An engineered strain of Schizochytrium that promotes β-carotene production by knocking out transcription factors, methods, and applications.
By knocking out the transcription factors A1189 and A9257 genes of Schizochytrium HX-308, engineered strains △A1189 and △A9257 were constructed, enabling global regulation of the metabolic flux of Schizochytrium. This solved the problem of the cumbersome nature of traditional metabolic engineering and significantly improved the production efficiency of β-carotene.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- NANJING NORMAL UNIVERSITY
- Filing Date
- 2023-02-21
- Publication Date
- 2026-07-31
AI Technical Summary
Existing metabolic engineering strategies for improving β-carotene production are cumbersome and time-consuming, making it difficult to achieve efficient global regulation and affecting strain performance.
By knocking out the transcription factors A1189 and A9257 on the genome of Schizochytrium HX-308, global regulation of the metabolic flux of Schizochytrium was achieved, and engineered strains △A1189 and △A9257 were constructed to promote the accumulation of β-carotene.
It significantly increased β-carotene titers by 1.3 times and 3.9 times compared to wild-type strains, simplifying the multi-gene modification process and improving work efficiency.
Smart Images

Figure CN116478835B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of bioengineering technology, and in particular to a Schizochytrium strain, method and application that promotes β-carotene production by knocking out transcription factors. Background Technology
[0002] Schiochytrium sp. is a marine unicellular heterotrophic microorganism. Due to its broad substrate spectrum, rapid growth rate, and high lipid content, it has gradually become a sought-after host cell for researchers. Currently, through optimization of culture conditions, the lipid accumulation of Schiochytrium sp. can reach more than 55% of its dry weight cell (DCW). Furthermore, Schiochytrium sp. naturally possesses the mevalonic acid (MVA) pathway. Therefore, Schiochytrium sp. can utilize the MVA pathway to produce terpenoids.
[0003] β-carotene (C 40 H 56 As a class of tetraterpenoid compounds, β-carotene is commonly found in many plants, fungi, and algae. In the human body, β-carotene is a precursor to vitamin A. Microbial vitamin A plays a crucial role in anti-cancer, antioxidant, and cardiovascular disease prevention. The global β-carotene market reached $451.1 million in 2020 and is projected to grow by 2.1% from 2020 to 2027, reaching $523.4 million by 2027. Furthermore, among the three isomers, including α-, β-, and γ-carotene, β-carotene is the most stable and effective. Traditionally, β-carotene is usually produced through chemical synthesis or plant extraction. However, both methods are often costly, time-consuming, and unsustainable. Microbial production of β-carotene offers advantages such as requiring less land area, being less affected by seasons and weather, and is a sustainable method.
[0004] Currently, metabolic engineering strategies are used to increase the yield of terpenoids. Common strategies include overexpressing precursor acetyl-CoA-related genes and increasing the supply of the cofactor NADPH, directing more metabolic flux toward the synthesis of the target compound. However, this single-level metabolic engineering strategy often requires simultaneous modification of multiple genes in the metabolic pathway, leading to increased workload and time consumption. It may also cause imbalances in the intracellular environment, affecting strain performance. In contrast, transcription factors (TFs) can regulate the expression levels of multiple genes at the cellular level, offering advantages in global and efficient regulation of cellular performance.
[0005] A search revealed no published documents related to this invention's patent application. Summary of the Invention
[0006] The purpose of this invention is to overcome the current practice of promoting β-carotene production through cumbersome metabolic engineering, and to provide a Schizochytrium strain, method, and application that can rapidly increase β-carotene titer simply by knocking out transcription factors.
[0007] The technical solution adopted by this invention to solve the technical problem is:
[0008] A Schizochytrium engineered strain that promotes β-carotene production by knocking out transcription factors. The engineered strain was obtained by knocking out the transcription factor A1189 gene and the A9257 gene on the genome of Schizochytrium HX-308, respectively, thereby achieving global regulation of the metabolic flux of Schizochytrium at the cellular level and promoting the accumulation of β-carotene in Schizochytrium.
[0009] The nucleotide sequence of the A1189 gene is SEQ ID NO.1, and the nucleotide sequence of the A9257 gene is SEQ ID NO.2.
[0010] Furthermore, the preservation number of the Schizochytrium HX-308 is CCTCC No. M209059.
[0011] Furthermore, the engineered strains are engineered strains of Schizochytrium △A1189 and △A9257. The β-carotene titers of the engineered strains of Schizochytrium △A1189 and △A9257 are 1.3 times and 3.9 times higher than those of wild-type Schizochytrium HX-308, respectively.
[0012] The method for constructing the engineered strain of Schizochytrium as described above includes the following steps:
[0013] (1) Based on the HX-308 genome sequencing, the promoter P2845, terminator T2845, and upstream and downstream homologous arm sequences of genes A1189 and A9257, namely A1189up, A1189dw, A9257up, and A9257dw, were obtained; the sequence of the G418 resistance gene NeoR is shown in SEQ ID NO.3. Primers were designed, and the corresponding DNA fragments were obtained by PCR. Further fusion DNA fragments were obtained by PCR. Among them, the nucleotide sequence of promoter P2845 is SEQ ID NO.5, the nucleotide sequence of terminator T2845 is SEQ ID NO.6, the nucleotide sequence of A1189up is SEQ ID NO.7, the nucleotide sequence of A1189dw is SEQ ID NO.8, the nucleotide sequence of A9257up is SEQ ID NO.9, and the nucleotide sequence of A9257dw is SEQ ID NO.10.
[0014] (2) The obtained fusion DNA fragment was inserted into the pZPK vector (Sun W, Yang X, Wang X, et al. Homologous gene targeting of a carotenoids biosynthetic gene in Rhodosporidium toruloides by Agrobacterium-mediated transformation[J]. Biotechnology Letters, 2017, 39(7): 1001-1007.) using a one-step cloning method to construct recombinant plasmids ZL-A1189 and ZL-A9257 for knocking out the A1189 and A9257 genes and then transformed into Escherichia coli DH5α;
[0015] (3) Obtain the correct recombinant plasmid by sequencing the E. coli transformants, preserve the bacteria, and keep them for later use;
[0016] (4) Transform the correctly sequenced recombinant plasmid into Agrobacterium AGL-1 (purchased from Beijing Xinghua Yueyang Biotechnology) to obtain recombinant Agrobacterium ZL-A1189 and ZL-A9257 strains.
