ShRNA targeting circular RNA, lentivirus expression vector and construction method and application thereof

Abstract

The application discloses a kind of shRNA of targeting circular RNA, it is characterized in that the circular RNA is circular RNA hsa_circ_0005571, the shRNA includes sense strand, antisense strand, stem-loop structure and termination signal.The application also discloses the lentiviral expression vector of the above-mentioned shRNA and its construction method.The shRNA of targeting circular RNA hsa_circ_0005571 of the application can down-regulate the expression of hsa_circ_0005571 by transfection shRNA, significantly inhibits cancer cell activity, and provides basis for clinical treatment and scientific research of cervical cancer related circRNA.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a shRNA targeting circular RNA, a lentiviral expression vector, its construction method, and its application. Background Technology

[0002] As one of the most common gynecological malignancies, cervical cancer has become a significant public health issue. In recent years, with the use of human papillomavirus (HPV) vaccines and the widespread implementation of cervical cancer screening, the incidence of cervical cancer has declined significantly in developed Western countries, while the incidence in my country has shown an upward trend. According to the latest cervical cancer incidence reports, the global number of new cases is approximately 600,000 per year, and the number of deaths is approximately 340,000 per year. China has nearly 110,000 new cases and approximately 59,000 deaths annually, accounting for about one-fifth of the global cervical cancer incidence rate. Cervical cancer remains a serious threat to women's health. While strengthening cervical cancer prevention, treatment still faces significant challenges. Currently, surgery, radiotherapy, and chemotherapy are the main treatments for cervical cancer, but their efficacy is not ideal for most patients with advanced cervical cancer. The prognosis for advanced recurrent cervical cancer is poor, and effective treatment methods are still lacking. Therefore, further research into the pathogenesis of cervical cancer and the exploration of new treatment methods are urgently needed.

[0003] Circular RNAs (circRNAs) are a class of single-stranded, closed circular RNA molecules formed by backsplicing of precursor mRNA (pre-mRNA). Current research has confirmed the differential expression of various circRNAs in cervical cancer cells. They participate extensively in tumor cell growth, invasion, migration, and metastasis through competitive binding to microRNAs (miRNAs) to act as sponges, interacting with RNA-binding proteins, and even translating functional peptides. However, overall, research on circRNAs in cervical cancer is still in its early stages. Their detailed molecular mechanisms of action have not yet been fully elucidated, and there is significant room for further research into whether circRNAs can serve as therapeutic targets for cervical cancer.

[0004] The circular RNA hsa_circ_0005571, located on human chromosome 19 (18285849-18286507), originates from exons 1-3 of its linear parent gene IFI30. Current reports on hsa_circ_0005571 are limited, with only one study suggesting its potential involvement in regulating malignant biological processes such as proliferation, invasion, migration, and apoptosis in triple-negative breast cancer cells (PMID: 35378000). However, there are no reports on the function of hsa_circ_0005571 in cervical cancer, and its correlation with the development and progression of cervical cancer remains unknown. Summary of the Invention

[0005] To address the aforementioned problems, the present invention aims to provide a shRNA targeting the circular RNA hsa_circ_0005571 and its application. This circular RNA is related to the proliferation ability of cervical cancer cells, and the shRNA designed targeting it can be used in the preparation of anti-cervical cancer drugs.

[0006] The objective of this invention and the technical problem it solves are achieved by the following technical solutions.

[0007] One aspect of the present invention provides a shRNA targeting a circular RNA, wherein the circular RNA is a circular RNA hsa_circ_0005571, and the shRNA comprises a sense strand, an antisense strand, a stem-loop structure, and a termination signal;

[0008] The sense strand has the base sequence shown in SEQ ID No. 2, and the antisense strand has the base sequence shown in SEQ ID No. 3.

[0009] The base sequence of the stem-loop structure is CTCGAG;

[0010] The base sequence of the termination signal is TTTTT or TTTTTT.

