Major gene loci associated with wheat grain protein content and applications

Abstract

The application discloses a major gene locus associated with wheat kernel protein content and application, and belongs to the technical field of wheat molecular breeding. The SNP marker Whaas63035 provided by the application is located on the 7AS chromosome of wheat, and a polymorphic site of A / G exists at the 36th base. When the genotype of the site is GG, the protein content in the wheat kernel is relatively high; and when the genotype of the site is AA, the protein content in the wheat kernel is relatively low. In the application, a mixed linear model is used to perform whole genome association analysis on the protein content in the wheat kernel under different environments, a major QTL and gene controlling the protein content in the wheat kernel are mined out, and corresponding molecular markers are developed, thereby providing important gene resources and technical foundations for cultivating new wheat varieties with high quality and improving the processing quality of wheat.

Description

Technical Field

[0001] This invention belongs to the field of wheat molecular breeding technology, specifically involving major gene loci associated with wheat grain protein content and their applications. Background Technology

[0002] Protein is one of the main components of mature wheat grains, accounting for approximately 8%-20% of the grain's dry weight. The quantity and quality of wheat protein determine the quantity and quality of gluten. Differences in protein content and ratio among different wheat varieties can result in diverse gluten quality characteristics. Protein content is an important indicator for classifying high-quality wheat and a major factor affecting wheat processing quality traits. Studies have found that wheat materials with high protein content are more suitable for making bread and other foods, while wheat materials with low protein content are more suitable for making cakes, cookies, etc. In the wheat breeding process, the number of seed generations is small but numerous. Using molecular markers to assist in the selection of wheat materials with suitable protein content and ratio is an effective means to improve the breeding process and efficiency.

[0003] Studies have shown that the protein content in wheat grains is controlled by multiple genes and is greatly influenced by the external environment. To date, the protein content loci in wheat grains that have been located are mainly distributed on chromosomes 6B, 6D, 7A, and 7B. Nelson et al. (2006) detected multiple QTL loci related to protein components, including those on chromosomes 6D and 7A. Charmet et al. (2005) located two QTL loci related to wheat grain protein components on chromosomes 7A and 7D. Fang et al. (2018) identified 22 QTLs controlling the protein component content of wheat flour using a RIL population, located on chromosomes 2A, 2D, 3B, 4A, 5A, 5B, 6B, 7A, 7B, and 7D. However, most of these QTLs were located using SSR markers in genetic populations based on biparental data, resulting in a narrow genetic background and the identified QTLs only functioning in a few populations. With the completion of genome sequencing of wheat and its closely related species, the use of high-throughput SNP chips and genome-wide association analysis to locate and mine genes for important wheat traits has become a research hotspot. Summary of the Invention

[0004] This invention improves the protein content of wheat grains through genetic modification based on genotype selection. It uses genome-wide association analysis to identify stable loci and genes closely linked to the protein content of wheat grains under different environments, and develops corresponding functional markers. This provides a theoretical basis for promoting the breeding of high- and low-protein wheat and improving the quality of flour-based foods.

[0005] This invention provides a genetic marker qGPC7A.1 for rapid and convenient detection of protein content in wheat grains, and an SNP marker Whaas63035 closely linked to protein content in wheat grains, providing a theoretical basis and new marker resources for the breeding of wheat varieties with high and low protein content. The technical solution adopted in this application is detailed below.

[0006] This invention provides an SNP marker closely linked to the protein content in wheat grains, the SNP marker being Whaas63035, and the nucleotide sequence of the SNP marker being shown in SEQ ID NO.1, with the 36th base from the 5' end being either A or G.

[0007] In one implementation, the SNP tag Whaas63035 is linked to QTL qGPC7A.1.

[0008] In one implementation, when the Whaas63035 genotype is GG, the wheat grain trait is characterized by high protein content; when the genotype is AA, the wheat grain trait is characterized by low protein content.

[0009] In one implementation, when the Whaas63035 genotype is GG, its nucleotide sequence is shown in SEQ IN NO:2.

[0010] In one implementation, when the Whaas63035 genotype is AA, its nucleotide sequence is shown in SEQ IN NO:3.

[0011] This invention provides the application of the above-mentioned SNP markers in assisted breeding.

[0012] In one embodiment, the application includes breeding or screening wheat plants, lines, strains, or varieties with relatively high protein content.

[0013] In one embodiment, the application includes breeding or screening wheat plants, lines, strains, or varieties with relatively low grain protein content.

[0014] This invention provides the application of the above-mentioned SNP markers in identifying or assisting in the identification of protein content in wheat grains.

[0015] In one embodiment, the application involves performing whole-genome sequencing on collected wheat grains and then using 660K chip technology to analyze the genotype of the SNP marker Whaas63035.

[0016] In one implementation, when the Whaas63035 genotype is GG, the wheat grain trait is characterized by high protein content; when the genotype is AA, the wheat grain trait is characterized by low protein content.

[0017] This invention provides the application of the above-mentioned SNP markers in comparing the protein content of wheat grains.