[0017] (5) Using the Agrobacterium-mediated transformation method for Schizochytrium sp. (Huang PW, Xu YS, Sun XM*, Shi TQ, Gu Y, Ye C, Huang H. Development of an Efficient Gene Editing Tool in Schizochytrium sp. and Improving Its Lipid and Terpenoid Biosynthesis. Front Nutr. 2021 Dec 14; 8:795651.), the A1189 and A9257 genes in the Schizochytrium genome were knocked out, and engineered strains of Schizochytrium △A1189 and △A9257 were obtained.
[0018] Furthermore, the specific steps include the following:
[0019] (1) Construction of recombinant plasmids ZL-A1189 and ZL-A9257:
[0020] Using the genome of *Schizochytrium* HX-308 as a template, PCR amplification was performed using primer pairs P2845-F / R, T2845-F / R, A1189UP-F / R, A1189DW-F / R, A9257UP-F / R, and A9257DW-F / R. Simultaneously, PCR amplification was performed using the pZPK plasmid as a template with primer pair G418-F / R. The resulting DNA fragments included the promoter P2845, the terminator T2845, the G418 resistance gene NeoR, and the upstream and downstream homologous arms of A1189 and A9257. The nucleotide sequences of P2845-F / R, T2845-F / R, G418-F / R, A1189UP-F / R, A1189DW-F / R, A9257UP-F / R, and A9257DW-F / R are SEQ ID NO. 11-24, respectively.
[0021] Using pZPK plasmid as a backbone, pZPK was double-digested with the restriction enzymes EcoRI and HindIII, and the linearized vector was obtained by gel extraction. A one-step cloning kit from Novizan was then used. The Ultra One Step Cloning Kit was used for one-step cloning, inserting the fusion DNA fragment obtained in the previous step into pZPK to construct recombinant plasmids ZL-A1189 and ZL-A9257.
[0022] The ligation system was cultured at 50℃ for 30 min, and then transformed into competent E. coli DH5α cells. E. coli were then transformed, cultured at 220 rpm and 37℃ for 1 h, followed by centrifugation at 3000 rpm for 3 min, and finally spread onto LB solid medium containing 50 μg / mL kanamycin. The medium was then incubated overnight at 37℃ with the medium inverted for >12 h until transformants appeared.
[0023] Pick 4-6 transformants from each transformation plate and place them in 5 mL of LB liquid medium containing 50 μg / mL kanamycin. Incubate for 6-8 h. Send the bacterial culture to a sequencing company for sequencing. Select the correctly sequenced strains and preserve them at -80℃ (containing 20% glycerol) for later use.
[0024] (2) Construction of recombinant Agrobacterium AGL-A1189 and AGL-A9257:
[0025] Extract plasmids ZL-A1189 and ZL-A9257 from E. coli DH5α that were correctly sequenced, and set them aside for later use.
[0026] Remove 100 μL of Agrobacterium AGL-1 competent cells stored at -80℃ and place them on ice for 10 min; add 1 μg of correctly sequenced plasmid and perform Agrobacterium transformation, incubate at 220 rpm and 28℃ for 1 h, then centrifuge at 3000 rpm for 3 min, discard the supernatant, and mix the remaining 100-200 μL of bacterial culture by pipetting, spread evenly on LB solid medium containing 50 μg / mL carbenicillin and 50 μg / mL kanamycin, and incubate upside down in a 28℃ incubator until transformants grow;
[0027] Transformants were picked and cultured overnight at 28°C and 220 rpm in 3 mL of LB liquid medium containing 50 μg / ml carbenicillin and 50 μg / ml kanamycin for more than 12 h. Agrobacterium AGL-A1189 and AGL-A9257 containing recombinant plasmids were stored at -80°C (containing 20% glycerol).
[0028] (3) Construction of recombinant Schizochytrium △A1189 and △A9257:
[0029] Using the Agrobacterium-mediated Schizochytrium transformation method (Huang PW, Xu YS, Sun XM*, Shi TQ, Gu Y, Ye C, Huang H. Development of an Efficient Gene Editing Tool in Schizochytrium sp. and Improving Its Lipid and Terpenoid Biosynthesis. Front Nutr. 2021 Dec 14; 8:795651.), the A1189 and A9257 genes on the Schizochytrium HX-308 genome were knocked out separately. After treating Agrobacterium and Schizochytrium separately, 100 μL of each bacterial culture was taken and mixed evenly. The resulting 200 μL culture was spread on IM solid medium and induced for 48 h. Then, it was transferred to GPYS solid medium to wait for transformants to grow. Three transformants were picked from each transformation plate and named △A1189 and △A9257, respectively, and incubated at -80℃ (containing 20% glycerol).
[0030] Three transformants were picked from each transformation plate and named △A1189 and △A9257 respectively, and incubated at -80℃ (containing 20% glycerol).
[0031] The application of the engineered strains of Schizochytrium as described above in the production of β-carotene.
[0032] The method for producing β-carotene by fermentation using the engineered strain of Schizochytrium as described above includes the following steps:
[0033] The engineered strain of Schizochytrium was taken from the preservation tube and placed in the seed culture. It was cultured at 28℃ and 170 rpm / min, and subcultured every 24 hours for a total of two subcultures. The third generation seed culture was then transferred to the fermentation medium. After 7 days of fermentation, the fermentation was stopped, the fermentation broth sample was processed, and the β-carotene titer was determined (the method for detecting β-carotene titer is: Harnkarnsujarit N, Charoenrein S, Roos YH. Reversed phase HPLC analysis of stability and microstructural effects on degradation kinetics of β-carotene encapsulated in freeze-dried maltodextrin-emulsion systems. JAGric Food Chem. 2012 Sep 26; 60(38):9711-8.).