[0011] Another aspect of the present invention provides a lentiviral expression vector for shRNA targeting circular RNA, characterized in that the vector is: pLKO.1-puro-hsa_circ_0005571-shRNA lentiviral vector.

[0012] Another aspect of the present invention provides a method for constructing a lentiviral expression vector of shRNA targeting circular RNA, wherein the lentiviral expression vector is obtained by cloning the synthesized shRNA into the lentiviral expression vector pLKO.1-puro, and the construction method includes the following steps:

[0013] (1) Design shRNA target sites: which have the base sequence shown in SEQ ID No. 1 of the sequence listing;

[0014] (2) DNA oligo sequence synthesis: shRNA interference sequences are designed according to the shRNA target, with the sense strand having the base sequence shown in SEQ ID No. 2 of the sequence listing and the antisense strand having the base sequence shown in SEQ ID No. 3 of the sequence listing;

[0015] (3) DNA oligo sequence annealing: Mix the sense and antisense strands and then add annealing buffer to anneal to form shRNA template, and then dilute for later use;

[0016] (4) Vector linearization: The lentiviral expression vector pLKO.1-puro was subjected to double enzyme digestion at 37℃ for 3 h, the product was subjected to electrophoresis, the linearized pLKO.1-puro was recovered and diluted for later use;

[0017] (5) Ligation of the target fragment with the vector: The linearized pLKO.1-puro obtained was ligated with the obtained shRNA template at 16℃ overnight to obtain the ligation product;

[0018] (6) Transformation and PCR identification and sequencing of positive clones: The ligation product was added to competent E. coli cells, incubated on ice for 30 min, heat-shocked at 42℃ for 90 s, and incubated on ice for 2 min; LB liquid medium without antibiotics was added for culture; the bacterial culture was evenly spread on LB solid medium containing Amp and cultured overnight in an incubator at 37℃. The next day, single colonies were picked for bacterial PCR identification, and positive clones were selected for sequencing. The positive clones identified were the successfully constructed pLKO.1-puro-hsa_circ_0005571-shRNA lentiviral vector.

[0019] Furthermore, the shRNA interference sequence in step (2) also includes a stem-loop structure with the base sequence CTCGAG and a termination signal with the base sequence TTTTT or TTTTTT.

[0020] Furthermore, the concentration ratio of the sense chain and the antisense chain in step (3) is 1:1.

[0021] Further, the annealing procedure in step (3) is as follows: 95℃, 30s; 72℃, 2min; 37℃, 2min; 25℃, 2min.

[0022] Furthermore, the enzyme used in the double enzyme digestion reaction in step (4) is AgeI / EcoRI, and the enzyme digestion system is as follows:

[0023]

[0024] Furthermore, the connection system described in step (5) is as follows:

[0025]

[0026] Another aspect of the present invention provides the use of shRNA targeting circular RNA in the preparation of anti-cervical cancer drugs.

[0027] Another aspect of the present invention provides the application of a lentiviral expression vector for shRNA targeting circular RNA in the preparation of an anti-cervical cancer drug.

[0028] Compared with the prior art, the present invention has significant advantages and beneficial effects: the shRNA that targets the circular RNA hsa_circ_0005571 disclosed in the present invention can downregulate the expression of hsa_circ_0005571 by transfecting the shRNA, significantly inhibiting the activity of cancer cells, and providing a basis for the clinical treatment and scientific research of cervical cancer-related circRNAs.

[0029] The above description is merely an overview of the technical solution of the present invention. In order to better understand the technical means of the present invention and to implement it in accordance with the contents of the specification, the preferred embodiments of the present invention are described in detail below with reference to the accompanying drawings. Attached Figure Description

[0030] Figure 1 The inhibitory effect of lentivirus-mediated shRNA on the hsa_circ_0005571 gene in cervical cancer cells;

[0031] Figure 2 To investigate the effect of CCK8 on the proliferation of cervical cancer cells by interfering with hsa_circ_0005571;

[0032] Figure 3 To investigate the effect of interfering with hsa_circ_0005571 on the stemness of cervical cancer cells. Detailed Implementation

[0033] To make the technical problems to be solved, the technical solutions, and the beneficial effects of the present invention clearer, the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the present invention and do not limit the present invention.

