Lettuce yield regulation gene loc111907799, its coding protein, expression vector and application thereof

Abstract

The application discloses a lettuce yield regulation gene LOC111907799 , an encoded protein thereof, an expression vector thereof and application thereof; CRISPR / Cas9 knockout is performed on a lettuce gene LOC111907799 , and the influence of the gene on the performance of traits such as leaf number, leaf size and plant height of the lettuce is determined; the improvement effect of the gene on the yield of the lettuce is verified; and thus solid technical support is provided for improving the yield of the lettuce by using the gene LOC111907799 LOC111907799 LOC111907799 LOC111907799 LOC111 .

Description

Technical Field

[0001] This invention application relates to the field of bioengineering technology, specifically to a lettuce yield regulating gene. LOC111907799 Its encoded proteins, expression vectors, and applications. Background Technology

[0002] lettuce( Lactuca sativa L. var. ramosa Hort Lettuce (Lactuca sativa) is an annual or biennial herbaceous plant belonging to the genus Lettuce in the family Asteraceae. It is a popular and common vegetable with a huge demand and broad market prospects.

[0003] The main biomass components of lettuce include plant height, leaf area, number of leaves, leaf size, and plant diameter. In recent years, with the continuous development of genomics and molecular biology techniques, some studies have identified genes related to lettuce yield, such as... LsAP2 , LsMYB , LsNAC , LsWRKY These genes may be involved in the regulation of lettuce yield, providing new genetic resources for the genetic improvement of lettuce yield. However, lettuce yield is a complex trait controlled by multiple genes, and current research on lettuce yield genes is relatively limited. The functional genes obtained so far are still very limited in their ability to fully elucidate the molecular mechanisms of yield formation. Therefore, it is necessary to further explore more genes related to lettuce biological yield and analyze their utilization pathways, thereby enriching the genetic basis of yield formation and providing excellent genetic resources for the breeding of new lettuce varieties.

[0004] The information disclosed in this background section is intended only to enhance the understanding of the overall background of the present invention and should not be construed as an admission or in any way implying that the information constitutes prior art known to those skilled in the art. Summary of the Invention

[0005] The inventors identified a gene in lettuce that is related to corn. KWE2 Homologous genes LOC111907799 Furthermore, by creating corresponding knockout mutations, their effects on lettuce leaf number and size traits, as well as their regulatory role on lettuce yield, were clarified, thus providing a basis for utilizing... LOC111907799 Genetics has laid a solid technological foundation for increasing lettuce yield.

[0006] One of the purposes of this application is to provide a gene for regulating lettuce yield. LOC111907799 Its nucleotide sequence is at least one of the following: (1) As shown in SEQ ID NO.1; (2) A DNA molecule that can affect yield-related phenotypes by means of one or more base substitutions and / or one or more base insertions and / or deletions, as well as large nucleotide sequence insertions / deletions / shifts / inversions, based on SEQ ID NO.1.

[0007] Another aspect disclosed in this application is a gene for regulating lettuce yield. LOC111907799 The encoded protein has an amino acid sequence of at least one of the following: (1) A protein consisting of the amino acid sequence encoded by SEQ ID NO.1; (2) As shown in SEQ ID NO.2; (3) Proteins derived from SEQ ID NO.2 by substitution, deletion and / or addition of one or more amino acid residues and having yield-related traits.

[0008] The third aspect disclosed in this application is to provide a lettuce yield-regulating gene. LOC111907799 Recombinant expression vectors, expression cassettes, transgenic cell lines, or recombinant bacteria.

[0009] The fourth aspect disclosed in this application provides a method for identifying lettuce regulatory genes. LOC111907799 The mutated primer pair has the following sequence: JLS4080-A1-F1 5'-TCCAGCTTACTTTTTATTTGAGCAC- 3', JLS4080-A1-R1 5'-GGTTGCAAACGACAAGCGAT-3'.

[0010] The fifth aspect disclosed in this application is the lettuce yield-regulating gene. LOC111907799 The primers mentioned above are used in the improvement of yield traits and the selection of superior varieties / lines in lettuce.

[0011] For example, silencing / downregulating the expression of the lettuce yield-regulating genes. LOC111907799 To increase leaf area, number of leaves, plant height and / or plant diameter in lettuce. To construct lettuce yield-regulating genes. LOC111907799 The knockout or silence vector is transformed into a plant, and the corresponding homozygous mutant is cultured and screened out for hybridization breeding.