[0034] Furthermore, the seed culture medium is:
[0035] Glucose: 50 g / L, Potassium dihydrogen phosphate: 4 g / L, Yeast extract: 4 g / L, Sodium sulfate: 20 g / L, Magnesium sulfate heptahydrate: 4.6 g / L, Ammonium sulfate: 4.8 g / L, Sodium chloride: 1.25 g / L, Potassium chloride: 1 g / L, Monosodium glutamate: 20 g / L, 0.1% Trace elements, Vitamin B1 0.5 mg / L, Vitamin B6 0.5 mg / L, Vitamin B2 12 0.25 μg / L; of which, 0.1% trace elements include: zinc sulfate heptahydrate: 0.001 g / L, copper sulfate pentahydrate: 0.001 g / L, boric acid: 0.001 g / L, ammonium sulfate: 0.5 g / L, manganese sulfate monohydrate: 0.001 g / L, sodium manganate monohydrate: 0.001 g / L;
[0036] The fermentation medium was as follows: glucose: 10 g / L, potassium dihydrogen phosphate: 4 g / L, yeast extract: 4 g / L, sodium sulfate: 12 g / L, magnesium sulfate heptahydrate: 2 g / L, ammonium sulfate: 4 g / L, sodium chloride: 0.5 g / L, potassium sulfate: 0.7 g / L, calcium chloride: 0.15 g / L, monosodium glutamate: 20 g / L, 0.1% trace elements, vitamin B1 0.5 mg / L, vitamin B6 0.5 mg / L, vitamin B2... 12 0.25 μg / L; of which, 0.1% of trace elements are: zinc sulfate heptahydrate: 8 g / L, magnesium chloride tetrahydrate: 8 g / L, cobalt chloride hexahydrate: 0.1 g / L, sodium manganate dihydrate: 0.1 g / L, copper sulfate pentahydrate: 6 g / L, nickel sulfate hexahydrate: 6 g / L, ferrous sulfate heptahydrate: 20 g / L;
[0037] When preparing solid culture media, all of the above media should have 1.5% agar added.
[0038] The beneficial effects achieved by this invention are:
[0039] 1. This invention avoids traditional metabolic engineering strategies and achieves global regulation of cells by modulating transcription factors, promoting the accumulation of β-carotene and providing a strategy for regulating terpene compound titers at the protein level.
[0040] 2. This invention significantly increases the titer of β-carotene by knocking out only a single transcription factor gene. This greatly reduces the cumbersome steps of traditional metabolic engineering that regulates multiple genes, thus improving work efficiency.
[0041] 3. This invention relates to the knockout of two transcription factors that promote β-carotene production in Schizochytrium. Transcription factor A1189, with a coding region of 2637 bp, encodes oxidized squalene-lanosterol cyclase and related proteins. Transcription factor A9257, with a coding region of 1044 bp, encodes a zinc transporter and related ZIP domain proteins.
[0042] This invention achieves global regulation of Schizochytrium at the cellular level by knocking out two transcription factors, A1189 and A9257, respectively, thereby regulating the expression levels of multiple genes in cells. This not only significantly reduces the cumbersome steps of multi-gene knockout but also significantly promotes the accumulation of β-carotene in Schizochytrium.
[0043] 4. This invention uses *Schizochytrium sp.* HX-308 as the original strain, and knocks out the transcription factors A1189 and A9257, respectively, to promote the accumulation of β-carotene in *Schizochytrium sp.*. Compared with the original strain, the β-carotene titer increased by 1.3 times and 3.9 times, respectively. This invention provides a good strategy for increasing the titer of β-carotene and other terpenoid compounds. Attached Figure Description
[0044] Figure 1 This is an agarose gel electrophoresis image of the gene knockout of A1189 and A9257 in Schizochytrium HX-308(WT) in this invention.
[0045] Figure 2 The titer of β-carotene produced by wild-type Schizochytrium HX-308 and engineered strains △A1189 and △A9257 in this invention is shown in the figure.
[0046] Figure 3 This is a verification diagram of the NeoR sequencing results of the transformant resistance gene in this invention. Detailed Implementation
[0047] To better understand the present invention, the present invention will be further described in detail below with reference to the embodiments. However, the scope of protection of the present invention is not limited to the scope represented by the embodiments.
[0048] Unless otherwise specified, all raw materials used in this invention are conventional commercially available products. Unless otherwise specified, all methods used in this invention are conventional methods in the field. All substances used in this invention are of conventional usage quality.
[0049] A Schizochytrium engineered strain that promotes β-carotene production by knocking out transcription factors. The engineered strain was obtained by knocking out the transcription factor A1189 gene and the A9257 gene on the genome of Schizochytrium HX-308, respectively. By globally regulating the metabolic flux of Schizochytrium at the cellular level, the accumulation of β-carotene in Schizochytrium is promoted.
[0050] The nucleotide sequence of the A1189 gene is SEQ ID NO.1, and the nucleotide sequence of the A9257 gene is SEQ ID NO.2.
[0051] Preferably, the preservation number of the Schizochytrium HX-308 is CCTCC No. M209059.
[0052] Preferably, the engineered strains are engineered strains of Schizochytrium △A1189 and △A9257, and the β-carotene titers of engineered strains of Schizochytrium △A1189 and △A9257 are 1.3 times and 3.9 times higher than those of wild-type Schizochytrium HX-308, respectively.
[0053] The method for constructing the engineered strain of Schizochytrium as described above includes the following steps:
[0054] (1) Based on the HX-308 genome sequencing, the promoter P2845, terminator T2845, and upstream and downstream homologous arm sequences of genes A1189 and A9257, namely A1189up, A1189dw, A9257up, and A9257dw, were obtained; the sequence of the G418 resistance gene NeoR is shown in SEQ ID NO.3. Primers were designed, and the corresponding DNA fragments were obtained by PCR. Further fusion DNA fragments were obtained by PCR. Among them, the nucleotide sequence of promoter P2845 is SEQ ID NO.5, the nucleotide sequence of terminator T2845 is SEQ ID NO.6, the nucleotide sequence of A1189up is SEQ ID NO.7, the nucleotide sequence of A1189dw is SEQ ID NO.8, the nucleotide sequence of A9257up is SEQ ID NO.9, and the nucleotide sequence of A9257dw is SEQ ID NO.10.
