50), respectively. tHMGR The terminator PEXt was then used to construct the TEFp-tHMGR-PEXt module via overlap PCR.

[0149] (4) The TEFp-tHMGR-PEXt module was integrated into the pMD-H3-HUH plasmid using the One Step Fusion Cloning Mix kit (TOROIVD) to obtain pMD-H3HM. The assembly order of each functional module in pMD-H3HM is shown in the figure. Figure 3 .

[0150] 1.4 Construction of recombinant plasmid pMD-H4BRP

[0151] (1) Using the Yeast MYA-2613 chromosome as a template, the homologous arm sequences on the chromosome were amplified using primers H4U-F / R (SEQ ID NO:51~52) and H4D-F / R (SEQ ID NO:53~54), and the two were linked together by overlap PCR and inserted into the pMD19-T simple vector to obtain the pMD-H4 plasmid.

[0152] (2) The recyclable screening marker hisG-URA3-hisG on pUC-HUH was inserted into pMD-H4 by enzyme digestion to obtain pMD-H4-HUH.

[0153] (3) Using the pMD-H1BRP constructed in 1.1 as a template, the TEFp-carB-PEXt+EXPp-carRP-XPRt module was amplified using primers BRP-F / R (SEQ ID NO:55~56).

[0154] (4) The TEFp-carB-PEXt+EXPp-carRP-XPRt module was integrated into the pMD-H4-HUH plasmid using the One Step Fusion Cloning Mix kit (TOROIVD) to obtain pMD-H4BRP. The assembly order of each functional module in pMD-H4BRP is shown in the figure. Figure 4 .

[0155] 1.5 Construction of engineered bacteria and shake-flask fermentation

[0156] The pMD-H1BRP constructed in 1.1 was linearized by digestion with PmeⅠ and then transformed into *Yeast Immunodeficiency syndrome* MYA-2613 using the Frozen-EZ Yeast Transformation II Kit (ZYMO RESEARCH). The transformed material was then plated on SD+URA agar plates (20 g / L glucose, 6.7 g / L YNB (yeast basal nitrogen source), 10 mg / L uracil, 20 g / L agar powder, and the remainder water). Orange-yellow colonies were picked and screened to obtain the mutant strain MC-BRP, which yielded 32.6 mg / L of β-carotene in shake-flasks.

[0157] Following the MC-BRP construction process, the pMD-H2BRPG constructed in 1.2 was linearized by SwaⅠ restriction enzyme digestion and then transformed into the mutant strain MC-BRP. The mixture was then plated on SD medium plates (20 g / L glucose, 6.7 g / L YNB (yeast basal nitrogen source), 20 g / L agar powder, and the remainder being water). The mutant strain MC-2BRP-G was obtained by screening, and its β-carotene yield in shake-flask was 179.0 mg / L.

[0158] MC-2BRP-G was cultured in YPD (20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract, the remainder being water), then diluted and spread onto YPD+FOA agar plates (20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract, 1 g / L 5-fluoroorotic acid, 20 g / L agar powder). The URA3-deficient mutant strain MC-2BRP-G-FOA was obtained by selection. Then, following the MC-2BRP-G construction process, pMD-H3HM constructed in section 1.3 was linearized by SwaI restriction enzyme digestion and transformed into MC-2BRP-G-FOA. The mutant strain MC-2BRP-GH was obtained through screening, with a β-carotene yield of 303.8 mg / L.

[0159] Following the construction process of MC-2BRP-GH, URA3-deficient MC-2BRP-GH-FOA was selected. Then, pMD-H4BRP constructed in step 1.4 was linearized by SwaI restriction enzyme digestion and transformed into MC-2BRP-GH-FOA. The mutant strain MC-3BRP-GH was obtained by screening, with a β-carotene yield of 501.3 mg / L.

[0160] Example 2: Screening of β-carotene ketolase genes

[0161] Cantharidin is a continuation of β-carotene synthesis, formed by ketylation modification of β-carotene at the C4 and C4′ sites by β-carotene ketylase. The different biogenic sources of ketylases exhibit varying activities and substrate specificities, which can affect the synthesis of cantharidin. This example will be derived from... Bradyrhizobium sp. ORS278, Sphingomonas melonis DC18 Brevundimonas vesicularis After codon optimization, the β-carotene ketolase gene from DC263 was introduced into the β-carotene-producing bacterium MC-3BRP-GH. The roles and activities of each gene in cantharidin synthesis were compared to screen for suitable ketolase genes.