[0018] Beneficial effects:

[0019] This application utilizes the wheat 660K gene chip to identify the genotypes of wheat materials from related populations. Genome-wide association analysis (GWAS) was used to identify a QTL qGPC7A.1 associated with protein content in wheat grains, with its closely linked significant SNP marker being Whaas63035. According to the Chinese spring reference genome sequence information, this significant SNP marker is located at 45,821,002 nucleotides on chromosome 7AS. Its nucleotide sequence is shown in SEQ IN NO:1: TATATTGTTCGTTCGTCATAGAATTAATTAGTACC[A / G]CATCGCTCTTATACACGAAAATT GACCAATTTATA. A polymorphic site of A / G allele mutation exists at base position 36 of this sequence.

[0020] Genotypic data of wheat materials in associated populations were identified using the Whaas63035 polymorphism. Association analysis, combined with phenotypic data on grain protein content, revealed significant differences in wheat grain protein content among different alleles. When the Whaas63035 genotype was GG, the wheat grain protein content was higher; when the genotype was AA, the wheat grain protein content was lower. This suggests that genotype GG is a favorable allele for increasing wheat grain protein content.

[0021] In this application, a mixed linear model was used to conduct a genome-wide association analysis on the protein content in wheat grains of associated populations, and the major gene locus Whaas63035 controlling the protein content in wheat grains was identified, providing new marker resources and applications for further improving wheat processing quality and breeding high-quality wheat varieties. Attached Figure Description

[0022] Figure 1 The phenotypic data of protein content in related wheat populations grown under different environments are normally distributed. YY_18, YY_19, and YY_20 represent wheat grown in Yuanyang County, Henan Province (YY), Henan Modernization Research and Development Base in 2017-2018, 2018-2019, and 2019-2020, respectively. BLUE is the best linear unbiased estimate calculated under different environments.

[0023] Figure 2Manhattan plot of genome-wide association analysis (GWAS) of protein content BLUE values ​​in wheat populations grown under different environments. The red dashed line represents -log. 10 The threshold line is P=4; the red dot and black arrow point to the significant marker Whaas63035 identified in this invention, which is located on the wheat 7AS chromosome.

[0024] Figure 3 This graph compares the protein content of wheat grains among different allelic genotypes under different environments for the Whaas63035 marker. Orange indicates genotype AA, and blue indicates genotype GG. The differences in protein content among different genotypes in wheat grains reached a highly significant level. Detailed Implementation

[0025] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in this technical field. Unless otherwise specified, the reagents and materials used in the following embodiments are commercially available or can be prepared by known methods.

[0026] Example 1

[0027] The protein content in wheat grains from associated populations under different environments was determined using a near-infrared spectroscopy analyzer, and the protein content under different environments was calculated. The specific implementation steps are as follows:

[0028] An associated population comprising 207 wheat accessions was constructed and planted at the Henan Modernization Research and Development Base in Yuanyang County, Henan Province (YY) from 2017 to 2018, 2018 to 2019, and 2019 to 2020, and mature wheat grains were collected. The protein content in the wheat grains of the associated populations was determined using an IM9500 multi-functional near-infrared spectroscopy analyzer (Perten). The protein content of mature grains from each wheat accession was measured three times in duplicate (Table 1). Descriptive statistical analysis of the protein content in the wheat grains of the associated populations measured under different conditions over the three years was performed using IBM SPSS Statistics 22. The results showed that the kurtosis and skewness values ​​were both less than 1, indicating a basically normal distribution. Figure 1The protein content of wheat grains from the associated population identified under the YY_18 environment ranged from 8.80% to 16.07%, with an average of 13.28%; the protein content of wheat grains from the associated population identified under the YY_19 environment ranged from 9.90% to 17.30%, with an average of 13.71%; and the protein content of wheat grains from the associated population identified under the YY_20 environment ranged from 12.10% to 18.80%, with an average of 14.65%. The protein content of grains calculated using BLUE values ​​ranged from 10.45% to 15.90%, with an average of 13.43%. The coefficient of variation for protein content in wheat grains from different populations measured over different years ranged from 7.32% to 9.71%. The wheat grains grown in 2018-2019 showed the largest variation in protein content, with a minimum of 9.90% and a maximum of 17.30% (Table 2). This indicates that the wheat materials in this associated population exhibit broad phenotypic diversity, making them suitable for subsequent association analysis.

[0029] Table 1. Phenotypic data of protein content in wheat materials from related populations under different environments.

[0030]

[0031]

[0032]

[0033]

[0034]

[0035] Table 2. Phenotypic distribution of protein content in wheat grains of associated populations under different environments.

[0036]

[0037] Note: YY_18, YY_19, and YY_20 represent the associated populations constructed from 207 wheat materials, which were planted in the Henan Modernization Research and Development Base in Yuanyang County, Henan Province (YY) in 2017-2018, 2018-2019, and 2019-2020, respectively. BLUE is the best linear unbiased estimate calculated under different environments.