[0055] (2) The obtained fusion DNA fragment was inserted into the pZPK vector (Sun W, Yang X, Wang X, et al. Homologous gene targeting of a carotenoids biosynthetic gene in Rhodosporidium toruloides by Agrobacterium-mediated transformation[J]. Biotechnology Letters, 2017, 39(7): 1001-1007.) using a one-step cloning method to construct recombinant plasmids ZL-A1189 and ZL-A9257 for knocking out the A1189 and A9257 genes, and then transformed into Escherichia coli DH5α;
[0056] (3) Obtain the correct recombinant plasmid by sequencing the E. coli transformants, preserve the bacteria, and keep them for later use;
[0057] (4) Transform the correctly sequenced recombinant plasmid into Agrobacterium AGL-1 to obtain recombinant Agrobacterium ZL-A1189 and ZL-A9257 strains;
[0058] (5) Using the Agrobacterium-mediated transformation method for Schizochytrium sp. (Huang PW, Xu YS, Sun XM*, Shi TQ, Gu Y, Ye C, Huang H. Development of an Efficient Gene Editing Tool in Schizochytrium sp. and Improving Its Lipid and Terpenoid Biosynthesis. Front Nutr. 2021 Dec 14; 8:795651.), the A1189 and A9257 genes in the Schizochytrium genome were knocked out, and engineered strains of Schizochytrium △A1189 and △A9257 were obtained.
[0059] Preferably, the specific steps include the following:
[0060] (1) Construction of recombinant plasmids ZL-A1189 and ZL-A9257:
[0061] Using the genome of *Schizochytrium* HX-308 as a template, PCR amplification was performed using primer pairs P2845-F / R, T2845-F / R, A1189UP-F / R, A1189DW-F / R, A9257UP-F / R, and A9257DW-F / R. Simultaneously, PCR amplification was performed using the pZPK plasmid as a template with primer pair G418-F / R. The resulting DNA fragments included the promoter P2845, the terminator T2845, the G418 resistance gene NeoR, and the upstream and downstream homologous arms of A1189 and A9257. The nucleotide sequences of P2845-F / R, T2845-F / R, G418-F / R, A1189UP-F / R, A1189DW-F / R, A9257UP-F / R, and A9257DW-F / R are SEQ ID NO. 11-24, respectively.
[0062] Using pZPK plasmid as a backbone, pZPK was double-digested with the restriction enzymes EcoRI and HindIII, and the linear vector was obtained by gel extraction. A one-step cloning kit from Novizan was then used. The Ultra One Step Cloning Kit was used for one-step cloning, and the fusion fragment obtained in the previous step was inserted into pZPK to construct recombinant plasmids ZL-A1189 and ZL-A9257.
[0063] The ligation system was cultured at 50℃ for 30 min, and then transformed into competent E. coli DH5α cells. The E. coli were then transformed by incubating at 220 rpm and 37℃ for 1 h, followed by centrifugation at 3000 rpm for 3 min. Finally, the cells were plated onto LB solid medium containing 50 μg / mL kanamycin and incubated overnight at 37℃ with the medium inverted. The incubation time was >12 h until transformants appeared.
[0064] Pick 4-6 transformants from each transformation plate and incubate them in 5 mL of LB liquid medium containing 50 μg / mL kanamycin for 6-8 h; send the bacterial culture to a sequencing company for sequencing, select the correctly sequenced strains, and preserve the bacteria at -80°C (containing 20% glycerol) for later use.
[0065] (2) Construction of recombinant Agrobacterium AGL-A1189 and AGL-A9257:
[0066] Extract plasmids ZL-A1189 and ZL-A9257 from E. coli DH5α that were correctly sequenced, and set them aside for later use.
[0067] Take out 100 μL of Agrobacterium AGL-1 competent cells stored at -80℃ and place them on ice for 10 min; add 1 μg of the sequenced plasmid; perform Agrobacterium transformation, incubate at 220 rpm and 28℃ for 1 h, then centrifuge at 3000 rpm for 3 min, discard the supernatant, mix the remaining 100-200 μL of bacterial solution by pipetting, spread it evenly on LB solid medium containing 50 μg / mL carbenicillin and 50 μg / mL kanamycin, and incubate upside down in a 28℃ incubator until transformants grow;
[0068] Transformants were picked and cultured overnight at 28°C and 220 rpm in 3 mL of LB liquid medium containing 50 μg / mL carbenicillin and 50 μg / mL kanamycin for more than 12 h. Agrobacterium AGL-A1189 and AGL-A9257 containing recombinant plasmids were stored at -80°C (containing 20% glycerol).
[0069] (3) Construction of recombinant Schizochytrium △A1189 and △A9257:
[0070] Using the Agrobacterium-mediated transformation method for Schizochytrium (Huang PW, Xu YS, Sun XM*, Shi TQ, Gu Y, Ye C, Huang H. Development of an Efficient Gene Editing Tool in Schizochytrium sp. and Improving Its Lipid and Terpenoid Biosynthesis. Front Nutr. 2021 Dec 14; 8:795651.), the A1189 and A9257 genes on the Schizochytrium HX-308 genome were knocked out separately. After treating Agrobacterium and Schizochytrium separately, 100 μL of each bacterial culture was taken and mixed evenly. The mixed culture was spread on IM solid medium and induced for 48 h. Then it was transferred to GPYS solid medium. After transformants grew, three transformants were picked from each transformation plate and named △A1189 and △A9257, respectively. The culture was incubated at -80℃ (containing 20% glycerol).
[0071] The application of the engineered strains of Schizochytrium as described above in the production of β-carotene.
[0072] The method for producing β-carotene by fermentation using the engineered strain of Schizochytrium as described above includes the following steps:
[0073] The engineered strain of Schizochytrium was taken from the preservation tube and placed in the seed culture. It was cultured at 28℃ and 170 rpm / min, and subcultured every 24 hours for a total of two subcultures. The third generation seed culture was then transferred to the fermentation medium. After 7 days of fermentation, the fermentation was stopped, the fermentation broth sample was processed, and the β-carotene titer was determined (the method for detecting β-carotene titer is: Harnkarnsujarit N, Charoenrein S, Roos YH. Reversed phase HPLC analysis of stability and microstructural effects on degradation kinetics of β-carotene encapsulated in freeze-dried maltodextrin-emulsion systems. JAGric Food Chem. 2012 Sep 26; 60(38):9711-8.).