[0012] The plants that can be converted in this application can be monocotyledonous and dicotyledonous plants, including but not limited to lettuce, rapeseed, sunflower, sorghum, corn, wheat, barley, rye, cotton, sweet potato, potato, soybean, pea, alfalfa, switchgrass, Arabidopsis, etc.

[0013] One or more technical solutions provided in the embodiments of this application have at least one of the following technical effects or advantages: 1. Genes regulating lettuce yield LOC111907799 CRISPR / Cas9 knockout was performed to obtain homozygous CRISPR-Cas9 mutants, clarifying... LOC111907799 The effects of genes on traits such as leaf area, leaf number, plant height and / or plant diameter in lettuce were investigated; their regulatory role in lettuce biomass was confirmed; thus providing a basis for the utilization of... LOC111907799 Genetics provides the technological support for increasing lettuce yield.

[0014] 2. The genes and methods disclosed in this application can be used to facilitate the creation of high-yield breeding materials for crops such as lettuce, corn, and wheat, shorten the breeding cycle of new crop varieties, reduce breeding costs, and improve breeding efficiency. Attached Figure Description

[0015] Figure 1 Lettuce in the implementation example of this application LOC111907799 Evolutionary tree of genes; phylogenetic tree constructed using the neighbor-joining method, where the value on each branch represents the support in 1000 simulations, and the scale bar represents the average number of amino acid substitutions at each site.

[0016] Figure 2 Lettuce in the implementation example of this application LOC111907799 Schematic diagram of gene editing backbone vector.

[0017] Figure 3 Lettuce in an embodiment of the present invention LOC111907799 A schematic diagram of the intermediate template carrier for editing.

[0018] Figure 4 Lettuce in the implementation example of this application LOC111907799 A schematic diagram of PCR electrophoresis of the dual-target construct fragment.

[0019] Figure 5 Lettuce in the implementation example of this application LOC111907799 A schematic diagram of the final vector for gene editing.

[0020] Figure 6 Lettuce in the implementation example of this application LOC111907799 A schematic diagram illustrating the detection of the final gene-editing vector.

[0021] Figure 7 Lettuce in the implementation example of this application LOC111907799 A schematic diagram of the positive screening process for gene-edited seedlings.

[0022] Figure 8 This is a comparison of the phenotypic traits of lettuce in the embodiments of this application, wherein the left figure is... LOC111907799 The gene knockout line, with the transgenic control line shown on the right. Detailed Implementation

[0023] Definitions and explanations of relevant terms: The term "lettuce biomass regulatory gene" refers to a nucleotide sequence that encodes a protein, specifically encoding an active polypeptide that regulates biomass production.

[0024] The "lettuce yield regulating gene" also includes genes that encode natural regulatory genes for biological yield. KWE2 Variations of the open reading frame sequence of the same functional protein; these variations include, but are not limited to, deletions, insertions and / or substitutions of one or more nucleotides, and the addition of several (usually up to 60, preferably up to 30, more preferably up to 10, and best up to 5) nucleotides to the 5' or 3' end.

[0025] The "lettuce yield regulating gene" also includes an amino acid sequence capable of translating a class of amino acid sequences that regulate lettuce plant height, leaf area, leaf number, leaf size, plant diameter, and biomass yield, such as the amino acid sequence of SEQ ID NO. 2. This class of amino acid sequences also includes variants that have the same function as naturally occurring lettuce biomass yield regulating proteins. These variants include, but are not limited to: deletions, insertions, and / or substitutions of one or more amino acids, and the addition of one or more amino acids (usually no more than 20, preferably no more than 10, and even more preferably no more than 5) to the C-terminus and / or N-terminus. In the art, substitution with amino acids of similar or comparable properties generally does not alter the protein's function; similarly, the addition of one or more amino acids to the C-terminus and / or N-terminus generally does not alter the protein's function.

[0026] Furthermore, the full-length nucleotide sequence or fragments of the "lettuce yield regulating gene" can typically be obtained using PCR amplification, recombinant methods, or artificial synthesis. For PCR amplification, primers can be designed based on the relevant nucleotide sequences disclosed in this embodiment, especially the open reading frame sequences, and commercially available cDNA libraries or cDNA libraries prepared using conventional methods known to those skilled in the art can be used as templates to amplify the relevant sequences. When the sequence is long, nested PCR amplification is usually required two or more times, and then the products from each PCR amplification are spliced ​​together in the correct order.