[0034] Example 1: Construction of the shRNA lentiviral expression vector of hsa_circ_0005571

[0035] 1. shRNA target design

[0036] hsa_circ_0005571 is an exon-circular circRNA. Interference target sequences were designed targeting the sequences before and after its backsplice junction. After evaluation and testing on the online design website: https: / / circinteractome.nia.nih.gov / index.html, the following sequence was selected as the interference target: GCCACTAACAGGCAATCTATA (SEQ ID NO:1).

[0037] 2. DNA oligo sequence synthesis

[0038] The synthesized DNA oligo contains an shRNA interference sequence, a stem-loop structure, and a termination signal. The shRNA interference sequence contains both sense and antisense strands.

[0039] The shRNA interference sequence was designed based on the selected target sequence, and appropriate restriction endonuclease sites were added to both ends to complete the vector construction. In addition, a TTTTT or TTTTTT transcription termination signal was added to the 3' end of the positive strand, and a termination signal complementary sequence was added to the 5' end of the positive strand; the stem-loop sequence (CTCGAG) was located in the center of the oligonucleotide linking the two oligonucleotides.

[0040] Meanwhile, a missense sequence was designed as a control group, and a single-stranded DNA oligo was synthesized by Suzhou Genewiz Biotechnology Co., Ltd.

[0041] The shRNA interference sequence is shown below:

[0042] hsa_circ_0005571-shRNA positive chain:

[0043] CCGGGCCACTAACAGGCAATCTATACTCGAGTATAGATTGCCTGTTAGTGGCTTTTTG (SEQ ID NO: 2);

[0044] hsa_circ_0005571-shRNA antisense strand:

[0045] AATTCAAAAAGCCACTAACAGGCAATCTATACTCGAGTATAGATTGCCTGTTAGTGGC (SEQ ID NO: 3);

[0046] The missense sequences of the control group are shown below:

[0047] NC-shRNA positive strand (SEQ ID NO:4):

[0048] CCGGGATGCTAGCTGCAACTGTCTACTCGAGTAGACAGTTGCAGCTAGCATCTTTTTG

[0049] NC-shRNA antisense strand (SEQ ID NO:5):

[0050] AATTCAAAAAGATGCTAGCTGCAACTGTCTACTCGAGTAGACAGTTGCAGCTAGCATC

[0051] 3. Construction of the shRNA lentiviral expression vector of hsa_circ_0005571

[0052] (1) DNA oligo sequence annealing

[0053] The sense and antisense strands (100 μM) DNA oligos were mixed 1:1 to a final concentration of 50 μM. Annealing buffer (10 mM Tris, pH 7.5-8.0, 50 mM NaCl, 1 mM EDTA) was added, and the mixture was annealed on a PCR instrument (annealing program: 95℃, 30 s; 72℃, 2 min; 37℃, 2 min; 25℃, 2 min) to form double-stranded DNA, which became the shRNA template. The annealed shRNA template was diluted with RNase-free water to a final concentration of 200 nM for the next ligation reaction.

[0054] (2) Carrier linearization

[0055] The lentiviral expression vector pLKO.1-puro was subjected to double digestion with AgeI / EcoRI at 37℃ for 3 h to linearize the vector. The digestion products were subjected to 1% agarose gel electrophoresis to recover the target fragment, which was then diluted to 50 ng / μL with RNase-free water. The digestion system is shown in Table 1 below:

[0056] Table 1 Enzyme digestion system

[0057] Vector 4μg AgeI 1μL EcoRI 1μL Buffer (10×) 5μL <![CDATA[ddH2O]]> Make up to 50 μL

[0058] (3) Target fragment and vector connection

[0059] The linearized pLKO.1-puro obtained in the above steps was ligated to the obtained shRNA template using T4 ligase at 16°C overnight, followed by transformation experiments. The ligation system is shown in Table 2 below:

[0060] Table 2 Connection System

[0061]

[0062]

[0063] (4) Transformation and PCR identification and sequencing of positive clones

[0064] 5 μL of the ligation product was added to 50 μL of competent E. coli cells, incubated on ice for 30 min, heat-shocked at 42℃ for 90 s, and then incubated on ice for 2 min. 500 μL of antibiotic-free LB liquid medium was added, and the mixture was incubated at 37℃ with shaking at 200 rpm for 1 h. The bacterial culture was then evenly spread onto LB solid medium containing Amp and incubated overnight at 37℃. The next day, single colonies were picked and subjected to PCR identification. Positive clones were sequenced (Suzhou Genewiz Biotechnology Co., Ltd.). After sequencing alignment, the positive clones were identified as the successfully constructed pLKO.1-puro-hsa_circ_0005571-shRNA lentiviral vector.

[0065] (5) Lentiviral packaging and titer determination

[0066] The extracted recombinant plasmid pLKO.1-puro-hsa_circ_0005571-shRNA, helper plasmid psPAX2, and PMD2.G (BioVector plasmid vector bacterial strain cell gene preservation center) were co-transfected into HEK-293T cells (Wuhan Pronosei Biotechnology Co., Ltd.). Viral supernatant was collected at 48h and 72h, respectively, and cell morphology and green fluorescent protein (GFP) expression were observed. The extracted virus was purified and concentrated, and the virus titer was determined by serial dilution. The prepared virus concentrate was aliquoted and stored at -80℃.

[0067] Obtaining Scramble virus: HEK-293T cells were co-transfected with pLKO.1-puro plasmid containing the missense sequence mentioned above, helper plasmids psPAX2 and PMD2.G. Viral supernatant was collected at 48h and 72h, respectively. Cell morphology and green fluorescent protein (GFP) expression were observed. The extracted virus was purified and concentrated, and the viral titer was determined by serial dilution. The prepared viral concentrate was aliquoted and stored at -80℃.

[0068] Example 2: hsa_circ_0005571-shRNA lentivirus infection of human cervical cancer cells and establishment of stable transgenic strains

[0069] 1. Take Siha and HeLa cells in the logarithmic growth phase and adjust the cell concentration to 2 × 10⁻⁶. 5 / Hole seeding on a 6-hole plate;

[0070] 2. The following day, add NC-shRNA and hsa_circ_0005571-shRNA virus lysate to DEME high glucose medium (components and concentrations: L-glutamic acid 4mM, NaHCO3 3700mg / L, D-glucose 4500mg / L, sodium pyruvate 1mM, phenol red indicator 15mg / L, pH 7.2-7.4), add 8μg of polybrene transfection enhancement reagent to each well, and shake to mix.

[0071] 3. After culturing for 12 hours, replace the medium with DEME high-glucose medium containing virus dilution (components and concentrations: L-glutamate 4mM, NaHCO3 3700mg / L, D-glucose 4500mg / L, sodium pyruvate 1mM, phenol red indicator 15mg / L, pH 7.2–7.4). Repeat the infection twice using the same method. Observe the fluorescence and infection efficiency under a microscope. If the fluorescence efficiency is >80%, and the cell condition is good with a cell confluence >80%, the infection is successful.

[0072] 4. Subsequently, the cells were screened and cultured in DEME high-glucose medium containing puromycin (concentration 1 μg / mL) (components and concentrations: L-glutamic acid 4 mM, NaHCO3 3700 mg / L, D-glucose 4500 mg / L, sodium pyruvate 1 mM, phenol red indicator 15 mg / L, pH 7.2–7.4). The culture medium was changed every 72 hours, and stable cell lines were obtained after three consecutive changes.