[0074] Preferably, the seed culture medium is:
[0075] Glucose: 50 g / L, Potassium dihydrogen phosphate: 4 g / L, Yeast extract: 4 g / L, Sodium sulfate: 20 g / L, Magnesium sulfate heptahydrate: 4.6 g / L, Ammonium sulfate: 4.8 g / L, Sodium chloride: 1.25 g / L, Potassium chloride: 1 g / L, Monosodium glutamate: 20 g / L, 0.1% Trace elements, Vitamin B1 0.5 mg / L, Vitamin B6 0.5 mg / L, Vitamin B2 12 0.25 μg / L; of which, 0.1% trace elements include: zinc sulfate heptahydrate: 0.001 g / L, copper sulfate pentahydrate: 0.001 g / L, boric acid: 0.001 g / L, ammonium sulfate: 0.5 g / L, manganese sulfate monohydrate: 0.001 g / L, sodium manganate monohydrate: 0.001 g / L;
[0076] The fermentation medium was as follows: glucose: 10 g / L, potassium dihydrogen phosphate: 4 g / L, yeast extract: 4 g / L, sodium sulfate: 12 g / L, magnesium sulfate heptahydrate: 2 g / L, ammonium sulfate: 4 g / L, sodium chloride: 0.5 g / L, potassium sulfate: 0.7 g / L, calcium chloride: 0.15 g / L, monosodium glutamate: 20 g / L, 0.1% trace elements, vitamin B1 0.5 mg / L, vitamin B6 0.5 mg / L, vitamin B2... 12 0.25 μg / L; of which, 0.1% of trace elements are: zinc sulfate heptahydrate: 8 g / L, magnesium chloride tetrahydrate: 8 g / L, cobalt chloride hexahydrate: 0.1 g / L, sodium manganate dihydrate: 0.1 g / L, copper sulfate pentahydrate: 6 g / L, nickel sulfate hexahydrate: 6 g / L, ferrous sulfate heptahydrate: 20 g / L;
[0077] When preparing solid culture media, all of the above media should have 1.5% agar added.
[0078] Specifically, the relevant preparation and testing methods are as follows:
[0079] The culture media used in the following examples are as follows:
[0080] LB liquid medium: sodium chloride 10 g / L, tryptone 10 g / L, yeast extract 5 g / L, antibiotics (including: carbenicillin 50 mg / L, kanamycin 50 mg / L).
[0081] IM liquid culture medium: glucose: 2 g / L, potassium dihydrogen phosphate: 1.45 g / L, dipotassium hydrogen phosphate: 2.05 g / L, ammonium nitrate: 0.5 g / L, sodium chloride: 0.01 g, magnesium sulfate heptahydrate: 0.6 g, sodium chloride: 0.3 g, 0.1% trace elements (including: zinc sulfate heptahydrate: 0.001 g / L, copper sulfate pentahydrate: 0.001 g / L, boric acid: 0.001 g / L, ammonium sulfate: 0.5 g / L, manganese sulfate monohydrate: 0.001 g / L, sodium manganate monohydrate: 0.001 g / L), morpholine ethanesulfonic acid monohydrate: 8.7 g / L, glycerol: 5 g / L, acetylsyl syringone: 200 μM.
[0082] GPYS liquid medium: glucose: 50 g / L, sea salt: 20 g / L, peptone: 10 g / L, yeast extract: 5 g / L, antibiotics (including: thiazolycin: 300 μg / mL and G418: 500 μg / mL).
[0083] Seed culture medium: Glucose: 50 g / L, Potassium dihydrogen phosphate: 4 g / L, Yeast extract: 4 g / L, Sodium sulfate: 20 g / L, Magnesium sulfate heptahydrate: 4.6 g / L, Ammonium sulfate: 4.8 g / L, Sodium chloride: 1.25 g / L, Potassium chloride: 1 g / L, Monosodium glutamate: 20 g / L, 0.1% trace elements (including: Zinc sulfate heptahydrate: 0.001 g / L, Copper sulfate pentahydrate: 0.001 g / L, Boric acid: 0.001 g / L, Ammonium sulfate: 0.5 g / L, Manganese sulfate monohydrate: 0.001 g / L, Sodium manganate monohydrate: 0.001 g / L), Vitamin B1 0.5 mg / L, Vitamin B6 0.5 mg / L, Vitamin B2 12 0.25 μg / L.
[0084] Fermentation medium: Glucose: 10 g / L, Potassium dihydrogen phosphate: 4 g / L, Yeast extract: 4 g / L, Sodium sulfate: 12 g / L, Magnesium sulfate heptahydrate: 2 g / L, Ammonium sulfate: 4 g / L, Sodium chloride: 0.5 g / L, Potassium sulfate: 0.7 g / L, Calcium chloride: 0.15 g / L, Monosodium glutamate: 20 g / L, 0.1% trace elements (Zinc sulfate heptahydrate: 8 g / L, Magnesium chloride tetrahydrate: 8 g / L, Cobalt chloride hexahydrate: 0.1 g / L, Sodium manganate dihydrate: 0.1 g / L, Copper sulfate pentahydrate: 6 g / L, Nickel sulfate hexahydrate: 6 g / L, Ferrous sulfate heptahydrate: 20 g / L), Vitamin B1 0.5 mg / L, Vitamin B6 0.5 mg / L, Vitamin B2 12 0.25 μg / L.
[0085] When preparing solid culture media, all of the above-mentioned culture media need to have 1.5% agar added.