[0162] 2.1 Construction of recombinant plasmid pMD-H5BSW

[0163] (1) Using Yersinia lipophila MYA-2613 chromosome as a template, the homologous arm sequences on the chromosome were amplified using primers H5U-F / R (SEQ ID NO:57~58) and H5D-F / R (SEQ ID NO:59~60), and the two were linked together by overlap PCR and inserted into the pMD19-T simple vector to obtain the pMD-H5 plasmid.

[0164] (2) The recyclable screening marker hisG-URA3-hisG on pUC-HUH was inserted into pMD-H5 by enzyme digestion to obtain pMD-H5-HUH.

[0165] (3) Using Yersinia lipophila MYA-2613 chromosome as a template, the promoter EXPp and terminator XPRt were amplified using primers EXP3-F / R (SEQ ID NO:61~62) and XPR3-F (SEQ ID NO:65) / BRP-R (SEQ ID NO:56), respectively; using pUC-BSW as a template, the promoter EXPp and terminator XPRt were amplified using primers BSW-F / R (SEQ ID NO:63~64). BSW Genes; then the EXPp-BSW-XPRt module was constructed by overlap PCR.

[0166] (4) The EXPp-BSW-XPRt module was integrated into the pMD-H5-HUH plasmid using the One Step Fusion Cloning Mix kit (TOROIVD) to obtain pMD-H5BSW. The assembly order of each functional module in pMD-H5BSW is shown in [reference needed]. Figure 5 .

[0167] 2.2 Construction of recombinant plasmid pMD-H5SMW

[0168] Following the pMD-H5BSW construction process in section 2.1, using the Yersinia lipophila MYA-2613 chromosome as a template, the promoter EXPp and terminator XPRt were amplified using primers EXP3-F (SEQ ID NO:61) / EXP4-R (SEQ ID NO:66) and XPR4-F (SEQ ID NO:69) / BRP-R (SEQ ID NO:56), respectively. Using pUC-SMW as a template, primers SMW-F / R (SEQ ID NO:67~68) were used to amplify... SMW Genes were extracted; then, the EXPp-SMW-XPRt module was constructed using overlap PCR. The pMD-H5-HUH plasmid was then inserted to obtain pMD-H5SMW.

[0169] 2.3 Construction of recombinant plasmid pMD-H5BVW

[0170] Following the pMD-H5BSW construction process in section 2.1, using Yersinia lipophila MYA-2613 chromosome as a template, the promoter EXPp and terminator XPRt were amplified using primers EXP3-F (SEQ ID NO:61) / EXP5-R (SEQ ID NO:70) and XPR5-F (SEQ ID NO:73) / BRP-R (SEQ ID NO:56), respectively. Using pUC-BVW as a template, primers BVW-F / R (SEQ ID NO:71~72) were used to amplify... BVW Genes were extracted; then, the EXPp-BVW-XPRt module was constructed using overlap PCR. The pMD-H5-HUH plasmid was then inserted to obtain pMD-H5BVW.

[0171] 2.4 Effects of β-carotene ketolase genes from different sources on the yield of engineered cantharidin.

[0172] MC-3BRP-GH was cultured in YPD (20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract, the remainder being water), then diluted and spread on YPD+FOA agar plates (20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract, 1 g / L 5-fluoroorotic acid, 20 g / L agar powder). URA3-deficient MC-3BRP-GH-FOA was selected. Then, pMD-H5BSW constructed in 2.1 was linearized by SwaⅠ restriction enzyme digestion and transformed into MC-3BRP-GH-FOA using the Frozen-EZ Yeast Transformation II Kit (ZYMORESEARCH). The transformed MC-3BRP-GH-FOA was spread on SD agar plates (20 g / L glucose, 6.7 g / L YNB (yeast basal nitrogen source), 20 g / L agar powder, the remainder being water), and the mutant strain MC-CTX1-BSW was obtained through screening.