[0038] Example 2

[0039] Genome-wide association analysis (GWAS) was conducted using the wheat 660K microarray to analyze the genotype data of wheat materials from related populations. This data, combined with phenotypic data on protein content in wheat grains from different environmental conditions, identified key genes and loci controlling protein content, providing genetic resources and a theoretical basis for the breeding of high-quality wheat varieties. The specific experimental steps are as follows:

[0040] 1. Genotype data analysis

[0041] Leaf tissues from wheat seedlings in different environments in Example 1 were collected. DNA was extracted using a plant tissue DNA extraction kit, and the concentration was measured. The OD260 / OD280 ratio was set between 1.8 and 2.0 to ensure DNA integrity. Valid SNPs in the associated population were screened and identified using wheat 660K SNP chip genotyping data, yielding a total of 224,706 marker loci.

[0042] 2. Genome-wide association analysis

[0043] The population structure matrix and phylogenetic coefficients were calculated using STRUCTURE and Plink software. Genome-wide association analysis (GWAS) was performed using a Q+K mixed linear model (MLM) on the protein content and best linear unbiased estimate (BLUE) of wheat grains under three different environments in YY_18, YY_19, and YY_20. The threshold for detecting effect sites was set to -log10(p) = 4, and SNPs detected under all three environments were considered significant. Manhattan plots were used to represent the marker sites on the genome that were significantly associated with protein content after the association analysis.

[0044] Analysis of QTLs significantly associated with protein content identified under different environments revealed a major-effect QTL, qGPC7A.1, stable across multiple environments on chromosome 7AS, explaining 7.67%–10.92% of phenotypic variation. This QTL was observed in 2017–2018, 2018–2019, and BLUE (Bluetooth). Figure 2 The significant SNP site closely linked to it was detected in the genome sequence (IWGSC refseqv1.0). According to the Chinese Spring reference genome sequence information (IWGSC refseqv1.0), this significant site Whaas63035 is located at 45,821,002 bp on chromosome 7AS.

[0045] Table 3.1 Correlation Analysis Results under Different Environments

[0046]

[0047] Example 3

[0048] Genotyping of the identified SNP locus Whaas63035, which is significantly associated with protein content, was performed in the associated population. Combined with phenotypic data on protein content in wheat grains, phenotypic differences between different alleles were identified, and superior alleles were screened. This provides a reliable molecular marker for the breeding of high-quality wheat varieties and the screening of superior germplasm resources. The specific procedure is as follows:

[0049] Based on wheat 660K microarray data, the significantly relevant Whaas63035 nucleotide sequence was extracted: TATATTGTTCGTTCGTCATAGAATTAATTAGTACC[A / G]CATCGCTCTTATACACGAAAATT GACCAATTTATA. "[A / G]" indicates that this SNP marker has two polymorphic single nucleotides, A or G, meaning that the base at this position is either A or G in actual wheat materials. A mutation polymorphism site of A / G alleles exists at base position 36 of this sequence. Genotyping of different alleles of Whaas63035 in wheat materials from the associated population revealed that 14 wheat materials were of the Whaas63035_GG genotype, accounting for approximately 6.8%; and 193 wheat materials were of the Whaas63035_AA genotype, accounting for approximately 93.2% (Table 3).

[0050] Analysis of protein content in wheat grains from related populations revealed significant differences in protein content among different alleles under different environments. Figure 3 The protein content in wheat grains, calculated using BLUE values, showed that the protein content in wheat materials with the genotype Whaas63035_GG was significantly higher than that in wheat materials with the genotype Whaas63035_AA under different environments, increasing by 9.43%, 14.35%, 11.85%, and 11.03%, respectively. These results indicate that the Whaas63035_GG genotype is a favorable genotype for increasing the protein content in wheat grains.

[0051] Table 3. Effects of different genotypes of Whaas63035 on protein content in wheat grains.

[0052]

[0053] Note: The percentage increase or decrease is calculated by dividing the protein content of the AA genotype wheat material by the protein content of the GG genotype wheat material, i.e., percentage increase or decrease (%) = (AA-GG) / GG*100%.

[0054] In summary, the results indicate that the SNP marker Whaas63035 obtained in this invention can be effectively used to identify the protein content in wheat grains and can be used for effective screening of wheat materials in the early generations of breeding. Selecting Whaas63035_GG wheat material for breeding high-protein wheat and selecting Whaas63035_AA wheat material for breeding low-protein wheat shortens the breeding time and improves the breeding process.

[0055] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A SNP marker closely linked to the protein content in wheat grains, characterized in that, The SNP is marked as Whaas63035 The nucleotide sequence of the SNP marker is shown in SEQ ID NO.1, and the 36th base from the 5' end is either A or G.

2. The application of the SNP marker as described in claim 1 in assisted breeding, characterized in that, The application includes breeding or screening wheat plants, lines, strains, or varieties with relatively high grain protein content; or, the application includes breeding or screening wheat plants, lines, strains, or varieties with relatively low grain protein content.

3. The application of the SNP marker as described in claim 1 in the identification or auxiliary identification of wheat grain protein content.

4. The application according to claim 3, characterized in that, The application involves performing whole-genome sequencing on collected wheat grains, followed by analysis of the aforementioned SNP markers using 660K chip technology. Whaas63035 The genotype.

Images