[0086] Example 1
[0087] Construction of recombinant plasmids ZL-A1189 and ZL-A9257:
[0088] Recombinant plasmids ZL-A1189 and ZL-A9257 were used to introduce Agrobacterium tumefaciens to knock out the A1189 and A9257 genes in the genome of Schizochytrium HX-308 (strain preservation number CCTCC No. M209059), respectively. The nucleotide sequences of genes A1189 and A9257 are SEQ ID NO.1 and SEQ ID NO.2, respectively, as follows:
[0089] (1) Based on genome annotation, the constitutive expression gene glyceraldehyde-3-phosphate dehydrogenase was identified as A2845 (SEQ ID NO.4). The promoter P2845 (SEQ ID NO.5) was located 1 kb upstream of the start codon of A2845, and the terminator T2845 (SEQ ID NO.6) was located 500 bp downstream of the stop codon.
[0090] Gene A2845 (1014bp)
[0091]
[0092] Promoter P2845 (1022bp)
[0093]
[0094] Terminator T2845 (508 bp)
[0095] AAAGTCGCACGCGAGCTTTTTACTTTTCCTATTATTTTTTTTCTTCCTCCGATCCCTCTTGTTGCACCAGAAAACAACGCAGAAACACGGGAGCTTGACAGCGTGACCACAGGAAAGATACTAT GGATGAGAACGGAACGCCAGGTGGAATACAGAAGTCGAGGGCATATCTTTGCGAGCAACACATGTTCGAGCCGCGGAATCGACCCCGGACGCCATGGCTGGCTGGCTGACTGGCTGACTGATCCATG CTCATGAAAGCATGGCAACTCTTGCTGGCGCCGGGGCCTCTGTCGCTCTTGCCGCTTCCGTGCCACGTTTGCCTGGACTTGCTCCCTTTGTTTGTTTCTCGCTTCCAGGTCCTTCTCGCGTTCTGC CTCTTCCTCTTCCCTTTCCAAGTCCTCTTCTTCAATATCCATGTCGTCGTCTTCGAATGCAAAGTCACGCGAATCAGAGCCAAATTGTGCTGCAAATTCAGCATACTGCTCTAGGGTAGCCTTATCG
[0096] (2) Based on genome annotation, the proteins encoding oxidized squalene-lanosterol cyclase and its related proteins were identified as A1189 and A9257, respectively. One kb upstream of the start codon and one kb downstream of the stop codon of A1189 and A9257 were selected as the upstream and downstream homologous arms for knocking out the target gene (A1189up-SEQ ID NO.7, A1189dw-SEQ ID NO.8, A9257up-SEQ ID NO.9, A9257dw-SEQ ID NO.10, respectively).
[0097] A1189up (1136 bp)
[0098]
[0099] A1189dw(925 bp)
[0100] CCTCTCCAGCTAGCTCTTCCTTCTCCTCTGCGCCACCGCGCGAGGGCCCGCTGCGCTCCGCTGCGCTCCGCTCCGCTCCGCACAGCTCGGCGCAGGCCGCACCCGGGCTCTGTCTCCGCCGCGCCGCGATCGGTGTATGCCTGTCTGTGCCTGTCTGCGCGCGCGCAAGCAAGCAAGTAAGGCAGGCAAAAAGCAAGAAAGCAGTCGCTGGGACTCTCAGCCAGGTGATGTATTATAGTAGTCCGTAGTACGTATTATAGTAGAGTGTAGTACTACGCCGCAAAGAGCCCCGCCTTCTTTGCGCTTATTTCGCGCCTGCTTTGCTTGCGCCTTTGGGCGAACGGGGCGGGCCTCTTCCGGCCAGCGGGGAGGAAGCCCCGCCGCTCCCGCCGCAATCCGTCGCTCGCCGGCCGGCCGGGTGCTCATGACCCGCGAGCTCTCGCACGATGCGGGCGCTGGCGCGCATGCGCACGCGGCGATGCGGCATCGCCGCGGAGGCTGCGCCGATCTTGATCGCGCCAACGCGGCCGCCCCCTCACCCACGTCGCCTGCGTCCCCTCTGCGCGCGGCGGGGCCGCCTGCTCGCTGAAAAGCGTTGCGCAGGATATCCTCGTCCAGAAGTACAGGATATCCTAGGCACCTCCCCTGCCGGCGAGGATATCCTCTTGCGCGTCACCGCGCGATGCGCCATCATCGCGGTTTGCGCAAGAGGGCGCGGCGCCGCGCCGCCCCGGACCGCGAGGCCGGCGCGGAAGAGCTCGTCCTCGGGGAGCACGAGCTCGCCACGCACAGCCCGAGCAGCGCGGAAACCCGCGCCGCCTCCGGGCCTGCCGCCTCCCGCGCGCCCCGCTGCGCCCGCACACTCGCGCGCGCACCCGCGGACGGCGCGAGCGGCGCGATAAAGGGCGACGATAGGCACATCGTC
[0101] A9257up(1008 bp)
[0102]
[0103] A9257dw(1074 bp)
[0104]
[0105] (3) Based on the sequences obtained from genome sequencing, corresponding primers were designed, and the primer sequences are shown in Table 3. Using the genome of Schizochytrium HX-308 as a template, PCR amplification was performed using primer pairs P2845-F / R, T2845-F / R, A1189UP-F / R, A1189DW-F / R, A9257UP-F / R, and A9257DW-F / R, respectively. The PCR amplification programs are shown in Tables 1 and 2 below. After PCR amplification, the gel was run, the gel was cut and recovered, and the corresponding promoter P2845, terminator T2845, upstream and downstream homologous arms of A1189, and upstream and downstream homologous arms of A9257 DNA fragments were obtained.
[0106] (4) The sequence of the G418 resistance gene NeoR is shown in SEQ ID NO.3. Based on the NeoR sequence, primers G418-F / R were designed. Using pZPK plasmid as a template (Sun W, Yang X, Wang X, et al. Homologous gene targeting of a carotenoids biosynthetic gene in Rhodosporidium toruloides by Agrobacterium-mediated transformation[J]. Biotechnology Letters, 2017, 39(7): 1001-1007.), PCR amplification was performed using the G418-F / R primer pair to obtain the corresponding DNA fragment of the G418 resistance gene NeoR. Finally, the fusion fragment was obtained by PCR. The verification results are as follows: Figure 3 As shown.