[0173] Following the construction process of MC-CTX1-BSW, pMD-H5SMW constructed in 2.2 was linearized by digestion with SwaⅠ and then transformed into MC-3BRP-GH-FOA. The mutant strain MC-CTX1-SMW was obtained by screening.

[0174] Following the construction process of MC-CTX1-BSW, pMD-H5BVW constructed in 2.3 was linearized by digestion with SwaⅠ and then transformed into MC-3BRP-GH-FOA. The mutant strain MC-CTX1-BVW was obtained by screening.

[0175] Cantharidin production was assessed using shaken-flask fermentation with MC-3BRP-GH, MC-CTX1-BSW, MC-CTX1-SMW, and MC-CTX1-BVW strains. The cantharidin yields for each strain are shown in Table 2. This indicates that the β-carotene ketolase gene was used in the fermentation process. BSW The engineered bacteria produced higher yields and better results in cantharidin production.

[0176] Table 2. Cantharides yellow bottle yields from mutant strains of ketolase genes from different sources.

[0177]

[0178] Example 3: Construction of high-yield engineered strains for cantharidin and shake-flask fermentation

[0179] This embodiment adds to the MC-CTX1-BSW. BSW Copying, enhancing the conversion of β-carotene to canthaxanthin, and then by increasing... carB , carRP , GGS1 and tHMGR Copy number further promotes metabolic shift towards β-carotene synthesis, providing sufficient substrate for canthaxanthin synthesis, thereby increasing canthaxanthin synthesis.

[0180] 3.1 Construction of recombinant plasmid pMD-H6BSW

[0181] (1) Using Yersinia lipophila MYA-2613 chromosome as a template, the homologous arm sequences on the chromosome were amplified using primers H6U-F / R (SEQ ID NO:74~75) and H6D-F / R (SEQ ID NO:76~77), and the two were linked together by overlap PCR and inserted into the pMD19-T simple vector to obtain the pMD-H6 plasmid.

[0182] (2) The recyclable screening marker hisG-URA3-hisG on pUC-HUH was inserted into pMD-H6 by enzyme digestion to obtain pMD-H6-HUH.

[0183] (3) Using the pMD-H5BSW constructed in 2.1 as a template, the EXPp-BSW-XPRt module was amplified using primers EWX-F (SEQ ID NO:78) / BRP-R (SEQ ID NO:56).

[0184] (4) The EXPp-BSW-XPRt module was integrated into the pMD-H6-HUH plasmid using the One Step Fusion Cloning Mix kit (TOROIVD) to obtain pMD-H6BSW. The assembly order of each functional module in pMD-H6BSW is shown in the figure. Figure 6 .

[0185] 3.2 Construction of recombinant plasmid pMD-H7BRP

[0186] (1) Using Yersinia lipophila MYA-2613 chromosome as a template, the homologous arm sequences on the chromosome were amplified using primers H7U-F / R (SEQ ID NO:79~80) and H7D-F / R (SEQ ID NO:81~82), and the two were linked together by overlap PCR and inserted into the pMD19-T simple vector to obtain the pMD-H7 plasmid.

[0187] (2) The recyclable screening marker hisG-URA3-hisG on pUC-HUH was inserted into pMD-H7 by enzyme digestion to obtain pMD-H7-HUH.

[0188] (3) Using the pMD-H4BRP constructed in 1.4 as a template, the TEFp-carB-PEXt+EXPp-carRP-XPRt module was amplified using primers BRP2-F (SEQ ID NO:83) / BRP-R (SEQ ID NO:56).

[0189] (4) The TEFp-carB-PEXt+EXPp-carRP-XPRt module was integrated into the pMD-H7-HUH plasmid using the One Step Fusion Cloning Mix kit (TOROIVD) to obtain pMD-H7BRP. The assembly order of each functional module in pMD-H7BRP is shown in the figure. Figure 7 .

[0190] 3.3 Construction of recombinant plasmid pMD-H8GH

[0191] (1) Using Yersinia lipophila MYA-2613 chromosome as a template, the homologous arm sequences on the chromosome were amplified using primers H8U-F / R (SEQ ID NO:84~85) and H8D-F / R (SEQ ID NO:86~87), and the two were linked together by overlap PCR and inserted into the pMD19-T simple vector to obtain the pMD-H8 plasmid.