[0027] At least one of the lettuce yield-regulating genes disclosed in this application, particularly those expressed in higher plants, is preferred. LOC111907799 The proteins, once the desired nucleotide sequence is transformed into a specific plant species, can be propagated within that species or transferred into other varieties of the same species (especially commercial varieties) using conventional breeding techniques. The lettuce yield-regulating genes disclosed in this application can be used... LOC111907799The nucleotide sequence is inserted into an expression cassette or contained in a non-pathogenic, self-replicating virus, and then preferably, the expression cassette is stably integrated into the plant genome. The recipients transformed in this application can be monocotyledonous and dicotyledonous plants, including but not limited to maize, wheat, barley, rye, rice, rapeseed, cotton, sunflower, potato, bean, pea, switchgrass, Arabidopsis, etc. By expressing the nucleotide sequences disclosed in this invention in transgenic plants, the biosynthesis of functional proteins capable of enhancing the corresponding heterosis expression is promoted in the transgenic plants. In this way, transgenic plants with enhanced heterosis expression can be produced. To express the nucleotide sequences of this invention in transgenic plants, the nucleotide sequences disclosed in this invention may need to be modified and optimized, and their codons may be changed to conform to plant preferences while maintaining the amino acids encoded by the nucleotide sequences of this invention. Moreover, high levels of expression in plants are best achieved from coding sequences with a GC content of at least about 35%, preferably more than about 45%, more preferably more than 50%, and most preferably more than about 60%.

[0028] The following detailed description of some specific embodiments of the present invention is provided to facilitate a better understanding of the invention. However, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0029] Unless otherwise specified, the experimental methods described in the embodiments of this application are conventional methods. Those skilled in the art should understand that, unless otherwise specified, the reagents, enzymes, etc., used in the following embodiments are all analytical grade reagents or enzymes commercially available from reagent companies. The materials, methods, and embodiments are for illustrative purposes only and are not intended to limit the scope of the application.

[0030] Example 1: Lettuce LOC111907799 Functional verification of genes Research has found that lettuce LOC111907799 Genes and Corn KWE2 The closest genetic relationship ( Figure 1 The two are homologous genes; further research confirms that lettuce LOC111907799 Genes and Corn KWE2 The genes have similar functions that negatively regulate yield and heterosis.

[0031] To further verify lettuce LOC111907799 The gene's regulatory role in lettuce biomass yield was investigated by knocking it out using CRISPR-Cas9.

[0032] The specific steps are as follows: 1. Vector construction: The vector was constructed using T4 ligase digestion. Figure 2 ) Based on the gene sequence, the following targets were designed and knockout vectors were constructed. After the vectors were constructed, they were transformed.

[0033] Table 1 Target Design .

[0034] 2. Carrier processing use Bsa Digest 1µg of the vector with enzyme I and incubate at 37°C for approximately 1 hour.

[0035] 50µL system: WMC028 vector 1µg (10µL) Bsa I enzyme 1µL Bsa 5µL of enzyme I buffer ddH2O 34µL.

[0036] Once the time is up, the original solution will be recycled directly.

[0037] Using the DC301 kit (PCR gel recovery kit): ① Add 50µL of the enzyme digestion vector to the recovery column, along with 300µL of GDP, and centrifuge at 12000g for 1 min; ② Add the waste liquid back to the recovery column, pass it through the column again, and centrifuge at 12000g for 1 min; ③ Discard the waste liquid, add 600µL of GW to the recovery column, and centrifuge at 12000g for 1 min; ④ Repeat step ③; ⑤ Discard the waste liquid, centrifuge empty at 12000g for 2 min; ⑥ Place the recovery column into a 1.5mL ep sterile centrifuge tube, wait for the alcohol to evaporate for a few minutes, then add 30µL of elution buffer (ddH2O, or EB elution buffer), let stand for 2 min, centrifuge at 12000g for 2 min, then discard the recovery column to obtain the enzyme digestion vector product.

[0038] 2. Primer design and PCR amplification ( Figure 3 ) PCR amplification was performed using the above vectors as templates: Upstream primer F: Protected base + Bsa I+Target 1+Template approximately 16bp; Upstream primer R: Protected base + Bsa I+ target 2+ template approximately 16bp.

[0039] Dissolve primers: 12000 rpm for 5 min. Add 10 times the amount of water indicated on the primer tube wall to the EP tube (400-500) to prepare a 10 µM primer concentration. After adding water, tighten the tube cap, shake for 1 min, and store in a 4℃ refrigerator for later use.