[0107] Table 1 PCR amplification system
[0108] reagents Volume (μL) 2*PrimeSTARMax 25 Primer P1 1 Primer P2 1 template 1 <![CDATA[ddH2O]]> 22
[0109] Table 2 PCR Procedure
[0110]
[0111] Table 3 Primer sequences
[0112]
[0113]
[0114] (5) Recombinant plasmids ZL-A1189 and ZL-A9257 were derived from pZPK plasmid as a backbone. pZPK-NeoR was double-digested with EcoRI and HindIII, and the linearized vectors were obtained by gel extraction. A one-step cloning kit from Novizan was used. The Ultra One Step Cloning Kit performs one-step cloning, inserting the fusion fragment containing the upper and lower homologous arms of A1189 and A9257 obtained in the previous step into pZPK to construct recombinant plasmids ZL-A1189 and ZL-A9257.
[0115] Connection system:
[0116] reagents Volume (μL) Excerpt 1 Enzyme digestion plasmid 2 <![CDATA[ddH2O]]> 5.7 2×Ultra One Step Cloning Mix 10
[0117] The ligation system was prepared on ice and incubated at 50°C for 30 min. The ligation system was then transformed into competent E. coli DH5α cells (purchased from Beijing Qingke Biotechnology Co., Ltd.). The specific procedures are as follows:
[0118] (6) Take 100 μL of competent cells stored at -80℃, thaw on ice, and use a pipette to transfer the ligation product to the competent cells, mixing thoroughly by pipetting. After incubating on ice for 30 min, heat shock in a 42℃ water bath for 90 s, and then incubate on ice again for 3 min. Add 1 mL of LB liquid medium, incubate at 220 rpm and 37℃ for 1 h. Centrifuge at 3000g for 3 min, and finally spread on LB solid medium containing 50 μg / mL kanamycin, and incubate overnight (>12 h) upside down in a 37℃ incubator until transformants grow.
[0119] (7) Pick 4-6 transformants from the plate and incubate them in 5 mL LB broth (containing 50 μg / mL kanamycin) for 6-8 hours. Send the bacterial culture to a sequencing company for sequencing, select the correctly sequenced strain, and preserve the bacteria at -80℃ (containing 20% glycerol) for later use. Results are as follows... Figure 3 As shown.
[0120] Example 2
[0121] Construction of recombinant Agrobacterium AGL-A1189 and AGL-A9257:
[0122] (1) Extract plasmids from plasmids ZL-A1189 and ZL-A9257 that were correctly sequenced in Example 1 and set them aside.
[0123] (2) Take out 100 μL of Agrobacterium AGL-1 competent cells stored at -80℃ and place them on ice for 10 min. Add 1 μg of the correctly sequenced plasmid, gently mix with a pipette, and incubate on ice for 30 min. Quick freeze in liquid nitrogen for 5 min, incubate at 37℃ for 5 min, and immediately incubate on ice for 2 min. Add 1 mL of LB liquid medium and incubate at 28℃ and 220 rpm for 1 h. Centrifuge at 3000g for 5 min to collect the bacterial cells. After removing 900 μL of supernatant, resuspend the bacterial cells in 100 μL of liquid and spread them evenly on LB solid medium (containing 50 μg / mL carbenicillin and 50 μg / mL kanamycin). Incubate at 28℃ inverted until transformants grow.
[0124] (3) Pick 3-4 transformants and culture them overnight (>12h) at 28℃ and 220rpm in 3mL LB liquid medium (containing 50μg / ml Carb and 50μg / ml Kan). Store the Agrobacterium AGL-A1189 and AGL-A9257 bacterial cultures containing recombinant plasmids at -80℃ (containing 20% glycerol).
[0125] Example 3
[0126] Construction of recombinant Schizochytrium △A1189 and △A9257:
[0127] (1) Wild-type Schizochytrium HX-308 stored at -80℃ was cultured in seed culture medium. Recombinant Agrobacterium AGL-A1189 and AGL-A9257 bacterial suspensions containing recombinant plasmids, prepared in Example 2 and stored at -80℃, were streaked onto LB solid medium (containing 50 μg / mL carbenicillin and 50 μg / mL kanamycin). For specific Agrobacterium-mediated Schizochytrium transformation methods, please refer to the article Huang PW, Xu YS, Sun XM*, Shi TQ, Gu Y, Ye C, Huang H. Development of an Efficient Gene Editing Tool in Schizochytrium sp. and Improving Its Lipid and Terpenoid Biosynthesis. Front Nutr. 2021 Dec 14; 8:795651.
[0128] (2) After treating Agrobacterium and Schizochytrium separately, 100 μL of bacterial solution from each was mixed evenly. The resulting 200 μL bacterial solution was spread on IM solid medium and induced for 48 h. The solution was then screened on GPYS solid medium containing 300 μg / mL cefotaxime sodium and 500 μg / mL G418 antibiotic. The solution was then incubated at 28 °C until transformants were grown.
[0129] (3) Pick 4-6 transformants from each transformation plate and extract their genomes. Using the extracted genomes as templates, verify whether gene A1189 is knocked out using primer pair A1189-YZ-F / R; verify whether gene A9257 is knocked out using primer pair A9257-YZ-F / R (results are shown in the figure). Figure 1 (As shown). The correctly verified engineered fissiculturia were named △A1189 and △A9257, respectively, and kept in storage for later use.
[0130] The verification primers are shown below:
[0131] A1189-YZ-F:GCGTCTAATGGTCGCGAAGATG
[0132] A1189-YZ-R:CGTGACCCATGGCGATGC
[0133] A9257-YZ-F:GTCAGACCTTGGCCGAGC
[0134] A9257-YZ-R:CGAATCTTCTCCGCACTAAAGCC
[0135] Example 4
[0136] Fermentation of recombinant Schizochytrium △A1189 and △A9257 to determine β-carotene production:
[0137] The yield of β-carotene was determined by fermentation culture of engineered strains △A1189 and △A9257 of Schizochytrium.