[0192] (2) The recyclable screening marker hisG-URA3-hisG on pUC-HUH was inserted into pMD-H8 by enzyme digestion to obtain pMD-H8-HUH.

[0193] (3) Using pMD-H2BRPG constructed in 1.2 as a template, the GPDp-GGS1-LIPt module was amplified using primers GGL-F / R (SEQ ID NO:88~89). Using pMD-H3HM constructed in 1.3 as a template, the TEFp-tHMGR-PEXt module was amplified using primers THP-F (SEQ ID NO:90) / PEX3-R (SEQ ID NO:50).

[0194] (4) Using the One Step Fusion Cloning Mix kit (TOROIVD), the GPDp-GGS1-LIPt and TEFp-tHMGR-PEXt modules were integrated into the pMD-H8-HUH plasmid to obtain pMD-H8GH. The assembly order of each functional module in pMD-H8GH is shown in [reference needed]. Figure 8 .

[0195] 3.4 Construction of engineered bacteria

[0196] Referring to the construction process of MC-CTX1-BSW in section 2.4, URA3-deficient MC-CTX1-BSW-FOA was selected. Then, pMD-H6BSW constructed in section 3.1 was linearized by digestion with SwaI and transformed into MC-CTX1-BSW-FOA, and the mutant strain MC-CTX2 was obtained through screening.

[0197] Following the construction process of MC-CTX1-BSW in section 2.4, MC-CTX2-FOA with URA3 deficiency was selected. Then, pMD-H7BRP constructed in section 3.2 was linearized by digestion with SwaI and transformed into MC-CTX2-FOA, and the mutant strain MC-CTX3 was obtained through screening.

[0198] Following the construction process of MC-CTX1-BSW in section 2.4, MC-CTX3-FOA with URA3 deficiency was selected. Then, pMD-H8GH constructed in section 3.3 was linearized by digestion with SwaI and transformed into MC-CTX3-FOA, and the mutant strain MC-CTX4 was obtained through screening.

[0199] 3.5 Shaking-flask fermentation of engineered bacteria producing cantharidin and product detection

[0200] MC-CTX2, MC-CTX3, and MC-CTX4 were subjected to shake-flask fermentation, and the canthaxanthin yield of each strain is shown in Table 3.

[0201] Table 3. Yield of each strain of cantharides in shaken bottles

[0202]

[0203] Example 4: Production of Cantharidin by Fermentation of Engineered Bacteria MC-CTX in 4 Tanks

[0204] The mutant strain MC-CTX4 was streaked onto YPD plates (20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract, 20 g / L agar powder, and the remainder water) and cultured at 28°C for 3 days. The resulting fragments were then inoculated into 500 mL shake flasks containing 50 mL of YPD seed culture medium (20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract, and the remainder water) and cultured at 28°C with shaking at 220 rpm for 24 h. Then, the seed culture was transferred at a 10% (v / v) inoculation rate to a 5 L fermenter containing 3 L of fermentation medium (40 g / L glucose, 15 g / L peptone, 20 g / L yeast extract, 4 g / L potassium dihydrogen phosphate, 1 g / L ferrous sulfate, and the remainder water). Fermentation temperature was 28℃, aeration rate was 1:1 (vol:vol), stirring speed was 400-600 rpm, and glucose (500 g / L, the remainder water) was added starting at 16 h at a flow rate of 10 ml / h. In three fermentation batches, the cantharidin yields of MC-CTX4 at 160 h were 3.37 g / L, 3.58 g / L, and 3.54 g / L, respectively, with an average cantharidin yield of 3.5 g / L.

[0205] The above embodiments are for illustrating the implementation schemes disclosed in this invention and should not be construed as limiting the invention. Furthermore, various modifications listed herein, as well as variations in the methods and compositions of the invention, will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been specifically described in conjunction with various specific preferred embodiments, it should be understood that the invention should not be limited to these specific embodiments. In fact, various modifications as described above that are obvious to those skilled in the art to obtain the invention should be included within the scope of this invention.