[0040] PCR amplification: 50µL system 1 µL each of F / R primers Template 1µL Pfu enzyme (high-fidelity enzyme) 20µL ddH2O 27µL.

[0041] The PCR instrument runs the following series of reactions: 95℃, 3 min; (95℃, 30 s; 58℃, 30 s) * 30 cycles; 72℃, 1 min; 72℃, 5 min; storage temperature at 4℃.

[0042] After the reaction, take 3 µL of the PCR product and spot it onto a gel to check if the bands are correct. Figure 4 The correct size is around 600bp, which means the original solution is recovered.

[0043] Using the DC301 kit (PCR gel recovery kit): ① Add 50µL of PCR product to the recovery column, along with 300µL of GDP, and centrifuge at 12000g for 1 min; ② Add the waste liquid back to the recovery column, pass it through the column again, and centrifuge at 12000g for 1 min; ③ Discard the waste liquid, add 600µL of GW to the recovery column, and centrifuge at 12000g for 1 min; ④ Repeat step ③; ⑤ Discard the waste liquid, centrifuge empty at 12000g for 2 min; ⑥ Place the recovery column into a 1.5mL ep sterile centrifuge tube, wait for the alcohol to evaporate for a few minutes, then add 30µL of elution buffer (ddH2O, or EB elution buffer), let stand for 2 minutes, centrifuge at 12000g for 2 min, then discard the recovery column to obtain the corresponding PCR product.

[0044] 3. Enzyme digestion treatment of PCR products use Bsa I. Digest the PCR product with enzymes and incubate at 37°C for approximately 1 hour.

[0045] 50µL system 30µL of PCR product Bsa I enzyme 1µL Bsa 5µL of enzyme buffer (I) ddH2O 14µL.

[0046] Using the DC301 kit (PCR gel recovery kit): ① Add 50µL of PCR digestion product to the recovery column, along with 300µL of GDP, and centrifuge at 12000g for 1 min; ② Add the waste liquid back to the recovery column, pass it through the column again, and centrifuge at 12000g for 1 min; ③ Discard the waste liquid, add 600µL of GW to the recovery column, and centrifuge at 12000g for 1 min; ④ Repeat step ③; ⑤ Discard the waste liquid, centrifuge empty at 12000g for 2 min; ⑥ Place the recovery column into a 1.5mL ep sterile centrifuge tube, wait for the alcohol to evaporate for a few minutes, then add 30µL of elution buffer (H2O or EB elution buffer), let stand for 2 min, centrifuge at 12000g for 2 min, then discard the recovery column to obtain the corresponding PCR digestion product.

[0047] 4. Connecting system (mixing on ice) - obtaining the desired carrier ( Figure 5 ) PCR digestion product (shaded area in the image above) 6µL Enzyme digestion vector product (the rest of the image above) 1µL 1µL of T4 enzyme T4 enzyme buffer 1µL ddH2O 1µL Total 10µL.

[0048] After running the Ligase program on the PCR instrument for 24°C for 1 hour, place it in the refrigerator.

[0049] 5. Conversion of DH5α 10µL or more of the ligation product + 100µL of E. coli competent cells: After removing the competent DH5α cells from the refrigerator, quickly place them on ice. After 5 minutes, wait for the bacterial block to dissolve, add the ligation product, let stand on ice for 25 minutes, heat shock at 42°C for 45 seconds, place on ice for 2 minutes (do not shake), add 100µL of antibiotic-free LB, shake at 37°C and 200rpm for 1 hour, plate, incubate with LB+Kana at 37°C for one day.

[0050] 6. Carrier quality control Colony PCR: Randomly select 12 single colonies from the plate and place them into 2 mL sterile EP tubes (pre-added with 200 µL Kana+LB), label them 1, 2, 3, 4, 5, 6, 7~12, shake for 6 h, and then take 5 µL of bacterial culture from each sample for PCR.

[0051] PCR Mix 10µL Primers (QC1+QC10) 1 / 1µL 5µL of bacterial solution ddH2O 3µL Total 20µL.

[0052] The target fragment is approximately 1200 / 600 bp (QC1+QC10), and the PCR gel run shows double bands with the correct band size. Figure 6 Select the correct bacterial culture for sequencing, such as 1, 2, etc. Sequencing primer information is as follows: QC1: CTGGCGAAAGGGGGATGTGCTGCAA; QC10: GCCATTTGTCTGCAGAATTG.