[0073] Example 3: Verification of the interference efficiency of hsa_circ_0005571-shRNA lentivirus

[0074] 1. Experimental groups: NC-shRNA infected group and hsa_circ_0005571-shRNA infected group;

[0075] 2. Collect cells from each group and extract total RNA from the cells according to the instructions of the total RNA extraction kit (purchased from Shanghai Feijie Biotechnology Co., Ltd.);

[0076] 3. Reverse transcription of cDNA was performed using the HiFiScript cDNA First-Strand Synthesis Kit (purchased from Jiangsu Kangwei Century Biotechnology Co., Ltd.). The experimental procedures were performed according to the product instructions. The obtained cDNA was stored at -20℃ for later use.

[0077] 4. Real-Time PCR amplification and detection: The program was as follows: 95℃ pre-denaturation for 10 min, followed by 38 cycles of denaturation at 95℃ for 15 s, annealing at 60℃ for 30 s, and extension at 72℃ for 30 s. The ABI 7500 quantitative PCR instrument was programmed with a selected melting curve. Fluorescence signals were continuously collected during the melting curve process to obtain the melting curve. Real-Time PCR was performed using 2... -△△Ct Relative quantitative analysis was performed using this method. Primer sequences are shown in Table 3:

[0078] Table 3. Specific amplification primer sequences and related information

[0079]

[0080] Figure 1This study investigates the inhibitory effect of lentivirus-mediated shRNA on the hsa_circ_0005571 gene in cervical cancer cells. For example... Figure 1 As shown, compared with the NC-shRNA group, the experimental group hsa_circ_0005571-shRNA significantly reduced the expression level of hsa_circ_0005571.

[0081] Example 4: hsa_circ_0005571-shRNA inhibits the proliferation of cervical cancer cells.

[0082] 1. Experimental groups: NC-shRNA infected group and hsa_circ_0005571-shRNA infected group;

[0083] 2. Take cells from each of the above groups in the logarithmic growth phase and adjust the cell concentration to 3 × 10⁻⁶. 3 / wells were inoculated in 96-well plates, with 3 replicates per group;

[0084] 3. Continue culturing for 1-4 days, and use the CCK-8 assay to detect the effect of inhibiting hsa_circ_0005571 expression on cell proliferation.

[0085] Figure 2 To investigate the effect of CCK8 assay on the proliferation of cervical cancer cells, such as... Figure 2 The expression of hsa_circ_0005571 was shown to inhibit the proliferation of cervical cancer cell lines.

[0086] Example 5: hsa_circ_0005571-shRNA inhibits tumor stemness in cervical cancer cells.

[0087] 1. Experimental groups: NC-shRNA infected group and hsa_circ_0005571-shRNA infected group;

[0088] 2. Take cells from each of the above groups in the logarithmic growth phase and adjust the cell concentration to 5 × 10⁻⁶. 2 / wells are inoculated in a 6-well plate, with 3 replicates per group;

[0089] 3. Continue culturing for 10-14 days, and use a plate clone assay to detect the effect of hsa_circ_0005571 on tumor stemness.

[0090] Figure 3 To investigate the effect of interfering with hsa_circ_0005571 on the stemness of cervical cancer cells. Figure 3 The expression of hsa_circ_0005571 was shown to inhibit the clonogenic ability of cervical cancer cell lines, i.e., to suppress tumor stemness.

[0091] In summary, the shRNA targeting the circular RNA hsa_circ_0005571 of this invention can downregulate the expression of hsa_circ_0005571 by transfecting the shRNA, significantly inhibiting cancer cell activity and providing a foundation for the clinical treatment and scientific research of cervical cancer-related circRNAs. Therefore, this invention provides the application of a shRNA targeting circular RNA in the preparation of anti-cervical cancer drugs, and the application of a lentiviral expression vector for a shRNA targeting circular RNA in the preparation of anti-cervical cancer drugs.

[0092] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some modifications or alterations to the methods and techniques disclosed above without departing from the scope of the present invention to create equivalent embodiments. Any simple modifications, equivalent changes and alterations made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the scope of the present invention.

Claims

1. The application of a shRNA targeting circular RNA in the preparation of an anti-cervical cancer drug, characterized in that, The circular RNA is circular RNA hsa_circ_0005571, and the shRNA contains a sense strand, an antisense strand, a stem-loop structure, and a termination signal; The sense strand has the base sequence shown in SEQ ID No. 2, and the antisense strand has the base sequence shown in SEQ ID No.