Claims

1. A genetically engineered bacterium, characterized in that, It can ferment to produce canthaxanthin, and the genetically engineered bacteria contain a polynucleotide encoding β-carotene ketolase, the polynucleotide encoding β-carotene ketolase being derived from... Bradyrhizobium The ketogenic enzyme of sp. ORS278, wherein the polynucleotide encoding β-carotene ketogenic enzyme is a codon-optimized polynucleotide suitable for yeast expression, and the sequence of the polynucleotide encoding β-carotene ketogenic enzyme is shown in SEQ ID NO: 91; The genetically engineered bacteria also contain GGS1, tHMGR , carB , carRP; The genetically engineered bacteria is yeast. ， The yeast is *Yarrowia lipophila* MYA-2613. GGS1 The polynucleotide sequence is shown in SEQ ID NO: 94; tHMGR The polynucleotide sequence is shown in SEQ ID NO: 95; carB Genebank login number AJ238028; The carRP Genebank login number AJ250827; The polynucleotide encoding β-carotene ketolase has two copies. GGS1 The number of copies is three, the aforementioned tHMGR The number of copies is two, the aforementioned carB The number of copies is four, the aforementioned carRP The number of copies is four.

2. The engineered bacteria as described in claim 1, characterized in that, The polynucleotide encoding β-carotene ketolase 、 GGS1, tHMGR , carB , carRP The two ends are also connected to a starter and a stopper.

3. The engineered bacteria according to claim 2, characterized in that, The promoter is selected from TEFp, EXPp, and GPDp, and the terminator is selected from PEXt, XPRt, and LIPt. The promoter and terminator are derived from Yersinia lipophila MYA-2613.

4. The application of the genetically engineered bacteria as described in any one of claims 1 to 3 in the fermentation production of cantharidin.

5. A fermentation method for producing canthaxanthin, characterized in that, The genetically engineered bacteria as described in any one of claims 1 to 3 are inoculated into a fermentation medium, and the cantharidin is obtained by fermentation.

6. A method for constructing a cantharidin-producing genetically engineered bacterium as described in claim 1, characterized in that, The method includes: (1) Construction of recombinant plasmids (1.1) Construction of recombinant plasmid pMD-H1BRP Genes carB , carRP The recombinant plasmid pMD-H1BRP was obtained by constructing the selection marker leu on the pMD19-T simple vector. (1.2) Construction of recombinant plasmid pMD-H2BRPG Genes carB , carRP , GGS1 The recombinant plasmid pMD-H2BRPG was constructed on the pMD19-T simple vector with the recyclable screening marker hisG-URA3-hisG. (1.3) Construction of recombinant plasmid pMD-H3HM Genes tHMGR The recombinant plasmid pMD-H3HM was constructed on the pMD19-T simple vector with the recyclable screening marker hisG-URA3-hisG. (1.4) Construction of recombinant plasmid pMD-H4BRP Genes carB , carRP The recombinant plasmid pMD-H4BRP was constructed on the pMD19-T simple vector with the recyclable screening marker hisG-URA3-hisG. (1.5) Construction of recombinant plasmid pMD-H5BSW Genes BSW The recombinant plasmid pMD-H5BSW was constructed on the pMD19-T simple vector with the recyclable screening marker hisG-URA3-hisG. Step (1) further includes sequentially constructing the following recombinant plasmids for the construction of genetically engineered bacteria: (1.6) Construction of recombinant plasmid pMD-H6BSW Genes BSW The recombinant plasmid pMD-H6BSW was constructed on the pMD19-T simple vector with the recyclable screening marker hisG-URA3-hisG. (1.7) Construction of recombinant plasmid pMD-H7BRP Genes carB , carRP The recombinant plasmid pMD-H7BRP was constructed on the pMD19-T simple vector with the recyclable screening marker hisG-URA3-hisG. (1.8) Construction of recombinant plasmid pMD-H8GH Genes GGS1 , tHMGR The recombinant plasmid pMD-H8GH was obtained by constructing the recyclable screening marker hisG-URA3-hisG on the pMD19-T simple vector. (2) Construction of engineered bacteria The recombinant plasmid constructed in step (1) was transferred into Yersinia lipophila MYA-2613 to obtain the genetically engineered strain.

Images