[0053] 7. Plasmids with correct sequencing results were transformed into Agrobacterium: ① 20 µL Agrobacterium (EHA105-WM) + 1 µL plasmid, incubate on ice for 5 min, flash freeze in liquid nitrogen for 5 min, incubate in water at 37℃ for 5 min, and incubate on ice for 5 min. Add 100 µL antibiotic-free LB, shake at 28℃ and 200 rpm for 2 h, directly plate with YP+Kana+rif, and incubate at 28℃ for two days.

[0054] ② Pick a single clone and shake it: Two days later, pick a single clone and put it into a 5mL sterile EP tube. Add 2mLYP+Kana+rif in advance and shake it overnight.

[0055] ③ Preservation of glycerol bacteria: 400µL bacterial culture + 100µL 75% sterile glycerol, label properly, and store in a -70°C freezer. Extract plasmid from the remaining bacterial culture and transform it into E. coli (1µL plasmid + 20µL competent E. coli cells, incubate on ice for 30 min, heat shock at 42°C for 35 s, incubate on ice for 2 min, add 100µL antibiotic-free LB, shake at 37°C, 200 rpm for 1 h, plate, incubate with LB + Kana at 37°C for one day).

[0056] ④ Select a single clone, shake the culture in the morning, and send the bacterial culture directly for sequencing in the evening. Use sequencing primer QC1.

[0057] ⑤ Sequencing feedback was correct, verifying that Agrobacterium was functioning correctly, and the prepared Agrobacterium could then be used for subsequent transformation experiments. The vector was transferred into Agrobacterium EHA105 via electroporation, and identified by PCR. Cotyledons that had germinated for 5 days were used as material, placed in a culture dish containing 50 mL of Agrobacterium suspension, and approximately 300 explants were treated within 2 hours, incubated at room temperature for 30 minutes for infection. After infection, the Agrobacterium suspension was discarded, and the explants were placed in a co-culture medium and co-cultured at 23°C in the dark for 2 days. After co-culture, the explants were transferred to the appropriate resistance selection medium and cultured at 25°C under light for 4 weeks to induce resistant shoots. Then, they were transferred to the appropriate resistance elongation medium and cultured for 4–6 weeks at 25°C, 5000 lx under light until rooting occurred. Figure 7 ).

[0058] After transplanting into seedling trays, the aada+bar gene and target sites were detected in T0 plants. Primer information is as follows: AADA-F2 CAGGGTGAGGACCACATTCC; AADA-R2 TCCGACATCGATCTCCTGGT. Amplified size 435bp.

[0059] ⑥ Methods for identifying corresponding mutation sites (primers, amplification, electrophoresis, etc.) Primers: JLS4080-A1-F1 TCCAGCTTACTTTTTATTTGAGCAC; JLS4080-A1-R1GGTTGCAAACGACAAGCGAT. The amplification program is shown in Table 2. The amplified size was 486 bp.

[0060] Table 2 Amplification Procedure .

[0061] Example 2: Lettuce LOC111907799 Phenotype after gene knockout Lettuce LOC111907799 The knockout transgenic line and the control variety were planted under the same environmental conditions, and phenotypic surveys were conducted during their growth period. The results showed that ( Figure 8 ), LOC111907799 Compared to the wild-type control, the gene knockout lettuce lines showed significant increases in leaf number, leaf width (67.4% increase), and plant height (10.3% increase). This indicates that the corn... KWE2 Lettuce homologous gene LOC111907799 It has a conservative negative regulatory function on lettuce yield and plant height traits.

[0062] Although some preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments as well as all changes and modifications falling within the scope of the invention.

[0063] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this application and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. Silence or lowering of tone to express lettuce LOC111907799 The application of genes in creating high-yield vegetable breeding materials is characterized by, The lettuce LOC111907799 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. A method for increasing lettuce yield, characterized in that, This includes silencing or downregulating the expression of nucleotide sequences in lettuce, such as those shown in SEQ ID NO.

1. LOC111907799 Genetic steps to increase leaf area, number of leaves, leaf width and / or plant height in lettuce.

3. The method according to claim 2, characterized in that, Includes the following steps: Construct the lettuce LOC111907799 Gene knockout or silencing vectors were used to transform lettuce, and positive plants with corresponding gene silence or knockout were cultured, identified, and screened.

Images