[0138] Two mL of engineered strains △A1189 and △A9257 were taken from the preservation tube and cultured in 50 mL of seed culture at 28℃ and 170 rpm / min. The culture was subcultured twice, every 24 hours. Two mL of the third-generation seed culture were then transferred to the fermentation medium. After 7 days of fermentation, 1 mL of the fermentation broth was taken, treated, and the β-carotene titer was determined (results are shown below). Figure 2 (As shown in Table 4). For specific fermentation broth treatment and β-carotene determination methods, refer to: Harnkarnsujarit N et al. Reversed phase HPLC analysis of stability and microstructural effects on degradation kinetics of β-carotene encapsulated in freeze-dried maltodextrin-emulsion systems. JAGric Food Chem. 2012. 60(38): 9711-8.
[0139] This invention utilizes an Agrobacterium-mediated transformation method to knock out the transcription factors A1189 and A9257 in the genome of wild-type Schizochytrium HX-308, obtaining engineered Schizochytrium strains A1189 and A9257. The yield of β-carotene was determined by fermentation of the engineered Schizochytrium strains. Figure 2 As shown in Table 4, compared with the wild-type strains, the β-carotene titers of engineered Schizochytrium A1189 and A9257 were increased by 1.3 times and 3.9 times, respectively. This provides a convenient and rapid strategy for microorganisms to increase the titers of β-carotene and other terpenoid compounds.
[0140] Table 4
[0141]
[0142] In existing technologies, Guo Jianqi et al. invented a recombinant lipophilic yeast strain that produces high levels of β-carotene. Its construction and application involve multiple genes, and the integration of multiple copies increases β-carotene titer (CN 114686385 B). The optimal engineered strain showed a 37.2% increase in β-carotene production compared to the control strain. However, this invention significantly increases β-carotene titer by simply knocking out a single transcription factor (knocking out the A9257 gene resulted in a 3.9-fold increase in β-carotene titer compared to the control).
[0143] The sequences used in this invention are as follows:
[0144] SEQ ID NO.1: A1189 (2637bp) nucleotide sequence
[0145]
[0146] SEQ ID NO.2: A9257 (1044bp) nucleotide sequence
[0147]
[0148] SEQ ID NO.3: NeoR (795bp) nucleotide sequence
[0149] ATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGAGGCAGCGCGG CTATCGTGGCTGCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCAT TCGACCACCAAGCGAAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGA AAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGA
[0150] Although embodiments of the invention have been disclosed for illustrative purposes, those skilled in the art will understand that various substitutions, variations, and modifications are possible without departing from the spirit and scope of the invention and the appended claims. Therefore, the scope of the invention is not limited to the contents disclosed in the embodiments.
Claims
1. An engineered strain of Schizochytrium that promotes β-carotene production by knocking out transcription factors, characterized in that: The engineered strain was obtained by knocking out the transcription factor A1189 gene and the A9257 gene on the genome of Schizochytrium HX-308, respectively, to achieve global regulation of the metabolic flux of Schizochytrium at the cellular level and promote the accumulation of β-carotene in Schizochytrium. The nucleotide sequence of the A1189 gene is SEQ ID NO.1, and the nucleotide sequence of the A9257 gene is SEQ ID NO.
2.
2. The engineered strain of Schizochytrium according to claim 1, characterized in that: The preservation number of the Schizochytrium HX-308 is CCTCC No. M209059.
3. The engineered strain of Schizochytrium according to claim 1 or 2, characterized in that: The engineered strains are Schizochytrium △A1189 and △A9257. The β-carotene titers of the engineered strains Schizochytrium △A1189 and △A9257 are 1.3 times and 3.9 times higher than those of the wild-type Schizochytrium HX-308, respectively.
4. The use of the engineered strain of Schizochytrium as described in any one of claims 1 to 3 in the production of β-carotene.
5. A method for producing β-carotene by fermentation using the engineered strain of Schizochytrium as described in any one of claims 1 to 3, characterized in that: Includes the following steps: The engineered strain of Schizochytrium was taken from the preservation tube and cultured in seed culture medium at 28 ℃ and 170 rpm / min. It was subcultured once every 24 hours for a total of two subcultures. The third generation seed culture was then transferred to fermentation medium. After 7 days of fermentation, the fermentation was stopped, and β-carotene was obtained.
6. The method according to claim 5, characterized in that: The seed culture medium is: Glucose: 50 g / L, Potassium dihydrogen phosphate: 4 g / L, Yeast extract: 4 g / L, Sodium sulfate: 20 g / L, Magnesium sulfate heptahydrate: 4.6 g / L, Ammonium sulfate: 4.8 g / L, Sodium chloride: 1.25 g / L, Potassium chloride: 1 g / L, Monosodium glutamate: 20 g / L, 0.1% trace elements, Vitamin B1 0.5 mg / L, Vitamin B6 0.5 mg / L, Vitamin B2 12 0.25 μg / L; of which, 0.1% trace elements include: zinc sulfate heptahydrate: 0.001 g / L, copper sulfate pentahydrate: 0.001 g / L, boric acid: 0.001 g / L, ammonium sulfate: 0.5 g / L, manganese sulfate monohydrate: 0.001 g / L, sodium manganate monohydrate: 0.001 g / L; The fermentation medium was as follows: glucose: 10 g / L, potassium dihydrogen phosphate: 4 g / L, yeast extract: 4 g / L, sodium sulfate: 12 g / L, magnesium sulfate heptahydrate: 2 g / L, ammonium sulfate: 4 g / L, sodium chloride: 0.5 g / L, potassium sulfate: 0.7 g / L, calcium chloride: 0.15 g / L, monosodium glutamate: 20 g / L, 0.1% trace elements, vitamin B1 0.5 mg / L, vitamin B6 0.5 mg / L, vitamin B2... 12 0.25 μg / L; of which 0.1% trace elements are: zinc sulfate heptahydrate: 8 g / L, magnesium chloride tetrahydrate: 8 g / L, cobalt chloride hexahydrate: 0.1 g / L, sodium manganate dihydrate: 0.1 g / L, copper sulfate pentahydrate: 6 g / L, nickel sulfate hexahydrate: 6 g / L, ferrous sulfate heptahydrate: 20 g / L; When preparing solid culture media, all of the above media should have 1.5% agar added.