3. The base sequence of the stem-loop structure is CTCGAG; The base sequence of the termination signal is TTTTT or TTTTTT.

2. The application of the lentiviral expression vector for shRNA targeting circular RNA according to claim 1 in the preparation of anti-cervical cancer drugs, characterized in that, The vector is: pLKO.1-puro-hsa_circ_0005571-shRNA lentiviral vector.

3. The application of the lentiviral expression vector for shRNA targeting circular RNA according to claim 2 in the preparation of anti-cervical cancer drugs, characterized in that, The lentiviral expression vector is obtained by cloning the synthesized shRNA into the lentiviral expression vector pLKO.1-puro, and the construction method includes the following steps: (1) Design shRNA target sites: which have the base sequence shown in SEQ ID No. 1 of the sequence listing; (2) DNA oligo sequence synthesis: shRNA interference sequence is designed according to the shRNA target, the sense strand of which has the base sequence shown in SEQ ID No. 2 of the sequence listing, and the antisense strand has the base sequence shown in SEQ ID No. 3 of the sequence listing; (3) DNA oligo sequence annealing: Mix the sense and antisense strands and then add annealing buffer to anneal to form shRNA template, and then dilute for later use; (4) Vector linearization: The lentiviral expression vector pLKO.1-puro was subjected to double enzyme digestion at 37℃ for 3 h. The product was subjected to electrophoresis, and the linearized pLKO.1-puro was recovered and diluted for later use. (5) Ligation of the target fragment with the vector: The linearized pLKO.1-puro obtained was ligated with the obtained shRNA template at 16℃ overnight to obtain the ligation product; (6) Transformation and PCR identification and sequencing of positive clones: The ligation product was added to competent E. coli cells, incubated on ice for 30 min, heat-shocked at 42℃ for 90 s, and incubated on ice for 2 min; LB liquid medium without antibiotics was added for culture; the bacterial culture was evenly spread on LB solid medium containing Amp and cultured overnight in an incubator at 37℃. The next day, single colonies were picked for bacterial PCR identification, and positive clones were selected for sequencing. The positive clones identified were the successfully constructed pLKO.1-puro-hsa_circ_0005571-shRNA lentiviral vector.

4. The application of the lentiviral expression vector for shRNA targeting circular RNA according to claim 3 in the preparation of anti-cervical cancer drugs, characterized in that, The shRNA interference sequence described in step (2) also includes a stem-loop structure with the base sequence CTCGAG and a termination signal with the base sequence TTTTT or TTTTTT.

5. The application of the lentiviral expression vector for shRNA targeting circular RNA according to claim 3 in the preparation of anti-cervical cancer drugs, characterized in that, The concentration ratio of the sense chain and the antisense chain in step (3) is 1:

1.

6. The application of the lentiviral expression vector for shRNA targeting circular RNA according to claim 3 in the preparation of anti-cervical cancer drugs, characterized in that, The annealing procedure in step (3) is as follows: 95℃, 30s; 72℃, 2min; 37℃, 2min; 25℃, 2min.

7. The application of the lentiviral expression vector for shRNA targeting circular RNA according to claim 3 in the preparation of anti-cervical cancer drugs, characterized in that, The enzyme used in the double digestion reaction in step (4) is AgeI / EcoRI, and the digestion system is as follows: Component dosage Vector 4 μg AgeI 1 μL EcoRI 1 μL Buffer (10×) 5 μL Add ddH2O to a final volume of 50 μL.

8. The application of the lentiviral expression vector for shRNA targeting circular RNA according to claim 3 in the preparation of anti-cervical cancer drugs, characterized in that, The connection system described in step (5) is as follows: Component dosage Linearized Vector 1 μL 1 μL of oligonucleotide fragment T4 DNA ligase 1 μL T4 Buffer (10×) 2 μL Add ddH2O to a final volume of 15 μL.

Images